Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download TABLES Table S1. Accession numbers and description of the
Document related concepts
no text concepts found
Transcript
TABLES Table S1. Accession numbers and description of the sequences used in the phylogenetic analysis shown in Figure 1. Gene Name Species Description AtCTR1 AtEDR1 At4G24480 At5G11850 At1G73660 At1G18160 At3G58640 At2G31010 At4G38470 AT3G06630 MdCTR1 CmCTR1 VvCTR1 Vvhypo Vvunnamed Accession Number NP_195993 AAG31143 NM_118581 NM_121223 NM_106025 NM_101676 AEE79810 AEC08477 AEE86931 NP_187315 ABI58288 AAT27129 CBI30245 CBI22876 XP_010646465 Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Malus x domestica Cucumis melo Vitis vinifera Vitis vinifera Vitis vinifera PtCTR1 PtCTR2 PtCTR3 PtCTR4 PtMAP3K Ptpred3 RcMAP3K Rcputkina RhCTR1 DmCTR1 XP_002326245 XP_002322899 XP_002311967 XP_002316514 XM_002306492 XP_002321072 XP_002514059 XP_002521235 AAK40361 BAC80147 DeEDR1 BAD02482 OsCTR1 OsEDR1 OsMAP3K Oshypo Oshypo2 Os02g0241 TaCTR1put HvEDR1 Hvpred SbMAP3K Sbhypo Sb04g0086 ZmATPBP ZmATPBP2 SlTCTR1 LeCTR2 SlCTR3 SlCTR4 PpCTR1L Pp184591 Pp127176 BAD25412 AAN61142 NM_001060369 EEC72807 NP_001043838 NP_001046406 ABB18389.1 AAG31142 BAJ91440 XM_002447031 XP_002458304 XP_002451853 NP_001152076 ACG43022 AAD46406 NP_001234768 AAR89820 AAR89822 KP319036 XP_001765313 XP_001763727 populus trichocarpa populus trichocarpa Populus trichocarpa Populus trichocarpa Populus trichocarpa Populus trichocarpa Ricinus communis Ricinus communis Rosa hybrid cultivar Delphinium 'MagicFountains dark blue' Delphinium 'MagicFountains dark blue' Oryza sativa Oryza sativa Oryza sativa Oryza sativa Oryza sativa Oryza sativa Triticum aestivum Hordeum vulgare Hordeum vulgare Sorghum bicolor Sorghum bicolor Sorghum bicolor Zea mays Zea mays Solanum lycopersicum Solanum lycopersicum Solanum lycopersicum Solanum lycopersicum Physcomitrella patens Physcomitrella patens Physcomitrella patens CTR(CONSTITUTIVETRIPLERESPONSE) EDR1 serine/threonine protein kinase, putative protein kinase family protein protein kinase family protein protein kinase family protein mitogen activated protein kinase kinase kinase-like protein putative serine/threonine kinase ACT-like protein tyrosine kinase family protein protein kinase family protein ethylene control element CTR1 homologue from melon unnamed protein product unnamed protein product, partial PREDICTED: serine/threonine-protein kinase EDR1 isoform X1 serine/threonine protein kinase 1, CTR1 serine/threonine protein kinase2, CTR2 serine/threonine protein kinase3, CTR3 serine/threonine protein kinase4, CTR4 predicted protein hypothetical protein POPTR_0014s13940g map3k delta-1 protein kinase, putative protein kinase, putative CTR1-like protein kinase constitutive triple response 1-like protein kinase enhanced disease resistance 1 putative