Download FGFR2(IIIb) - Development - The Company of Biologists

483
Development 127, 483-492 (2000)
Printed in Great Britain © The Company of Biologists Limited 2000
DEV1496
An important role for the IIIb isoform of fibroblast growth factor receptor 2
(FGFR2) in mesenchymal-epithelial signalling during mouse organogenesis
Laurence De Moerlooze*,‡, Bradley Spencer-Dene*, Jean-Michel Revest, Mohammad Hajihosseini,
Ian Rosewell and Clive Dickson§
Imperial Cancer Research Fund, Lincoln’s Inn Fields, London WC2A 3PX, UK
*These authors have contributed equally to this work
‡Present address: Université Libre de Bruxelles, IRIBHN, Campus Erasme, Bat C, 808 route de Lennik, B-1070 Bruxelles, Belgium
§Author for correspondence (e-mail: [email protected])
Accepted 9 November 1999; published on WWW 12 January 2000
SUMMARY
The fibroblast growth factor receptor 2 gene is
differentially spliced to encode two transmembrane
tyrosine kinase receptor proteins that have different ligandbinding specificities and exclusive tissue distributions. We
have used Cre-mediated excision to generate mice lacking
the IIIb form of fibroblast growth factor receptor 2 whilst
retaining expression of the IIIc form. Fibroblast growth
factor receptor 2(IIIb) null mice are viable until birth, but
have severe defects of the limbs, lung and anterior pituitary
gland. The development of these structures appears to
initiate, but then fails with the tissues undergoing extensive
apoptosis. There are also developmental abnormalities of
the salivary glands, inner ear, teeth and skin, as well as
minor defects in skull formation. Our findings point to a
key role for fibroblast growth factor receptor 2(IIIb)
in mesenchymal-epithelial signalling during early
organogenesis.
INTRODUCTION
which the IIIa exon is spliced. This generates two receptor
isoforms with quite different ligand-binding specificities (see
Ornitz et al., 1996). Fgfr2 containing the IIIb exon is found
mainly in epithelia, and is activated by four known ligands
(Fgf1, Fgf3, Fgf7 and Fgf10), which are synthesized
predominantly in the tissue mesenchyme. In contrast,
Fgfr2(IIIc) is located primarily in the mesenchyme, and apart
from Fgf1, which binds to all known receptors, is activated by
a different set of Fgf ligands (Bellusci et al., 1997; Finch et al.,
1995; Mason et al., 1994; Ornitz et al., 1996; Orr-Urtreger et
al., 1993; Peters et al., 1992; Yamasaki et al., 1996). Hence,
Fgfr2(IIIb) and Fgfr2(IIIc) are expressed in mutually exclusive
cell lineages, using a positively regulated splicing mechanism
that involves intron sequences adjacent to the isoform-specific
exons (Carstens et al., 1997, 1998; Del Gatto et al., 1997;
Gilbert et al., 1993).
The importance of FGF receptors in mouse development has
been established by gene targeting studies, which show that
mice deficient for Fgfr1 die during gastrulation with both
impaired growth and cell migration through the primitive
streak (Ciruna et al., 1997; Deng et al., 1994, 1997; Yamaguchi
et al., 1994). A null mutation encompassing both isoforms of
Fgfr2 results in peri-implantation lethality at E4.5-E5.5
(Arman et al., 1998), while embryos with a homozygous
hypomorphic allele die around E10.5 with no limb buds and a
defective placenta (Xu et al., 1998). A targeted deletion of
Fgfr3 results in skeletal dysplasia of the long bones and an
Fibroblast growth factors (Fgfs) are a large family of
intercellular signalling molecules, whose activities are
mediated through a family of tyrosine kinase transmembrane
receptors (reviewed in Johnson and Williams, 1993; McKeehan
et al., 1998). Binding of FGFs to their receptors is facilitated
by heparan sulphate-containing proteoglycans and culminates
in activation of the receptor tyrosine kinase and signal
transduction. Fgfs have been implicated in the development of
a diverse range of animal species from Caenorhabditis elegans
to mammals (for examples, see Amaya et al., 1991; DeVore et
al., 1995; Reichman-Fried and Shilo, 1995; Yamaguchi and
Rossant, 1995). Moreover, genetic linkage analysis has
implicated three members of the Fgf receptor (Fgfr) gene
family as the underlying cause of several skeletal dysplasias
and autosomal dominant craniosynostosis syndromes
(reviewed in DeMoerlooze and Dickson, 1997).
