Download Hepatitis C Virus Infection Involves CD34

From www.bloodjournal.org by guest on July 31, 2017. For personal use only.
Hepatitis C Virus Infection Involves CD34 1 Hematopoietic Progenitor Cells
in Hepatitis C Virus Chronic Carriers
By Domenico Sansonno, Claudio Lotesoriere, Vito Cornacchiulo, Massimo Fanelli, Pietro Gatti, Giuseppe Iodice,
Vito Racanelli, and Franco Dammacco
Although hepatitis C virus (HCV) mainly affects hepatocytes,
infection is widespread and involves immunologically privileged sites. Whether lymphoid cells represent further targets
of early HCV infection, or whether other cells in the hematopoietic microenvironment may serve as a potential virus
reservoir, is still unclear. We studied whether pluripotent
hematopoietic CD341 cells support productive HCV infection
and can be used to establish an in vitro infection system for
HCV. Six patients were selected as part of a cohort of HCV
chronic carriers who developed a neoplastic disease. Reverse transcriptase-polymerase chain reaction (RT-PCR) and
branched DNA signal amplification assays were used to
detect and quantitate HCV RNA in extracted nucleic acids
from purified bone marrow and peripheral blood CD341 cells.
Direct in situ RT-PCR, flow cytometry analysis, and immunocytochemistry were applied to demonstrate specific viral
genomic sequences and structural and nonstructural virusrelated proteins in intact cells. Results indicated that both
positive and negative HCV RNA strands and viral proteins
were present in CD341 cells from all HCV-positive patients
and in none of the controls. Additional experiments showed
that a complete viral cycle took place in CD341 cells in vitro.
Spontaneous increases in viral titers indicated that virions
were produced by infected hematopoietic progenitor cells.
To further define the cellular tropism, we attempted to infect
CD341 cells in vitro. We were unable to demonstrate viral
uptake by cells. These findings suggest that HCV replication
can occur in the early differentiation stages of hematopoietic
progenitor cells, and that they may be an important source
of virus production.
r 1998 by The American Society of Hematology.
T
seems attributable to HCV’s ability to mutate rapidly and exist
simultaneously as a series of related but immunologically
distinct variants (quasi-species nature).10,11 Several studies have
provided convincing evidence for the occurrence of HCV
productive infection in both bone marrow (BM) and peripheral
blood mononuclear cells (PBMC)12 and in lymphoid organs,13
which may thus serve as major HCV reservoirs.
The susceptibility of B-, T-, and monocyte/macrophage cell
lines to HCV infection has been demonstrated by the observation of polymerase chain reaction (PCR)-driven HCV specific
sequences.12 These findings have been corroborated by in situ
hybridization techniques showing both positive- and negativepolarity HCV genomic strands in circulating and/or BMrecruited mononuclear cells.14-16 However, it remains unclear
whether PBMC are the principal targets of early HCV infection
in hematologic tissue, or whether other cells within the hematopoietic microenvironment may also serve as potential virus
sites. In particular, it would be of interest to determine whether
early hematopoietic CD341 progenitor cells17 are also susceptible to infection.
Data from the present study indicate that hematopoietic
progenitor cells may indeed be an additional HCV infection site
and provide a better understanding of the cellular tropism of
HCV.
HE CLINICAL COURSE of a viral infection reflects the
fluctuating balance between the capacity of the virus to
replicate and spread and the ability of the host to eliminate it.
Persistence of a virus is evidence of its ability to escape the
host’s immune surveillance through the exploitation of several
strategies, including integration into the host genome,1 silencing
of viral gene expression,2 inhibition of antigen processing and
presentation,3,4 synthesis of proteins homologous to known
immune regulatory molecules,5 mutations that either inhibit
viral responsiveness to antiviral cytokines or preclude recognition by neutralizing antibodies3 or else modify residues that are
critical for recognition by the major histocompatibility complex
(MHC),6 or the T-cell receptor.7 A further defense mechanism is
direct infection of immunologically priviliged sites that cannot
be reached by virus-specific T cells or that do not express class I
or costimulatory molecules.8
Hepatitis C virus (HCV) infection is characterized by its
striking tendency to become chronic in a high proportion of
patients. A 70% to 80% range of persistent infection has been
documented by detection of HCV RNA.9 This persistence
From the Department of Biomedical Sciences and Human Oncology,
Section of Internal Medicine and Clinical Oncology, University of Bari
Medical School, Bari, Italy.
Submitted August 27, 1997; accepted June 21, 1998.
Supported in part by the Finalized Project ‘‘Clinical Applications of
Oncologic Research,’’ National Research Council, Rome (Contract No.
92.02269.PF39), by ‘‘Associazione Italiana per la Ricerca sul Cancro’’
(AIRC), and by a grant from Italian Ministry of University and Scientific
and Technological Research, group ‘‘Liver Cirrhosis and Viral Hepatitis.’’ V.C. is the recipient of a fellowship from AIRC.
Address reprint requests to Franco Dammacco, MD, Department of
Biomedical Sciences and Human Oncology, University of Bari Medical
School, Policlinico, P.zza G. Cesare, 11, 70124 Bari, Italy.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734 solely to indicate
this fact.
r 1998 by The American Society of Hematology.
0006-4971/98/9209-0021$3.00/0
3328
MATERIALS AND METHODS
Patients. Six patients were recruited from a cohort of consecutive
human immunodeficiency virus (HIV)-negative patients referred to the
Department of Biomedical Sciences and Clinical Oncology of the
University of Bari because of chronic HCV infection and a neoplastic
disease. In four of them, non-Hodgkin’s lymphoma (NHL) was
diagnosed from routinely stained sections prepared from formalin-fixed
paraffin-embedded surgical biopsy samples and classified according to
the International Working Formulation.18 Immunophenotypic analyses
using routine procedures, including the study of antigens associated
with B cells, T cells, plasma cells, natural killer cells, monocytes/
macrophages, and granulocytes, were performed on snap-frozen tissues.
Light chain restriction of surface IgG, IgA, IgM, and DNA and RNA
extraction studies were performed by standard procedures. DNA
analyses included Southern blotting and molecular hybridization to
Blood, Vol 92, No 9 (November 1), 1998: pp 3328-3337
From www.bloodjournal.org by guest on July 31, 2017. For personal use only.
HCV INFECTION OF CD341 CELLS IN HCV CARRIERS
3329
detect Ig gene rearrangement; assessment of B-cell clonality by VDJ
PCR19; sensitive analysis for Epstein-Barr virus and human herpes
virus-6 genomes by PCR.20 NHL patients underwent liver biopsy and
iliac crest BM needle biopsy. In the remaining two patients, colon
carcinoma and gastric carcinoma were diagnosed respectively, and liver
biopsies were performed during laparotomy.