CTR1-like protein kinase EDR1 Os04g0610900 (Os04g0610900) hypothetical protein OsI_06513 Os01g0674100 Os02g0241600 putative ethylene constitutive triple response protein EDR1 predicted protein hypothetical protein hypothetical protein SORBIDRAFT_03g030890 hypothetical protein SORBIDRAFT_04g008690 ATP binding protein ATP binding protein ethylene-responsive protein kinase TCTR1 TCTR2 protein CTR1-like protein kinase, CTR3 CTR1-like protein kinase, CTR4 Related to Arabidopsis CTR1 predicted protein predicted protein Pp147244 MpCTR1lpa Mp02993pa Mp3732par SmCTR1L11 XP_001779376 xxxxxxxxxx xxxxxxxxxx xxxxxxxxxx XM_002988206 Physcomitrella patens Marchantia polymorpha Marchantia polymorpha Marchantia polymorpha Selaginella moellendorffii SmCTR1L12 XM_002991338 Selaginella moellendorffii Sm269874 Sm40493 Sm932 Sm449389 XM_002991913 XM_002985474 XP_002994172 XP_002994609 Selaginella moellendorffii Selaginella moellendorffii Selaginella moellendorffii Selaginella moellendorffii predicted protein Selaginella moellendorffii (CTR1L1-1) Selaginella moellendorffii (CTR1L1-2) hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein Table S2. Accession numbers and description of the sequences used in the phylogenetic analysis shown in Figure S1. Gene Name Species Description AtCTR1 AtEDR1 At4G24480 At5G11850 At1G73660 At1G18160 At3G58640 Accession Number NP_195993 AAG31143 NM_118581 NM_121223 NM_106025 NM_101676 AEE79810 Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana At2G31010 At4G38470 AT3G06630 AT5G49470 AT1G67890 AT4G23050 AT3G06640 AT4G35780 AT2G42640 AEC08477 AEE86931 NP_187315 AED95815 AEE34715 AAM48011 NP_187316 AAM13016 NP_181792 Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana AT2G17700 MdCTR1 CmCTR1 VvCTR1 Vvhypo Vvhypo2 AEC06670 ABI58288 AAT27129 CBI30245 CBI22876 XP_002280724 Arabidopsis thaliana Malus x domestica Cucumis melo Vitis vinifera Vitis vinifera Vitis vinifera Vvhypo4 XP_010664108 Vitis vinifera Vvunnamed XP_010646465 Vitis vinifera Vvnoname PtCTR1 PtCTR2 PtCTR3 PtCTR4 PtMAP3K Ptpred Ptpred2 Ptpred3 Ptpred4 Ptpred5 RcMAP3K Rcputative Rcputkinase RhCTR1 DmCTR1 CBI34722 XP_002326245 XP_002322899 XP_002311967 XP_002316514 XM_002306492 XP_002314950 XP_002312329 XP_002321072 XP_006380562 XP_002306203 XP_002514059 XP_002528550 XP_002521235 AAK40361 BAC80147 DeEDR1 BAD02482 Mtunknown LjACTkinase Psunknown OsCTR1 OsEDR1 ACJ85685 BAI63585 ACN40743 BAD25412 AAN61142 Vitis vinifera populus trichocarpa populus trichocarpa Populus trichocarpa Populus trichocarpa Populus trichocarpa Populus trichocarpa Populus trichocarpa Populus trichocarpa Populus trichocarpa Populus trichocarpa Ricinus communis Ricinus communis Ricinus communis Rosa hybrid cultivar Delphinium 'MagicFountains dark blue' Delphinium 'MagicFountains dark blue' Medicago truncatula Lotus japonicus Picea sitchensis Oryza sativa Oryza sativa