Four FGF receptor genes have been identified in mammals
(Fgfr1 to Fgfr4), each comprising an extracellular domain
composed of two or three immunoglobulin-like (Ig) loops, a
transmembrane segment and an intracellular tyrosine kinase
(reviewed in Johnson and Williams 1993; McKeehan et al.,
1998). Ligand-binding specificity of the receptor is mediated
by the second and third Ig-loop. For Fgfr1-Fgfr3, the third Ig
loop is encoded by two exons, an invariant exon termed IIIa
and one of two exons, termed IIIb and IIIc, respectively, to
Key words: Fibroblast growth factor receptor 2, IIIb isoform, Limb
development, Skin, Pituitary gland, Lung
484
L. De Moerlooze and others
inner ear defect (Colvin et al., 1996; Deng et al., 1996).
Interestingly, Fgfr4-deficient mice show no apparent
phenotype, but the Fgfr3/Fgfr4 double null demonstrates a late
lung defect not found in the single receptor-deficient mice
(Weinstein et al., 1998).
Expression of the isoform-specific dominant negative
Fgfr2(IIIb) implicates this receptor in the development of
several organs including the limbs, lungs, skin, kidney and
several glandular tissues (Celli et al., 1998; Jackson et al.,
1997; Peters et al., 1994; Robinson et al., 1995; Werner et al.,
1993). To understand the role of Fgfr2(IIIb) in mouse
development, we have specifically abrogated its expression in
the mouse germ line while leaving intact a functional
Fgfr2(IIIc). Unlike the complete Fgfr2 null mutation which is
peri-implantation lethal, mice lacking the IIIb-specific isoform
of Fgfr2 are viable until birth. However, these mutant mice
display a wide range of phenotypic abnormalities implicating
this receptor isoform in the induction and specification of
several cell lineages in multiple organs during mouse
development.
MATERIALS AND METHODS
Gene targeting
Recombinant lambda bacteriophage encompassing the alternatively
spliced region of Fgfr2 were isolated from a 129SvJ-mouse genomic
library (kind gift of A.-M. Frischauf). To construct the targeting vector
a 96 bp loxP recognition sequence was inserted into the intron
between exons IIIb and IIIc at an XbaI site. The plasmid pGH-1(Gu
et al., 1993), which encodes a loxP site 5′ to HSV-neo and HSV-TK
genes, was modified by the addition of a loxP sequence at the 3′ end
of HSV-TK. This neo/TK cassette flanked by lox-P sites was inserted
at the BamHI site in the intron between exons IIIa and IIIb. The final
construct was approximately 8.5 kb in length, starting at an introduced
XhoI site in the intron upstream of exon IIIa and terminating at an
XbaI site in the intron 3′ of exon IIIc (Fig. 1). The plasmid DNA was
electroporated into GK129 ES cells as previously described (Fantl et
al., 1995) and HindIII-digested DNA from neo-resistant clones
screened by Southern hybridization with an internal probe. Candidate
homologous recombinant clones were re-screened using PCR with
primers that would amplify the 5′ and 3′ junction fragments of
correctly targeted DNA. To generate ES cells with a conditional or
non-conditional Fgfr2(IIIb) allele, they were transiently transfected
with pMC-Cre(Gu et al., 1993) plasmid, which expresses the Cre
recombinase from the CMV promoter, and reselected for the loss of
the plasmid cassette in the presence of gancyclovir. Several ES cell
clones were isolated from two independent primary ES clones that
were either non-conditional or conditional for the IIIb exon of Fgfr2
(see Fig. 1). ES cell clones were used to generate chimeras. We
obtained germline transmission of two conditional ES cell clones.