All were hepatitis B surface antigen (HBsAg) and hepatitis B virus
(HBV)-DNA negative, although four patients had antibodies to hepatitis
B surface (HBs) and hepatitis B core (HBc) and one had antibodies to
HBc alone. Organ- and nonorgan-specific autoantibodies were not
detected. Two patients had received a blood transfusion many years
earlier.
In all patients, clinical evaluation and biochemical and hematologic
testing was performed at 3-month intervals during the follow-up for
liver disease (mean, 9.1 6 1.86 years). The presence of anti-HCV
antibodies was confirmed by recombinant immunoblot assay (RIBA-2;
Ortho Diagnostic Systems, Raritan, NJ). At the time of diagnosis of
NHL, two patients were receiving interferon treatment (9 MU/wk). The
controls were four patients with NHL and negative serology for
anti-HCV antibodies and HCV RNA. The main clinical, histologic, and
virologic features of patients and controls are summarized in Table 1.
The study was approved by the ethical committee of the University
of Bari Medical School and informed consent was obtained from all
patients and controls.
CD341 cell mobilization, isolation, and purification. CD341 cell
mobilization was achieved by injecting patients with granulocyte
colony-stimulating factor (G-CSF), given at a daily dose of 10 µg/kg.
Injections were repeated for 6 to 7 days before the apheresis and BM
aspiration. Leukocyte subsets were monitored frequently (every 1 to 3
days) until the end of the apheresis procedure. In all of the cases,
leukapheresis was started when the absolute number of circulating
CD341 cells exceeded 10/µL. After volume reduction by centrifugation,
each leukapheresis product was frozen in 1-3 DF 700 freezing bags
(Gambro, Leuven, Belgium). The freezing medium consisted of 4%
(wt/vol) human serum albumin and 7.5% (vol/vol) dimethylsulfoxide in
0.9% NaCl. All bags were frozen in a controlled rate freezer and stored
in liquid nitrogen (2196°C).
For collection of peripheral blood CD341 cells, an automated dual
chamber computer-assisted continuous flow blood cell separator (Bax-
ter CS 3000; Baxter Healthcare Co, Deerfield, IL) was used, using a
preattached solution in a closed system kit. Common parameters
included blood flow (60 mL/min), anticoagulation (ACD-A 500 to 700
mL), volume of processed blood (7.5 L), and rotating speed (1,400
rpm).
BM mononuclear cells and aliquots of the leukapheresis products
were washed with RPMI 1640, separated by density gradient centrifugation over Ficoll-Hypaque (Pharmacia, Uppsala, Sweden), washed twice,
suspended in Iscove’s modified Dulbecco’s medium (IMDM)/20% fetal
calf serum (FCS), and cultured overnight to remove adherent cells.
The CD341 mononuclear cell fraction was isolated by sequential
immunomagnetic bead selection using the Dynal CD34 progenitor cell
selection system (code 113.01/113.02 from Dynal A.S., Oslo, Norway).
This reagent contains paramagnetic-polystyrene beads coated with
monoclonal antibody (MoAb) 561 specifically directed against class III
epitope on the CD34 antigen.21 Flow cytometry analysis showed that
CD34 selection in the final product ranged from 81% to 96% with a
mean of 92.3%.
CD341 cell cultures and lymphocyte subpopulations. Adherent BM
stromal cells were recovered after enzymatic digestion, washed twice
with RPMI 1640/10% FCS in medium, and seeded into flasks. They
were then expanded by several passages. The medium was changed
every week. CD341 cells (0.5 3 106 per well) were added to the
washed, stromal feeder layer and cultured for a further 2 to 4 weeks in
IMDM/20% FCS. Control cultures included no stroma or stroma alone.
Cultures were half-refed with complete medium twice weekly.
Positive selection of CD201, CD41, and CD81 cell fractions was
performed using the same type of magnetic beads (Dynal) already
described, coated with the corresponding MoAbs.
Flow cytometry analysis. CD341 cell cultures were obtained by
gentle aspiration, washed twice in phosphate-buffered saline (PBS), and
stained with the following murine MoAbs against HCV: (1) anti-c22-3
antibody (clone 4,6 E7-F6), recognizing amino acids (AA) 29-43 of the
core protein at a concentration of 0.9 µg/mL; (2) antienvelope glycoprotein 2 (E2)/nonstructural protein 1 (NS1) antibody (clone 15-B4-C7),
recognizing a conformational antigen of E2/NS1-encoded protein of
HCV-1 strain at a concentration of 1.5 µg/mL; (3) anti-c33c antibody
(clone 1,4 G11-B4G10), recognizing a structural determinant in the
NS3-encoded protein at a concentration of 1.0 µg/mL; (4) a mixture of
Table 1. Clinical, Histological, and Virological Parameters in HCV Chronic Carriers and Controls
HCV Status
Neoplastic Disease
Patients
Age/
Sex
Type
Histology
PCR-Driven HCV RNA
Liver Disease
Working
Formulation
Staging
Duration
Antibody Pattern
Serum/ Lymph Liver
Histology
(yr)
(5-1-1/c100-3/c33/c22) Genotypes Nodes Tissue BM
1
66/F NHL
B
IIB
CH
12
2
2
1
1
1/1b
1
1
1
2
77/F
H
IIA
CH
17
2
2
2
1
1/2a
1
1
1
3
59/M
G1A
IA
CIR
21
1
1
1
1
1/1b
1
1
1
4
5
6
Controls
1C
2C
65/M
56/M
61/M
G
IIA
T2, N2, M0
T2, N1, M0
CH
CIR
CIR
11
25
22
2
2
1
2
1
1
1
1
1
1
1
1
1/1b
1/1b
1/1b
1
ND
ND
1
1
1
1
ND
ND
G
A
IIB
IB
NNL
ST
—
—
2
2
2
2
2
2
2
2
2
2
2
2
2
2
2
2
G
B
IIA
IIA
ST
NNL
—
—
2
2
2
2
2
2
2
2
2
2
2
2
2
2
2
2
3C
4C
Follicular small
cleaved cells
NHL
Large cells immunoblastic
NHL
Mixed: Small
cleaved/large
cells
NHL
Diffuse large cells
Colon carcinoma Adenocarcinoma
Gastric carcinoma Adenocarcinoma
59/F NHL
69/F NHL
75/M NHL
68/M NHL
Diffuse large cells
Small lymphocytic
Diffuse large cells
Follicular small
cleaved cells
—
—
Abbreviations: CH, chronic hepatitis; NNL, near normal liver; CIR, cirrhosis; ST, steatosis; ND, not determined.
From www.bloodjournal.org by guest on July 31, 2017. For personal use only.
3330
three anti-c100-3 antibodies, namely clone 2C4G3 recognizing AA
1690-1696; clone 22A5B12 recognizing AA 1694-1711, and clone
20A6F3 recognizing a linker sequence at the junction of superoxide
dismutase (SOD) and HCV sequences in the NS4-encoded protein.
