Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Probing early eukaryotic evolution using phylogenetic methods The SSU Ribosomal RNA Tree for Eukaryotes Animals The Universal SSU rRNA Tree Wheelis et al. 1992 PNAS 89: 2930 The Archezoa Hypothesis - primitively amitochondriate eukaryotes (Tom Cavalier-Smith 1983) Fungi Choanozoa Trichomonas Plants / green algae Mitochondria? Microsporidia Ciliates + Apicomplexa Stramenopiles Red algae Dictyostelium Entamoebae Prokaryotic outgroup Euglenozoa Physarum Percolozoa Trichomonas Giardia Microsporidia Archezoa ‘Tree’ courtesy of W. Ford Doolittle Giardia Entamoeba The Archezoa Hypothesis T. Cavalier-Smith (1983) • The Archezoa hypothesis would fall if: – Find mitochondrial genes on archezoan genomes – Find that archezoans branch among aerobic species with mitochondria – Find mitochondrion-derived organelles in archezoans 1 Mitochondrial HSP 70 is encoded by the host nucleus but is of endosymbiotic origin Targeting sequences ATPase DOMAIN PEPTIDE BINDING DOMAIN Retention sequences N C Cytosolic HSP70 mitochondrial HSP70 RER HSP70 alpha-proteobacteria Endosymbiotic origin other proteobacteria chloroplasts Gram +ve & Archaea cyanobacteria Mitochondrial genes in Archezoa Archezoa Proteins of mitochondrial origin* Giardia / Spironucleus Heat shock 70, Chaperonin 60 Trichomonas Heat shock 70, Chaperonin 60 Microsporidia Heat shock 70 Entamoeba Heat shock 70, chaperonin 60 Chaperonin 60 Protein Maximum Likelihood Tree (PROTML, Roger et al. 1998, PNAS 95: 229) Note 100% Bootstrap support *defined as forming a monophyletic group with mitochondrial homologues in a non-controversial species phylogeny Long branches may cause problems for phylogenetic analysis A case of Eukaryote Eukaryote HGT? Chaperonin 60 Protein Maximum Likelihood Tree (PROTML, Roger et al. 1998, PNAS 95: 229) • Felsenstein (1978) made a simple model phylogeny including four taxa and a mixture of short and long branches A p TRUE TREE A B p q q q C D D WRONG TREE p>q Longest branches C B • Methods which assume all sites change at the same rate (e.g. PROTML) may be particularly sensitive to this problem 2 Cpn-60 Protein ML tree (PROTML) from variable sites with outgroups removed A simple experiment: Giardia • Does the Cpn60 tree topology change: – If we remove long-branch outgroups – If we remove sites where every species has the same amino acid Trichomonas 30 Euglena & Trypanosoma 31 Animals & Fungi Apicomplexa Plants Dictyostelium Entamoeba The Archezoa Hypothesis T. Cavalier-Smith (1983) • The Archezoa hypothesis would fall if: – Find mitochondrial genes on archezoan genomes – Find that archezoans branch among aerobic species with mitochondria – Find mitochondrion-derived organelles in archezoans a-tubulin trees place Microsporidia with Fungi Edlind TD, et al. (1996). Mol Phylog Evol 5 :359-67 Keeling PJ, Doolittle WF. (1996). Mol Biol Evol 13 :1297-305. Microsporidia 65 Fungi Microsporidia are primitive and early branching eukaryotes or relatives of fungi? • Microsporidia branch deep in some trees but not in others – Deep: SSU rRNA, EF-2 – With fungi: tubulin and HSP70 • Microsporidia contain a mitochondrial HSP70 – They once contained the mitochondrial endosymbiont and thus are not Archezoa sensu Cavalier-Smith – Hirt et al., 1997 Other eukaryotes – Or they obtained this gene (and the one for tubulin) from fungi via HGT – Sogin, 1997 Curr. Op. Genet. Dev. 7: 792-799 3 Maximum likelihood and phylogenetic inference • The maximum likelihood tree is the one with The tree shown is the maximum likelihood tree obtained using a program called PROTML the highest probability of giving rise to the data under a particular model 88 • It is not the probability that it is the “true” 83 75 tree Assumptions underpinning the PROTML model LogDet/Paralinear distances for EF-2 DNA variable sites codon positions 1+2 Animals • Assumes all sites in the molecule can change • Assumes that all sequences are evolving in the same