CTR(CONSTITUTIVETRIPLERESPONSE) EDR1 serine/threonine protein kinase, putative protein kinase family protein protein kinase family protein protein kinase family protein mitogen activated protein kinase kinase kinase-like protein putative serine/threonine kinase ACT-like protein tyrosine kinase family protein protein kinase family protein PAS domain-containing protein tyrosine kinase PAS domain-containing protein tyrosine kinase putative serine/threonine kinase PAS domain-containing tyrosine kinase-like protein putative protein mitogen activated protein kinase kinase kinase-like protein ACT-like protein tyrosine kinase-like protein ethylene control element CTR1 homologue from melon unnamed protein product unnamed protein product, partial PREDICTED: serine/threonine-protein kinase EDR1 isoform X2 PREDICTED: serine/threonine-protein kinase TNNI3K-like isoform X2 PREDICTED: serine/threonine-protein kinase EDR1 isoform X1 unnamed protein product serine/threonine protein kinase 1, CTR1 serine/threonine protein kinase2, CTR2 serine/threonine protein kinase3, CTR3 serine/threonine protein kinase4, CTR4 predicted protein kinase family protein hypothetical family protein POPTR_0008s10460g hypothetical protein POPTR_0014s13940g kinase family protein hypothetical protein POPTR_0004s18550g map3k delta-1 protein kinase, putative protein kinase, putative protein kinase, putative CTR1-like protein kinase constitutive triple response 1-like protein kinase enhanced disease resistance 1 unknown ACT-domain-containing protein kinase unknown putative CTR1-like protein kinase EDR1 OsMAP3K Oshypo Oshypo2 Os09g054430 0 Os02g024160 0 TaCTR1put HvEDR1 Hvpred SbMAP3K Sbhypo Sb04g008690 Sb02g031600 ZmATPBP ZmATPBP ZmATPBP2 Zmhypo3 SlTCTR1 LeCTR2 SlCTR3 SlCTR4 PpCTR1L Pp184591 Pp127176 Pp147244 Pp123192 Pp178475 Pp136578 Pp188912 Pp121191 Pp123660 MpCTR1lpa Mp02993pa Mp3732par SmCTR1L11 NM_001060369 EEC72807 NP_001043838 NP_001063830 Oryza sativa Oryza sativa Oryza sativa Oryza sativa Os04g0610900 (Os04g0610900) hypothetical protein OsI_06513 Os01g0674100 Os09g0544300 NP_001046406 Oryza sativa Os02g0241600 ABB18389.1 AAG31142 BAJ91440 XM_002447031 XP_002458304 XP_002451853 XP_002460599 NP_001152076 Triticum aestivum Hordeum vulgare Hordeum vulgare Sorghum bicolor Sorghum bicolor Sorghum bicolor Sorghum bicolor Zea mays putative ethylene constitutive triple response protein EDR1 predicted protein hypothetical protein hypothetical protein SORBIDRAFT_03g030890 hypothetical protein SORBIDRAFT_04g008690 hypothetical protein SORBIDRAFT_02g031600 ATP binding protein ACG43022 NP_001168730 AAD46406 NP_001234768 AAR89820 AAR89822 KP319036 XP_001765313 XP_001763727 XP_001779376 XP_001760542 XP_001758175 XP_001770798 XP_001770515 XP_001759015 XP_001761082 xxxxxxxxxx xxxxxxxxxx xxxxxxxxxx XM_002988206 Zea mays Zea mays Solanum lycopersicum Solanum lycopersicum