Protein concentration in the working mixture of each MoAb was 1.0
µg/mL; (5) anti-NS5 antibody (clone 1A6B7), recognizing AA 22782310 of NS5-encoded protein was used at a protein concentration of 1.2
µg/mL. Immunochemical characteristics and fine specificities of these
reagents have been reported elsewhere.13,22
After a 1-hour incubation at 37°C, the cells were pelleted, washed
with PBS, and reincubated with fluorescein isothiocyanate (FITC)conjugated antimouse immunoglobulin F(ab8)2 fragment (Boehringer
Mannheim, Mannheim, Germany; code 1.214.616). A parallel number
of cells fixed with 4% paraformaldehyde were analyzed for each
unfixed sample.
CD341 immunophenotype was detected by a pool of phycoerythrin
(PE)-labeled anti-CD34 MoAbs (Immunotech, Marseille, France; code
1459), which contained optimized proportions of the following three
MoAbs: QBend-10 directed to CD34 class II epitopes and Immu-33 and
Immu-409 specific for different CD34 class I epitopes. Omission of the
first antibody in indirect assay or PE-conjugated isotype-matched
nonspecific mouse immunoglobulins were used as controls in each
culture sample. CD341 mononuclear cells recovered from HCV2
patients acted as a further control. Flow cytometric analysis was
performed with a FACScan cytometer (Becton Dickinson, Sunnyvale, CA).
For double-staining, cell suspensions were stained with the following
antibody combinations: anti-CD34 conjugated with PE (Immunotech)
and anti-HCV (E2/NS1 protein, clone 15-B4-C7) conjugated with
FITC.
Immunocytochemical staining. After harvesting, CD341 cells were
washed twice in PBS, resuspended at 1 3 105/mL, dried onto glass
coverslips, and fixed for 15 minutes at 220°C with 100% acetone
followed by 100% methanol. After extensive washings, adherent
stromal cells were similarly fixed. After rehydration, cells were
incubated with anti-HCV MoAbs (see above) and then with affinitypurified sheep IgG, F(ab8)2 fragment to mouse Ig conjugated to alkaline
phosphatase (APh) (Boehringer, code 1.198.661). Unbound antibody
was washed off by immersing the slides in 0.1 mol/L Tris-HCl buffer pH
7.4 containing 0.15 mol/L NaCl, followed by 0.1 mol/L Tris-HCl pH 9.5
containing 0.1 mol/L NaCl and 0.05 mol/L MgCl2. Levamisole (0.15
mg/mL) was added to the APh substrate (4-chloro-2-methylbenzenediazonium/3-hydroxy-2-naphthoic acid 2,4-dimethyl-anilide phosphate) at
1 mg/mL to block endogenous APh.
Specificity of HCV staining patterns was assessed on selected
positive samples before and after absorption of the probe with
recombinant proteins (1 mg/mL) derived from the equivalent structural
and nonstructural regions of HCV genome. Recombinant SOD and
HBV-associated antigens (HBsAg, HBcAg) and hepatitis A virus
(HAV) antigen were included in these experiments as controls. Efficiency
of absorption was shown by testing the probes before and after
absorption for antigen reactivities with commercially available RIBA.
Replacement of primary antibody with an irrelevant antibody (mouse
antihuman chorionic gonadotropin [HCG] MoAb) was also performed.
CD34 antigen was detected both directly by incubating the section
with polystyrene beads coated with anti-CD34 MoAb (Dynal A.S.), and
indirectly with an anti-CD34 MoAb (clone QBend-10, Immunotech)
followed by antimouse Ig/APh (Boehringer Mannheim). Omission of
the first antibody and mouse isotypic antibody recognizing an irrelevant
epitope (IgG1 anti-HCG antibody) acted as the controls.
RT-PCR assay for HCV RNA and HCV genotyping. RNA was
extracted according to Chomczynsky and Sacchi.23 The RNA pellet was
washed in 75% ethanol and resuspended in 20 µL of diethylpyrocarbonate–treated autoclaved H2O. The total RNA yield was
determined by spectrophotometry and processed for HCV RNA detec-
SANSONNO ET AL
tion by RT-PCR assay, as described elsewhere.24 Primers were selected
from the 58-noncoding (NC) region of the HCV genome.
To characterize the HCV genotypes, biotinylated universal primers
referred to the 58-NC region were used to amplify and hybridize to
genotype-specific probes (Line Probe assay, LiPA HCV II; Innogenetics, Brussels, Belgium). Each sample was tested in triplicate, and
appropriate positive and negative controls were always included.
Negative strand-specific RT-PCR. Negative-polarity strand HCV
RNA sequences, presumably representing replicative intermediates,
were detected by RT-PCR with two sets of primers aimed at specifically
priming and amplifying HCV negative strand RNA.25 One of them
contained at the 58 end a tag sequence unrelated to HCV genome
(TAG-based assay). The second was located in the nucleocapsid of viral
genome outside the highly structured 58-NC region (CAP-based assay).
Conditions for the amplification of negative strand templates, their
specificity, and sensitivity were those described for the ‘‘TAG-based’’
assay by Lanford et al26 and for the CAP-based assay by Lerat et al.27
HCV2 strands were analyzed in CD341 cells obtained from patients
5 and 6. Following the above-described Dynal protocol, CD341 cell
fractions were further purified with a microbeads system (MACS;
Miltenyi Biotec Inc, Auburn, CA). After removal of magnetic beads
from CD341 cells using the detachment system (Detach-a-Bead CD34
No. 113.01/02; Dynal), cells were relabeled specifically with supermagnetic MACS microbeads coated with anti-CD34 MoAb (clone QBend10) and passed through a separation column placed in a strong
permanent magnet. Thus, only the magnetically labeled CD341 cells
were retained in the column and then recovered after removal of the
column from the magnetic field. By sequentially applying these two
methodologies, which combine the use of anti-CD34 antibodies directed against different epitopes on CD34 antigen, almost 100% pure
CD341 cells were obtained.
HCV RNA quantitation. HCV RNA was quantitated by signal
amplification using branched DNA (bDNA) in a sandwich hybridization
assay,28 according to the manufacturer’s instructions (Quantiplex HCV
RNA, Version 2.0; Chiron Corp, Emeryville, CA). Duplicate 50-µL
samples were added to the wells in which lysis, hybridization, capture,
and signal amplification occurred. Synthetic oligonucleotides, in a
mixture which included probes that mediated capture and probes that
bound to the bDNA amplifier molecule, hybridized equally well to the
highly conserved 58-NC and core regions of the HCV RNA of all known
genotypes, thereby capturing the RNA molecules onto the surface of a
microwell plate and linking to synthetic bDNA molecules added to the
well. Multiple copies of an APh-linked synthetic probe hybridized to the
immobilized complex, thereby amplifying the target signal. Detection
was achieved by incubating the complex with a chemiluminescent
substrate (dioxetane) and measuring light emission, which was proportional to the concentration of target nucleic acid in the specimen. The
standard curve was based on a diluted sample from a patient with HCV
infection whose serum had been quantitated by comparison with
synthetic HCV RNA. Because the values assigned to the HCV RNA
standards were based on comparison with highly purified RNA transcript covering the first 3,200 nucleotides from the 58 end of the HCV
genome, the results were expressed as genomic equivalents per mL
(Eq/mL) rather than genomic copies. The lower limit of sensitivity of
this assay was 0.2 million Eq/mL (MEq/mL). HCV genomic equivalents were divided by the number of the cells and results expressed as
HCV Eq/cell when considering HCV RNA extracted from cultured
cells.