Mice with the non-conditional allele were obtained by injecting
fertilized C57Bl × Fgfr2(IIIb)−/−cond eggs with pCAGGS-Cre (Araki
et al., 1995).
Genotyping
Genomic DNA was isolated from tail clips (Laird et al., 1991) and
genotype determined using two pairs of primers P1/P2 and P3/P4 as
shown in Fig. 1. P1 is in the IIIb exon and therefore absent in the
excised allele and P4 is in the loxP site and absent in WT. The PCR
protocol was 94°C 2 minutes, then 30 cycles of 94°C 30 seconds,
55°C 1 minutes, 72°C 30 seconds, followed by 72°C 10 minutes,
using a Techne Genius (Techne). Products were run out on a 1%
agarose gel. Primer sequences available on request.
RT-PCR analysis
Total RNA was prepared from snap-frozen adult and fetal tissues
using TRIzol Reagent (Gibco BRL) according to the manufacturer’s
protocol and 1 µg of each RNA was used with Ready-To-Go RT-PCR
Beads (Pharmacia Biotech) according to the manufacturer’s
recommended one-step protocol. The following primers were used;
5′ IIIa, AAGGTTTACAGCGATGCCCA; 3′ TM, ACCACCATGCAGGCGATTAA PCR conditions: 94°C/1 minute, 47°C/1 minute,
72°C/1 minute, for 35 cycles then 72°C/10 minutes. PCR products
were analyzed on a 2% agarose gel. Total reactions and isolated DNA
bands were restriction digested with AvaI or EcoRV to discriminate
between products containing IIIb and IIIc exons, respectively.
Histology and immunohistochemistry
Tissue was fixed overnight in neutral buffered formalin, dehydrated
through ethanol and embedded in paraffin wax, and 5 µm
sections were cut for staining in Haematoxylin and Eosin. For
immunohistochemistry, 8 µm sections were cut and, where necessary,
antigens were unmasked by prior boiling for 10 minutes in 0.01 M
tri-sodium citrate pH 6. A standard indirect immunoperoxidase
protocol was employed. The following primary antibodies were used:
ERLI-3 rabbit anti-mouse involucrin (a kind gift from F. Watt), rabbit
anti-mouse cytokeratins 1, 5, 6, 10, 14 and loricrin (BAbCO, USA)
at the recommended concentrations for 1 hour at room temperature.
Secondary antibody was biotinylated swine anti-rabbit IgG (DAKO,
UK) followed by streptavidin-peroxidase (DAKO, UK) and 3,3′diaminobenzidine (Sigma, UK) visualization. Proliferating cells were
detected using a rabbit antiserum to NCL-Ki67p (Novocastra, UK) as
above. Apoptotic cells were detected by labeling free 3′OH ends of
fragmented DNA with terminal transferase and tagged NTPs
(TUNEL) using a commercial kit (ApopTag®Plus In Situ Apoptosis
Detection Kit, Oncor, USA). Skeletal staining was carried out as
described previously (McLeod, 1980).
In situ hybridization
A mouse FGFR2 IIIc probe was kindly provided by P. Kettunen
(Kettunen et al., 1998). A mouse cDNA corresponding to the entire
IIIb exon of FGFR2 IIIb (nucleotides 1267-1417; (Miki et al., 1992)
was generated by PCR and cloned into pBluescript IISK+. The Fgfr2TK probe was a PCR-generated fragment of the cytoplasmic domain
encompassing nucleotides 1726-2764 in pBluescript IISK+. Plasmids
were linearized and sense and antisense single-stranded RNA probes
generated with the appropriate RNA polymerase. In situ hybridization
was performed on dewaxed tissue sections essentially as described
previously (Kettunen et al., 1998).
RESULTS
Targeted disruption of the IIIb isoform of FGF
receptor 2
A non-conditional isoform-specific mutation of Fgfr2(IIIb)
was obtained by removing exon IIIb from the mouse germline.