way 70 CAGGAATCACCTACGATCCTCGGCGGCGTTACGAACCGAA CAGGAATCACTTACGATCTTAAGCGGCGTTACGAACAGAA CAGGAATCACCTACGATCCTCAGCGGCGCTACGAACCGGC CAGGAAACACTTTCGATCTTGTTCGGAGTAATTCTGCGGC CAGGAATCACTTTCGATCCTGAGCGGCGATATGAACCGGC CAGGAATCACTTACGATCCTAAGCGGAGTAACGAACAGCC CAGGAATCACTTACGATCCTGCGCGGCGTTACGAACCGGC CAGGAATCACCTACGATCCTAAGCGGCGTTACGAACCGCC CAGGAATCACCTACGATCCTAAGCGGCGTTACGAACCGCC CAGGAATCACCTACGATCCTTCGCGGCGTTACGAACCGCA CAGGAAAGACCTACGATGCTGATCGGAGTAATGAACCGGA CAGGAAACACACAGGAACCTGTGCGGCTGCTTGATACTTC CAGGAAACACTTTCGAAATTTTGCGGCTGCCTGATTGAGA CAGGAAACACCTACGAAACTACGCGGCTGCATGAACGAGA Methanococcus outgroup (low G+C) 100 25 76 Entamoeba Microsporidia + fungi! Saccharomyces Glugea Cryptosporidium 54%G+C 54%G+C 53%G+C 45%G+C 43%G+C 44%G+C 58%G+C Sulfolobus Methanococcus Halobacterium Archaebacteria outgroups A combination of factors (outgroup GC content & site rate heterogeneity) influence the EF-2 DNA tree Methanococcus outgroup (low G+C) Halobacterium outgroup Higher G+C 80 60 ML estimate 60 40 40 20 20 Halobacterium outgroup Higher G+C 100 100 80 Bootstrap values 80 60 60 40 40 20 20 0 0 Giardia Dictyostelium 100 80 LogDet Bootstrap values 60 53%G+C 46%G+C A combination of factors (outgroup GC content and site rate heterogeneity) influence the EF-2 DNA tree Trypanosoma Trichomonas • EF-2 violates both of these assumptions: Human Saccharomyces Chlorella Dictyostelium Trypanosoma Entamoeba Cryptosporidium Tritrichomonas Tritrichomonas Giardia Glugea Sulfolobus Methanococcus Halobacterium Chlorella 0 20 40 60 80 100 0 0 20 40 60 80 Fraction of constant sites removed (Microsporidia, outgroup) 100 0 20 40 60 80 100 0 0 20 40 60 80 100 Fraction of constant sites removed (Microsporidia, outgroup) (Microsporidia, Fungi) 4 A combination of factors (outgroup GC content & site rate heterogeneity) influence the EF-2 DNA tree Methanococcus outgroup (low G+C) Bootstrap values Halobacterium outgroup Higher G+C 100 100 80 80 60 60 40 40 20 0 20 40 60 80 100 0 • Probably not: • Microsporidia are related to fungi (Tubulin, RNA polymerase,LSU rRNA, HSP70, TATA binding protein, EF-2, EF-1 alpha, SSU rRNA) • Evidence for Giardia and Trichomonas branching deeper than other eukaryotes is based on trees made using unrealistic assumptions (often PROTML) 20 0 Are the former Archezoa really ancient offshoots? • There is plenty of room for new hypotheses 0 20 40 60 80 100 Fraction of constant sites removed (Giardia, Trichomonas, outgroup) If former archezoa contain genes from the mitochondrial endosymbiont what happened to the organelle? Microsporidia are obligate intracellular parasites Life cycle of microsporidia mtHsp70 has diverse roles in mitochondria Pfanner and Geissler 2001 Nature Reviews 2: 339-344 Tree of Mitochondrial Hsp70 mtHsp70 mtHsp70 also plays a role in assembly of Fe-S clusters - an essential function for yeast mitochondria (Lill & Kispal, 2000) 5 Localisation of a mtHsp70 in Trachipleistophora Infected cells Rabbit Confocal microscopy using an antibody to Th-mtHsp70 Spores Microsporidial HSP70 have no obvious N-terminal targeting signal Western blot using an antibody to Th-mtHsp70 The Hsp70 protein is localised to membrane bound or electron dense structures. Microsporidian Microsporidian ‘mitochondrial remnant’ Host cell mitochondrion Traditional fixation methods show a double membrane Williams et al. 2002 Nature 418: 865-869 Trees are a good way of exploring the history of genes but care is needed! • Making trees is not easy: – Among-site rate heterogeneity, “fast clock” species, shared nucleotide or amino acid composition biases – Different data sets may be affected by individual phenomena to different degrees Phylogenetic analysis requires careful thought • Phylogenetic analysis is frequently treated as a black box into which data are fed (often gathered at considerable cost) and out of which “The Tree” springs • (Hillis, Moritz & Mable 1996, Molecular Systematics) – Biases need not be large if phylogenetic signal is weak 6