Direct in situ RT-PCR (IS-RT-PCR). CD341 cells, washed with
PBS to remove all traces of culture medium, were centrifuged onto
silane-coated microscope slides (Perkin-Elmer, Foster City, CA; code:
804-0502). A mild acid hydrolysis was performed by incubating the
slides in 0.02 mol/L HCl for 10 minutes. After repeated washings in
PBS, cells were immersed in 0.01% Triton-X 100 in PBS for 2 minutes,
transferred to a Coplin jar containing proteinase K (Boehringer
From www.bloodjournal.org by guest on July 31, 2017. For personal use only.
HCV INFECTION OF CD341 CELLS IN HCV CARRIERS
Mannheim) in 0.1 mol/L Tris-HCl pH 7.5, 5 mmol/L EDTA, and placed
in a microwave oven for 10 minutes. Microwaves were pulsed through
the jar until boiling for 5 minutes. To further reduce the levels of
endogenous APh, the slides were dipped in acetic acid at 4°C for 1
minute. They were then transferred to PBS and digested with RNasefree DNase (Boehringer Mannheim) at 37°C at 1 U/mL overnight. After
washings in PBS and nuclease-free water, the slides were dehydrated
through graded ethanols to 100%. RT-PCR was performed with one
enzyme under a single set of buffer conditions using DNA polymerase
from Thermus thermophilus (Tth) (Perkin-Elmer; code N808-0097),
which possesses RT activity in the presence of manganese. RT-PCR
mixture contained 200 mmol/L (each) deoxyribonucleoside triphosphates (deoxyadenosine triphosphate [dATP], deoxycytidine triphosphate [dCTP], deoxyguanosine triphosphate [dGTP], and deoxythymidine triphosphate [dTTP]), 2.5 mmol/L digoxigenin (DIG)-linked
11-deoxyuridine 58-triphosphate (dUTP) (Boehringer Mannheim), 2.5
mmol/L manganese acetate [Mn(OAc)2], 5 U recombinant Tth DNA
polymerase, 2.5 U RNasin (Promega, Madison, WI), 150 mmol/L of
each primer (JHC 51, antisense: CCCAACACTACTCGGCTA; JHC93
B, sense: ACCATGAATCACTCCCCT) from the highly conserved
58-NC of HCV genome,29 and 13 RT-PCR buffer (53 RT-PCR buffer
consists of 250 mmol/L Bicine, 575 mmol/L potassium acetate, 40%
glycerol, pH 8.2; Perkin-Elmer, code 808-0177). The reactions were
performed in an Omnislide Thermal Cycler (Hybaid Limited, Middlesex, UK), and slides were assembled with amplicover clips (PerkinElmer; code N804-0501).
RT was allowed to proceed for 60 minutes at 70°C, followed by
1-minute incubation at 95°C to facilitate denaturation. PCR amplification was performed with two cycles at 95°C for 2 minutes followed by
38 cycles at 95°C for 1 minute, and a combined annealing and extension
step for 1 minute at 60°C and 72°C. A final extension step of 7 minutes
at 72°C followed the last PCR cycle. At the end of the cycling, the slides
were washed in 23 SSC (13 SSC: 0.15 mol/L sodium chloride and
0.015 mol/L sodium citrate) at 60°C for 5 minutes and then in PBS for 2
minutes. Slides were dipped in 0.1 mol/L Tris-HCl, pH 7.5, 0.1 mol/L
NaCl, 2 mmol/L MgCl2, 0.05% Triton-X 100 for 30 minutes. DIGlabeled PCR product was detected by incubating the slides with
anti-DIG antibody conjugated with APh (Boehringer Mannheim) and
the signal detected by nitroblue tetrazolium (NTB; 340 µg/mL) and
5-bromo-4-chloro-3-indolyl phosphate (BCIP; 170 µg/mL) (Boehringer
Mannheim) substrate.
IS-RT-PCR procedure included the following controls: (1) CD341cells
from HCV RNA-negative patients; (2) RT-PCR solution phase on
nucleic acids extracted from CD341 cells from each patient; (3)
RT-PCR on cell suspensions containing a known number of CD341
cells from HCV RNA-positive patients mixed with CD341 cells from
HCV RNA-negative patients; (4) addition of RNase to remove target
RNA; (5) omission of specific primers, enzyme, nucleotides, Mn(OAc)2,
or anti-DIG antibody; (6) reference control gene-specific primers to
amplify 308-bp sequence complementary to interleukin-1a (IL-1a) site
insert from pAW109-derived cDNA (Perkin-Elmer; code N0808-0037);
(7) IS-RT-PCR efficiency, analyzed by targeting b-actin mRNA; sense:
58ACACTGTGCCCATCTACCTAGGGG38; antisense: 58ATGATGGAGTTGAAGGTAGTTTCGTGGAT38.
In vitro HCV infection. Primary CD341 hematopoietic precursors
from either BM or peripheral blood were seeded at 1 3 105 cells per
well and inoculated with undiluted serum #0715 containing 2 3 10
HCV MEq/mL (genotype 1b). This inoculum was selected because it
contained a high genomic titer and was capable of establishing a
productive HCV infection in MOLT-4 cells, a human T-cell line
(American Type Culture Collection, Rockville, MD). A total of 1 mL of
#0715 inoculum together with 3 mL of fresh culture medium was
incubated for 24 hours at 37°C. Cells were then washed and fresh
medium was added, followed by continued incubation with medium
changes at 4-day intervals. At various times during the culture period,
3331
culture medium (0.25 mL) and cells (105 cells) were collected for HCV
RNA detection and titration.
RESULTS
Experiments were designed to detect the presence of HCV
RNA in CD341 cells. Suspensions containing positivelyselected CD341 cells from BM and/or peripheral blood were
collected during a single apheresis procedure, and extracted
RNA was processed to demonstrate sequences of HCV genome.