Solanum lycopersicum Solanum lycopersicum Physcomitrella patens Physcomitrella patens Physcomitrella patens Physcomitrella patens Physcomitrella patens ATP binding protein uncharacterized LOC100382522 ethylene-responsive protein kinase TCTR1 TCTR2 protein CTR1-like protein kinase, CTR3 CTR1-like protein kinase, CTR4 Related to Arabidopsis CTR1 predicted protein predicted protein predicted protein predicted protein predicted protein predicted protein predicted protein predicted protein predicted protein SmCTR1L12 XM_002991338 Selaginella moellendorffii Sm269874 Sm40493 Sm46485 Sm120027 Sm97070 Sm131553 Sm444789 Sm422047 Sm932 Sm449389 XM_002991913 XM_002985474 XP_002989461 XP_002984190 XP_002972276 XP_002990461 XP_002981100 XP_002982574 XP_002994172 XP_002994609 Selaginella moellendorffii Selaginella moellendorffii Selaginella moellendorffii Selaginella moellendorffii Selaginella moellendorffii Selaginella moellendorffii Selaginella moellendorffii Selaginella moellendorffii Selaginella moellendorffii Selaginella moellendorffii Marchantia polymorpha Marchantia polymorpha Marchantia polymorpha Selaginella moellendorffii Selaginella moellendorffii (CTR1L1-1) Selaginella moellendorffii (CTR1L1-2) hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein Table S3. Primers used in this study (5’→3’). Oligo Name Sequence Used for For making the Ppctr1l knockout construct PpCTR1L5flanF TTGGCTTCTTCCTACTTCTTCTACC amplifying 5’ upstream sequence of PpCTR1L PpCTR1L5flanR GATATCCTCGGACTGGTGAGATCTATTCTCC PpCTR1L3flanF GATATCCGAGTCAAGTGTATAGACTGAAGC amplifying 3’ upstream sequence of PpCTR1L PpCTR1L3flanR CTTGTACACTAGACCAACCAATGAGC For Making the expression constructs for yeast two hybrid experiment XhoI-AtCTR1F TCCGACTCGAGGAAATGCCCGGTAGAAGATCTAATTAC amplifying AtCTR1 without the kinase AtCTR1R-XhoI TTCAACTCGAGTTAAGCACGGTGGACAGTGCCAAAGGAACC domain RV-At4g24F TCCAAGATATCTATGCCTCACCGGACTACTTACTTCTTTCC amplifying AtCRG without the kinase At4g24R-RV CGGACGATATCTTAAGCACGATGAACAGTTCCAAATGATCC domain XhoI-AtEDR1F GCCGACTCGAGATGAAGCATATTTTCAAGAAGCTACAC amplifying AtEDR1 without the kinase AtEDR1R-XhoI TCCAACTCGAGTTAAGCATGATAGACCTCTCCATAGGACC domain XhoI-PpCTR1LF TCCAACTCGAGATGGGTAGAAATTTGGTGGATTTAA amplifying PpCTR1L without g the the PpCTR1LR-XhoI CGGAGCTCGAGTTAAGCCCGATACACTTTACCATAAGAACC kinase domain EcoRI-ETR1F2 TCCGGGAATTCACTCGGGAGCTTTTCTTGAAAAATAAAGC amplifying AtETR1 without the ETR1R2-NcoI AGTTTCCATGGTTACATGCCCTCGTACAGTACCC transmembrane domain HI-ERS1F2 CCTCTGGATCCGTAACAGGGAATTGTTTCTCAAGAAGAAAGC amplifying AtERS1 without the ERS1R2-XhoI TATATCTCGAGTCACCAGTTCCACGGTCTGGTTTGTG transmembrane domain EcoRI-PpETR7-7F CGCAGGAATTCACTCGGGAGCTTTTTCTGAAGAACAAGG amplifying PpETR7 without the PpETR7_2RNcoI TCCGTCCATGGCGTAGACTCTCTTTATGCTTTCC transmembrane domain Primers for RT reaction Oligo dT GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTT synthesizing 1st strand cDNA Primers for RT PCR PpETR7F TTTCTCCAGGCTGACTCTTCTC amplifying a 650 bp fragment of Ppetr7-1 PpETR7TnosJxnR CTCAATCGAATTCTAGAACTAGTCG PIP2;2F TTGCTGTTGGCACGCAAAATCTCG amplifying a 490 bp fragment of PpPIP2;2 PIP2;2R GACTTGAAAGGACCAGCTCTAAGC PIP2;3F AGTGACATTTGGGCTACTGCTTGC amplifying a 490 bp fragment of PpPIP2;3 PIP2;3R CCAGCTCTCAGAACGTATTGATGG PpERFaF CGGAGATTCGTGACAAGATTGG amplifying a 170 bp fragment of PpERFa PpERFaR ATTCAGCTGGAGGAGGCGACAAG PpERFbF GTCTGGTTAGGGACATTCG amplifying a 1100 bp fragment of PpERFb Anchor GACCACGCGTATCGATGTCGAC PpTUB5’ TGCTGCTGGATAATGAAGCG amplifying a 540 bp fragment of PpTUB PpTUB3’ CGTGCTGTTCGAAATCATGC PpPYR15’ GGATTTCCAGTTCCTGTTGGAAGG amplifying a 450 bp fragment of PpPYR1 PpPYR13’ CGTCTCCTCTCTTGTGTTACCATC PpABI5’ GCAAGTGCTTGATTGGTCGTCG PpABI3’ CCGCAACTTCTAGAATGTCGCAG PpERFaF PpERFaR PpERFbF Anchor PpTUB5’ PpTUB3’ PpPYR15’ PpPYR13’ PpABI5’ PpABI3’ PpLEA5’ PpLEA3’ PpDHNA5’ PpDHNA3’ AtCOR475’ AtCOR473’ AtCOR785’ AtCOR783’ AtCOR15a5’ AtCOR15a3’ AtERD145’ AtERD143’ AtLT305’ AtLT303’ AtLT295’ AtLT293’ AtACTIN5’ AtACTIN3’ AtAZI_F AtAZI_R CGGAGATTCGTGACAAGATTGG ATTCAGCTGGAGGAGGCGACAAG GTCTGGTTAGGGACATTCG GACCACGCGTATCGATGTCGAC TGCTGCTGGATAATGAAGCG CGTGCTGTTCGAAATCATGC GGATTTCCAGTTCCTGTTGGAAGG CGTCTCCTCTCTTGTGTTACCATC GCAAGTGCTTGATTGGTCGTCG CCGCAACTTCTAGAATGTCGCAG CCGCATTCTGCATTCTGCAATTCGC CCATCTCCGTGTATCCTTCGTG CTGGTATGCAAGACAGAATCACTGG TCGTATCGTAGTCTGATCCAAGTCC CCTAGTGTCATCGAAAAGCTTCACC TTCACTTCCTCTTCAGTGGTCTTGG AAGTTGACTCCGGTCAATGAGAAGG TTGGAGCCTCTTCAACAGAATGTGG TTTCTCAGGAGCTGTTCTCACTGG ATCCTTAGCCTCTCCTGCTTTACC AATCATCGGCAGAGGTTACAGATCG TTCAGGTTTCTTGTGTCCAGGAAGC GTCATCATGGACCTACTAACACTGG CATGGTGAACAACGCCAGTATTACC GAGGAACATAAGCCTACTCTTCTCG AGCAATCGGTGTTGCTGTTTCAACC AGATTCAGATGCCCAGAAGTC CAGACACTGTACTTCCTTTCAGG AGTCCTAAACCAAAGCCAGTCCCA CGATATTGTGCACTGGCATCGCAT AtOSR1_F AtOSR1_R ATGAGGGTTCATGATCAACGGCTG GGCTGGGCTCATTAGAAGGAGAAA AtUBC_F AtUBC_R AtGAPDH_2F AtGAPDH_2R CTGCGACTCAGGGAATCTTCTAA TTGTGCCATTGAATTGAACCC CAAGGAGGAATCTGAAGGCAAAATGA CAACCACACACAAACTCTCGCCG amplifying a 330 bp fragment of PpABI1A amplifying a 170 bp fragment of PpERFa amplifying a 1100 bp fragment of PpERFb amplifying a 540 bp fragment of PpTUB amplifying a 450 bp fragment of PpPYR1 amplifying a 330 bp fragment of PpABI1A amplifying a 500 bp fragment of PpLEA amplifying a 520 bp fragment of PpDHNA amplifying a 480 bp fragment of AtCOR47 amplifying a 410 bp fragment of AtCOR78 amplifying a 400 bp fragment of AtCOR15a amplifying a 340 bp fragment of AtERD14 amplifying a 450 bp fragment of AtLT30 amplifying a 450 bp fragment of AtLT29 amplifying a 260 bp fragment of AtACT2 amplifying a 435 bp fragment of At4g12470 (Hall et al., 2012) amplifying a 241 bp fragment of AtOSR1 (Hall et al., 2012) amplifying a 61 bp fragment of At5g25760 amplifying a 251 bp fragment of At1g13440
Related documents