Data reported in Table 2 provide evidence that all patients
showed HCV genomic sequences in CD341 cells. Specifically,
confirmation of negative-polarity strand HCV RNA likely
representing viral replicative intermediates was examined in
two highly purified CD341 cell products obtained from patients
5 and 6, which were found to be 99.7% and 99.1% phenotypically pure, respectively. Nested PCR using capsid-derived
primers detected a specific product at 1 3 103 HCV RNA Eq. Its
sensitivity appeared slightly reduced at 5 3 103 HCV RNA Eq
in the presence of 1 3 106 Eq of positive strand templates,
whereas it was not significantly influenced by the addition of
cellular RNA to the system. By the CAP-based assay, negative
strand intermediates were demonstrated in CD341 cells of both
patients (Fig 1). Strand-specific RT-PCR analysis was also
performed with TAG-based derived primers. Negative strand
HCV RNA was shown in one (patient 6) of the two CD341
samples. As indicated in Table 1, products of PCR-driven
amplification of 58-NC region were obtained in the serum of all
anti-HCV positive patients. Moreover, detection and distribution of HCV RNA in purified lymphocyte subsets of these
patients did not show a consistent picture, in that CD201 and/or
CD81 or CD41 subsets tested positive for HCV RNA (data not
shown).
To gain insight as to whether HCV might sustain a productive
infection in CD341 cells, the latter were incubated and seeded
in liquid culture at a concentration of 0.5 3 106 in the absence of
growth factors. HCV RNA levels were titrated daily by the
bDNA technique in cells and the corresponding supernatants.
Results from separate experiments after 5 days of culture
showed that increments of HCV genomic equivalents in the
cells paralleled those found in the supernatants at corresponding
intervals. Figure 2, which summarizes culture experiments,
shows that 0.63 6 0.24 (mean 6 standard deviation [SD])
genomic HCV equivalents per cell could be detected on the
Table 2. HCV RNA Titers Measured by Branched DNA Methodology
and HCV RNA Negative-Polarity Strand
HCV RNA
CD341 Cells
Serum
Patients
NegativePolarity
Strand*
1
2
3
4
5
6
2/2
2/2
2/2
2/2
2/2
2/2
*TAG-/CAP-derived primers.
†Branched DNA assay.
Titer†
(MEq/mL)
NegativePolarity
Strand*
Titer†
(Eq/cell)
25.5
5.34
3.4
1.43
17.20
11.71
ND
ND
ND
ND
1/1
2/1
0.74
0.80
0.31
0.40
1.06
0.33
From www.bloodjournal.org by guest on July 31, 2017. For personal use only.
3332
Fig 1. Negative-polarity strand HCV RNA and specificity of CAPbased RT-PCR assay. Products were fractionated on a 3% agarose gel
and stained with ethidium bromide. Lane B: detection of synthetic
HCV negative strand RNA generated from the vector pRTI HCV cDNA
containing HCV capsid sequences cloned into pBluescript (Stratagene, San Diego, CA).24 Lanes A, E, and G: negative control reactions
in which RNA templates were amplified in the absence of RT,
omitting specific primers, or in nucleic acids extracted from CD341
cells of a HCV-negative control, respectively. Lanes C and D: RT-PCR
products for negative strand HCV RNA amplified from highly purified
samples of CD341 cells from patients no. 5 and 6, respectively. Results
were confirmed after Southern blotting (inserted panel). A total of 1
mg of RNA extracts prepared from CD341 cells was used along with
250 ng outer sense primer (58CCAAAACCCCAAAGAAA38, position:
750) for cDNA synthesis. Resulting cDNA was amplified after addition
of 250 ng of the outer antisense primer (58GTACCCCATGAGGTCGGCG38, position: 355). A second PCR reaction was performed using a
set of internal primers (sense-58CAGATCGTTGGTGGAGTT38, position: 427; antisense-58CAAGCCCTCATTGCCAT38, position: 616). The
resulting product of 189 bp was probed after Southern blotting using
a P32-labeled oligomer (58GGTCGCAACCTCGAGGTAGACGTCAGCCT38, position: 506). Lane F: molecular markers (HaeIII-digested
fX174). Predicted size of amplified fragment is indicated in base pair
(bp).
SANSONNO ET AL
starting day, whereas no viral RNA could be demonstrated in
the supernatant. Significant progressive increases of viral RNA
concentrations were shown during the culture period, and 5
days later, the number of viral Eq/cell was more than duplicated
(2.11 6 0.74). Remarkable changes were also shown in the
supernatants, in that 0.84 6 0.42 HCV RNA MEq/mL were
found on day 5.
Data from cells and supernatants suggested that CD341 cells
contained viral particles and expressed a complete viral cycle.
The time-dependent increase in viral titers strongly indicated
that the virions present in the culture fluid were actually
produced by infected cells. After 5 days, infected cultures
compared with noninfected cultures differed neither in terms of
number of CD341 cells nor of viable cells. To assess whether
cells in which HCV was suspected to replicate still expressed
the CD34 antigen, cells were restained with anti-CD34 MoAbs
and separated into CD341 and CD342 cells. Molecular analysis
showed that CD341 and CD342 cells both expressed viral RNA
in five of six patients. No difference in cell morphology and
viability was found between the two fractions.
The presence of HCV RNA genomic sequences within
CD341 cells was demonstrated morphologically by using a
PCR-driven in situ hybridization technique. Intracellular RNA
sequences were preserved in situ while the cell membrane was
permeabilized with proteinase K. Specific intracellular viral
RNA was amplified by a PCR protocol in which DIG-11-dUTP
was used to obtain a DNA product that remained in situ.
DIG-labeled dUTP incorporated into the PCR product was
detected by antidigoxigenin-APh–labeled antibody and chromogenic substrate. Controls were carefully evaluated. Positive
cells were mixed with uninfected CD341 cells at different
dilutions. Each experiment was performed in triplicate.
Amplified HCV RNA product was identified in a mixture
containing at least 1 3 104 negative cells in excess. Cytocentrifuged samples showed that the cellular morphology was
Fig 2. HCV RNA titration by
branched DNA signal amplification assay of nucleic acids extracted from CD341 cells and
their corresponding supernatants. Peripheral CD341 cells obtained from HCV-infected patients were cultured in RPMI 1640
medium supplemented with 10%
FCS. Supernatants and cells were
harvested daily for a period of 5
days.
From www.bloodjournal.org by guest on July 31, 2017. For personal use only.
HCV INFECTION OF CD341 CELLS IN HCV CARRIERS
preserved, cellular debris was minimal, and intracellular localization of PCR product was maintained. Efficiency of the
RT-PCR process was monitored by reverse transcription of
cRNA transcribed from the plasmid pAW109 containing an
insert of a synthetic linear array of primer sequences for the
IL-1a site. Sensitivity was further evaluated by targeting in situ
b-actin mRNA constitutively present in PBMC and showing
that more than 95% of them were positive. Analysis of viral
accumulation in the cell compartments showed that the signal
corresponding to HCV-specific 240-bp amplicon was detected
in the cytoplasm of CD341 cells from all patients (Fig 3A) and
in none of the controls. Albeit with different intensity, a large
proportion of CD341 cells were positive ranging from 36% to
65% (mean, 53.8 6 25.1) of purified fractions.
Morphologic evidence for the cellular accumulation of HCV
proteins was provided by immunocytochemistry on cultured
CD341 cells. Cells were tested with a large panel of MoAbs
covering structural (core, E2/NS1 proteins) and nonstructural
(NS3, NS4, NS5 proteins) encoding regions of the HCV
genome. Results showed that antigens were detected as diffuse
and homogeneous immune reactants within cytoplasmic compartments of CD341 cells (Fig 3B and C). Immunoreactive cells
rarely displayed granular submembrane deposits. Cell nuclei
were persistently negative. Immunostaining was considered
specific, as there was no reaction with CD341 cells from
HCV-unrelated controls, or with HCV-related samples after
substitution of the primary antibody mixture. Preabsorption of
the reagents with specific recombinant antigens abolished the
signal (Fig 3D), with a parallel loss of reactivity in immunoblotting. The proportion of HCV-infected CD341 cells ranged from
9% to 33% (mean, 19.2 6 14.7) in the different purified
preparations.
Morphologic studies on the coexpression of CD34 antigen
and HCV structural protein (E2/NS1) using two different
fluorochromes demonstrated a cytoplasmic colocalization of
both reactivities (Fig 3E and F). With this methodology,
however, the frequency of HCV-positivity in CD341 cells was
somewhat lower (9.2% 6 4.7%).
To determine whether viral protein translation was a regular
and effective process following transcription of viral genes in
CD341 cells, core and E2/NS1 protein-related epitopes were
analyzed by flow cytometry (Fig 4). CD341 cells were enumerated by flow cytometry in the apheresis products with and
without Ficoll-Hypaque centrifugation. The percentage of
double-stained cells approximately reflected that found with
immunohistochemistry in cytocentrifuged samples, in that
almost one fourth of CD341 cells (25.12% 6 17.88%) coexpressed HCV proteins. For cytoplasmic staining, CD341 cells
were previously fixed in 4% formaldehyde solution and resuspended in acetone. The presence of intracytoplasmic core and
E2/NS1 epitopes occurred less frequently than that found for
surface staining (16.8 6 15.2 v 48.6 6 31.9), respectively.
These results led us to investigate whether CD341 cells could
be infected in vitro. CD341 cells from anti-HCV, HCV RNAnegative patients were inoculated with undiluted serum #0750,
which was known to contain a high titer HCV and to be
extremely efficient in infecting the MOLT-4 cell line. Results
were negative in all experiments, performed under different
conditions, including the addition of feeder layers obtained
3333
from BM stromal cells and growth factors (IL-2, G-CSF,
g-interferon) (data not shown). Samples from cells and supernatants failed to show viral RNA genomic sequences after 4 weeks
of culture.
DISCUSSION
Our results demonstrate that HCV-harboring CD341 cells are
a consistent biological feature in chronic HCV carriers. The
following evidence points to productive infection of CD341
cells by HCV: (1) detection of negative-polarity strand of viral
RNA by RT-PCR amplification on nucleic acids extracted from
highly purified CD341 cell populations; (2) in situ demonstration of HCV RNA on intact cells; (3) detection of HCV-related
structural and nonstructural proteins by flow cytometry analysis, immunocytochemistry, and immunofluorescence; and (4) an
apparently complete extent of the viral cycle in cultured CD341
cells.
Separation of CD342 from the CD341 cell fraction showed
that HCV infection occurs in both cells that do and do not
express CD34 antigen, suggesting that HCV infection is not
restricted to a CD341 subset. In addition, it was demonstrated
that other hematopoietic lineages including B- and T-cell
subsets may be infected with HCV, as already reported.12,14-16
The presence or absence of HCV RNA within PBMC did not
correlate with any specific profile of serum or histologic
markers. During the purification of CD341 cells and lymphocyte subsets, the last washing was tested for HCV RNA. In
every instance, no PCR product was detected, suggesting that
the HCV RNA signal detected in the cells was not due to plasma
contamination. The presence of both positive- and negativepolarity HCV RNA strands in CD341 cells and only the positive
HCV RNA strand detected in the corresponding serum reflects
the specificity of the RT-PCR products. Furthermore, the
uneven distribution of HCV RNA in the blood mononuclear cell
subsets in the same patient is consistent with the specific nature
of the signal.
In vitro experiments indicated that HCV-infected BM and
peripheral blood hematopoietic progenitors did not show obvious morphologic abnormalities when compared with noninfected CD341 cells. Furthermore, the percentages of viable
cells after many days of liquid culture were not significantly
different between infected and noninfected CD341 cells. These
data support the contention that HCV infection has little or no
effect on the proliferation and differentiation of CD341 cells.
They also suggest that, although HCV infection occurs in the
early steps of blood progenitor differentiation, it does not result
in viral-induced myelosuppression. These considerations are in
good accordance with clinical studies showing that HCV is not
directly responsible for hepatitis-associated aplastic anemia.30
However, the biological significance of these findings is still
uncertain, and their impact on the clonogenic differentiation of
infected CD341 cells should be directly investigated.
Our experiments showed that CD341 cells are not susceptible
to HCV infection in vitro. None of the variations in the culture
conditions tested, including different concentrations of the virus
and the presence of a variety of growth factors or different
accessory cells, resulted in susceptibility to HCV infection.
These observations raise the possibility that several mechanisms, acting alone or in combination, could mediate HCV
From www.bloodjournal.org by guest on July 31, 2017. For personal use only.
3334
SANSONNO ET AL
Fig 3.
From www.bloodjournal.org by guest on July 31, 2017. For personal use only.
HCV INFECTION OF CD341 CELLS IN HCV CARRIERS
3335
Fig 4. Analysis by flow cytometry of Ficoll-Hypaque–purified
leukapheresis products. Enumeration of CD341 cells in light
density cell suspension of peripheral blood labeled with anti-E2/
NS1 whose labeling to the cells
was defined by goat antimouse
Ig conjugated with FITC. Surface
(A) and cytoplasmic (B) stainings
were performed. In (C), FITClabeled isotypic control is shown.
Double-staining analysis with PEconjugated anti-CD34 antibody
followed by FITC-labeled anti-E2/
NS1 antibody is reported in (D).
Isotypic controls are indicated in
(E and F).
infection of CD341 cells in vivo, namely infection of accessory
cells necessary for maintenance and regulation of normal
hematopoiesis through the production of growth factors and
infection of stromal cells in the microenvironment interfering
with cytokine(s) production or disrupting normal stromal cellhematopoietic cell interactions.
As compared with HCV RNA-containing CD341 cells, those
expressing HCV-related antigens were significantly fewer. It is
;
Fig 3. (A) Direct in situ RT-PCR to amplify 58-NC region of HCV genome in CD341 cells. Note the complete absence of reaction in an adjoining
cell. Immunocytochemistry to detect core (B) and E2/NS1 (C) antigens in CD341 cells. In both cases a cytoplasmic appearance of immune
reactants was found. Note adhesion of the core antigen to the nuclear membrane and accumulation of E2/NS1 antigen in cytoplasmic
submembrane spaces. In (D) core reactivity was blocked by preadsorption of antibody with recombinant HCV core antigen. (E) Staining of CD341
cells with FITC-conjugated anti-E2/NS1 protein. Specific signal outlining nonfluorescent nuclei is demonstrated. (F) The same cell as described in
(E) was shown to coexpress CD34 antigen, stained with PE-labeled antibody.
From www.bloodjournal.org by guest on July 31, 2017. For personal use only.
3336
SANSONNO ET AL
clear from our experiments that differing sensitivities in the
detection of CD341 cells infected with HCV are related to the
techniques used. Immunofluorescence on cytocentrifuged
samples appears to be less sensitive as compared with immunocytochemistry and flow cytometry analysis, which gave roughly
the same frequency. These differences were particularly striking
with in situ RT-PCR, in that mispriming and incorrect priming
were carefully excluded. Indeed, a pattern of viral latency with
silencing of viral genes expression can be suggested, as already
described in hepatitis B virus (HBV) infection in which not all
cells that contain HBV DNA display HBV-related proteins.31
Because CD341 cells include self-renewing stem cells, they can
be an initial site of infection, a continuous source of virus, and
possibly a mode of dissemination.
Previous studies on liver characterization and distribution of
CD34 reactivity have indicated that anti-CD34 antibodies are
more specific and sensitive than anti-von Willebrand factor or
Ulex europeus agglutinin 1 for labeling endothelial cells.32
Moreover, it has been shown that CD34 antigen is expressed by
endothelial cells in the sinusoid-like vessels of primary liver
tumor and not by the endothelial cells in the normal sinusoids.
CD34 staining, as detected by QBend-10 clone product, in
normal liver was confined to vessels of the portal tracts and in a
few sinusoids of the periportal areas in patients with chronic
hepatitis and cirrhosis.33 Experimental studies have indeed
shown that expression of CD34 transcripts fluctuate and decrease after the birth, but increase during processes such as
wound healing or tumor growth.34 In any case, the demonstration of CD34 reactivity in the liver suggests that this organ may
retain CD341 cells and perhaps act as a hematopoietic microenvironment from the fetal period, or as a reservoir of circulating
CD341 cells still remaining in the adult organ, as already
suggested.35 Further studies are needed to recognize and
characterize the distribution of CD341 reactivity in various
tissues, in view of the evidence which indicate that it may be
involved in leukocyte adhesion and ‘‘homing’’ during inflammatory processes, as well as in the localization of progenitor cells
in the BM.17 Although the precise function of CD34 protein
remains unknown, its widespread detection is consistent with
the multiple sites of demonstration of HCV infection, namely
BM,12,16 liver,36 and endothelium.22
Whether HCV infection of CD341 cells is also related to
lymphomagenesis is an intriguing possibility37 suggested by the
fact that HCV infection in our patients preceded the appearance
of lymphoma by many years and by the demonstration of HCV
proteins in the pathologic lymph nodes.13 Indeed, HCV might
sustain indolent stages of B-cell lymphoproliferation (putatively antigen-dependent), as recently demonstrated by PCR
analysis of Ig-VH gene rearrangements using genomic DNA
derived from intrahepatic B cells of chronically HCV-infected
patients with type II mixed cryoglobulinemia.38 A common
origin from B cells selected by the triggering antigen may be
inferred in both low-grade and high-grade NHLs.39
REFERENCES
1. Whitcomb JM, Hughes SH: Retroviral reverse transcription and
integration: Progress and problems. Ann Rev Cell Biol 8:275, 1992
2. Butera ST, Roberts BD, Lam L, Hodge T, Folks TM: Human
immunodeficiency virus type 1 RNA expression by four chronically
infected cell lines indicates multiple mechanism of latency. J Virol
68:2726, 1994
3. Miyashita E, Yang B, Lam KMC, Crawford DH, Thorley-Lawson
DA: A novel form of Epstein-Barr virus latency in normal B cells in
vivo. Cell 80:593, 1995
4. McFadden G, Kane K: How DNA viruses perturb functional
MHC expression to alter immune recognition. Adv Cancer Res 63:117,
1994
5. Spriggs MK: Cytokine and cytokine receptors genes captured by
viruses. Curr Opin Immunol 6:526, 1994
6. De Campos Lima PO, Gavioli R, Zhang QJ, Wallace LE, Dolcetti
R, Rowe M, Rickinson AB, Masucci MG: HLA-A11 epitope loss in
isolates of Epstein-Barr virus from a highly A111 population. Science
260:98, 1993
7. Phillips RE, Rowland-Jones S, Nixon FD, Gotch FM, Edwards JP,
Ogunlesi AO, Elvin JG, Rothbard JA, Bangham CRM, Rizza CR,
McMichael AJ: Human immunodeficiency virus genetic variation that
can escape cytotoxic T cell recognition. Nature 354:453, 1991
8. Franco A, Ferrari C, Sette A, Chisari FV: Viral mutations, TCR
antagonism and escape from the immune response. Curr Opin Immunol
7:524, 1995
9. Alter HJ: To C or not to C: These are the questions. Blood
85:1681, 1995
10. Weiner AJ, Brauer MJ, Rosenblatt J, Richman KH, Tung J,
Crawford K, Bonino F, Saracco G, Choo Q-L, Houghton M, Han JH:
Variable and hypervariable domains are found in the regions of HCV
corresponding to the flavivirus envelope and NS1 proteins and the
pestivirus envelope glycoproteins. Virology 180:842, 1991
11. Ogata NR, Alter HJ, Miller RH, Purcell RH: Nucleotide sequence and mutation rate of the H strain of hepatitis C virus. Proc Natl
Acad Sci USA 88:3392, 1991
12. Gabrielli A, Manzin A, Candela M, Caniglia ML, Paolucci S,
Danieli G, Clementi M: Active hepatitis C virus infection in bone
marrow and peripheral blood mononuclear cells from patients with
mixed cryoglobulinemia. Clin Exp Immunol 97:87, 1994
13. Sansonno D, De Vita S, Cornacchiulo V, Carbone A, Boiocchi M,
Dammacco F: Detection and distribution of hepatitis C virus-related
proteins in lymph nodes of patients with type II mixed cryoglobulinemia and neoplastic or non-neoplastic lymphoproliferation. Blood 88:
4638, 1996
14. Moldvay J, Deny P, Pol S, Brechot C, Lamas E: Detection of
hepatitis C virus RNA in peripheral blood mononuclear cells of infected
patients by in situ hybridization. Blood 83:269, 1994
15. Muratori L, Gibellini D, Lenzi M, Cataleta M, Muratori P,
Morelli MC, Bianchi F: Quantification of hepatitis C virus-infected
peripheral blood mononuclear cells by in situ reverse transcriptasepolymerase chain reaction. Blood 88:2768, 1996
16. Sansonno D, Iacobelli AR, Cornacchiulo V, Iodice G, Dammacco F: Detection of hepatitis C virus (HCV) proteins by immunofluorescence and HCV RNA genomic sequences by non-isotopic in situ
hybridization in bone marrow and peripheral blood mononuclear cells
of chronically HCV-infected patients. Clin Exp Immunol 103:414, 1996
17. Krause DS, Fackler MJ, Civin CI, Stratford May W: CD34:
Structure, biology, and clinical utility. Blood 87:1, 1996
18. Non-Hodgkin’s Lymphoma Pathologic Classification Project:
National Cancer Institute sponsored study of classifications of nonHodgkin’s lymphomas. Summary and description of a working formulation for clinical usage. Cancer 49:223, 1989
19. De Vita S, Ferraccioli GF, De Re V, Dolcetti R, Carbone A,
Bartoli E, Boiocchi M: Polymerase chain reaction detects B-cell
clonalities in patients with Sjögren syndrome and suspected malignant
lymphoma. J Rheumatol 21:1497, 1994
20. Di Luca D, Dolcetti R, Mirandola P, De Re V, Secchiero P,
Carbone A, Boiocchi M, Cassai E: Human herpesvirus 6: A survey of
From www.bloodjournal.org by guest on July 31, 2017. For personal use only.
HCV INFECTION OF CD341 CELLS IN HCV CARRIERS
presence and variant distribution in normal peripheral lymphocytes and
lymphoproliferative disorders. J Infect Dis 170:211, 1994
21. Sutherland DR, Keating A: The CD34 antigen: Structure,
biology and potential clinical application. J Haematother 1:115, 1992
22. Sansonno D, Cornacchiulo V, Iacobelli AR, Di Stefano R,
Lospalluti M, Dammacco F: Localization of hepatitis C virus (HCV)
antigens in liver and skin tissues of chronically HCV-infected patients
with mixed cryoglobulinemia. Hepatology 21:305, 1995
23. Chomczynsky P, Sacchi N: Single-step method of RNA isolation
by guanidium thiocyanate phenol-chloroform extraction. Anal Biochem
162:156, 1987
24. Dammacco F, Sansonno D, Han JH, Shyamala V, Cornacchiulo
V, Iacobelli AR, Lauletta G, Rizzi R: Natural interferon-a versus its
combination with 6-methylprednisolone in the therapy of type II mixed
cryoglobulinemia: A long-term, randomized, controlled study. Blood
84:3336, 1994
25. Dash S, Halim A-B, Tsuji H, Hiramatsu N, Gerber MA:
Transfection of HepG2 cells with infectious hepatitis C virus genome.
Am J Pathol 151:363, 1997
26. Lanford RE, Sureau C, Jacob JR, White R, Fuerst T: Demonstration of in vitro infection of chimpanzee hepatocytes with hepatitis C
virus using strand-specific RT/PCR. Virology 202:606, 1994
27. Lerat H, Berby F, Trabaud M-A, Vidalin O, Major M, Trépo C,
Inchauspé G: Specific detection of hepatitis C virus minus strand RNA
in hematopoietic cells. J Clin Invest 97:845, 1996
28. Davis GL, Lau JYN, Urdea MS, Neuwald PD, Wilber JC,
Lindsay K, Perrillo RP, Albrecht J: Quantitative detection of hepatitis C
virus RNA with a solid-phase signal amplification method: Definition of
optical conditions for specimen collection and clinical application in
interferon-treated patients. Hepatology 19:1337, 1994
29. Han JH, Shyamala V, Richman KH, Brauer MJ, Irvine B, Urdea
MS, Tekamp-Olson, Kuo G, Choo Q-L, Houghton M: Characterization
of the terminal regions of hepatitis C viral RNA: Identification of
3337
conserved sequences in the 58 untranslated region and poly(A) tails at
the 38 end. Proc Natl Acad Sci USA 88:1711, 1991
30. Brown KE, Tisdale J, Dunbar CE, Young NS: Hepatitisassociated aplastic anemia. N Engl J Med, 336:1059, 1997
31. Farmer JL, Irace HE, Maaba M, Heine K: Analysis of cellassociated recombinant hepatitis B surface antigen by flow cytometry.
Arch Virol 109:223, 1989
32. Anthony PP, Ramani P: Endothelial markers in malignant
vascular tumors of the liver: Superiority of QB-END/10 over Von
Willebrand factor and ulex europaeus agglutinin 1. J Clin Pathol 44:29,
1991
33. Tanigawa N, Lu C, Mitsui T, Miura S: Quantitation of sinusoidlike vessels in hepatocellular carcinoma: Its clinical and prognostic
significance. Hepatology 26:1216, 1997
34. Ito A, Nomura S, Hirota S, Suda J, Suda T, Kitamura Y:
Enhanced expression of CD34 messenger RNA by developing endothelial cells of mice. Lab Invest 72:532, 1995
35. Fina L, Molgaard HV, Robertson D, Bradley MJ, Monaghan P,
Delia D, Sutherland DR, Baker MA, Greaves MF: Expression of the
CD34 gene in vascular endothelial cells. Blood 75:2417, 1990
36. Selby MJ, Choo QL, Berger K, Kuo G, Glazer E, Eckart M, Lee
C, Chien D, Kuo C, Houghton M: Expression, identification and
subcellular localization of the proteins encoded by the hepatitis C viral
genome. J Gen Virol 74:1103, 1993
37. De Vita S, Sacco C, Sansonno D, Gloghini A, Dammacco F,
Crovatto M, Santini G, Dolcetti R, Boiocchi M, Carbone A, Zagonel V:
Characterization of overt B-cell lymphomas in patients with hepatitis C
virus infection. Blood 90:776, 1997
38. Sansonno D, De Vita S, Iacobelli AR, Cornacchiulo V, Boiocchi
M, Dammacco F: Clonal analysis of intrahepatic B cells from HCVinfected patients with and without mixed cryoglobulinemia. J Immunol
160:3594, 1998
39. Hsu FJ, Levy R: Preferential use of the VH4 Ig gene family by
diffuse large-cell lymphoma. Blood 86:3072, 1995
From www.bloodjournal.org by guest on July 31, 2017. For personal use only.
1998 92: 3328-3337
Hepatitis C Virus Infection Involves CD34+Hematopoietic Progenitor Cells
in Hepatitis C Virus Chronic Carriers
Domenico Sansonno, Claudio Lotesoriere, Vito Cornacchiulo, Massimo Fanelli, Pietro Gatti, Giuseppe
Iodice, Vito Racanelli and Franco Dammacco
Updated information and services can be found at:
http://www.bloodjournal.org/content/92/9/3328.full.html
Articles on similar topics can be found in the following Blood collections
Immunobiology and Immunotherapy (5498 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.