This was achieved using Cre recombination to excise exon IIIb
from the genome of targeted ES cells in a strategy outlined in
Fig. 1 (Gu et al., 1993). To determine the consequences of
deleting exon IIIb on transcript expression, we used RT-PCR
to investigate the presence of possible RNA species (Fig. 2). A
pair of primers was designed to detect the possible alternative
exon splicing events; namely exons IIIa to IIIc, IIIa to IIIb and
IIIa to TM. As the size of the products generated from
transcripts for wild-type IIIb and IIIc receptor isoforms is very
similar (340 verses 345 nts), we used restriction endonuclease
digestion at sites unique to each product to help distinguish
them. The results show that wild-type mice exhibited the
FGFR2(IIIb) signalling in mouse development
485
Fig. 1. Generation of Fgfr2(IIIb)−/− mice.
(A) Schematic depiction of Fgfr2 showing
alternatively spliced exons that generate the two
isoforms of this receptor. (B) Partial restriction
map of the targeting vector composed of
129/Sv/J mouse genomic DNA (from Xho1 to
Xba1), loxP sequences (filled disc) and the
cassette encoding the two selectable genes. The
relative position of the exons are shown (H,
HindIII; X, XhoI, A, AvaI; RV, EcoRV).
Stippled box, position of internal probe used to
screen recombinant ES cells by Southern
blotting (see D). The size of the HindIII
fragment from the wild-type allele is 6.5 kb and
the homologous recombinant is 8.9 kb.
(D) Southern blot showing correctly targeted
Fgfr2 allele (Ta). The position of PCR primers
used to confirm the junctions of homologous
recombinants are marked as A1, A2 and B1, B2
and a PCR result is illustrated in E.
(C) Transient transfection of the homologous
recombinant ES cells with a Cre recombinase
expression plasmid (pMC-Cre) can potentially
give rise to subclones with two possible
genomic configurations, and both are selectable
by their resistance to gancyclovir; ∆, full
deletion of the IIIb exon, flox, deletion of the
selection cassette leaving loxP sites flanking
exon IIIb; arrows, possible consequences of Cre
recombination. The resultant transfected ES cell
clones were screened by Southern blotting (F)
to identify the two configurations. The two pairs
of primers marked as P1, P2 and P3, P4 were
used for genotyping mice by PCR.
splicing patterns for the (IIIb) and (IIIc) isoforms of Fgfr2 as
expected. By contrast, the Fgfr2(IIIb)−/− mice showed the
splicing pattern for the Fgfr2(IIIc), and a novel splice
generated by splicing exon IIIa directly to exon TM (Fig. 2).
Heterozygous mutant mice showed all three splicing
alternatives. The IIIa to TM exon splice causes translation to
terminate two codons into TM. The resulting product lacks half
of Ig-loop three (part of the ligand-binding domain), the
transmembrane element as well as the kinase (Fig. 2).
Therefore, it is highly unlikely that this severely truncated
protein could have any significant receptor activity. As a further
check on receptor splicing, we have used in situ hybridisation
on skin sections to confirm the differential expression of
Fgfr2(IIIb), Fgfr2(IIIc) and the aberrant receptor RNA
(described below).
Skeletal and craniofacial abnormalities
Heterozygous mice were indistinguishable from their wildFig. 2. Alternative splicing patterns for Ig-loop III of the wild-type
and IIIb exon-deleted allele of Fgfr2. RT-PCR was used to assess the
alternative receptor splicing. RNA was isolated from whole embryos
or fetal liver and used with primers that hybridize within exons IIIa
or TM (arrowheads). The possible splicing alternatives for the
homozygous mutant, (−/−) and wild-type (+/+) mice are shown
schematically, and as results of the RT-PCR analysis. The products
from the Fgfr2(IIIb) and Fgfr2(IIIc) receptors are 340 and 345 bp,
respectively, while the novel splice resulting from the deletion of
exon IIIb is 195 bp. Digestion of the products with AvaI and EcoRV
were used to confirm the identity of the products. The novel IIIa to
TM splice results in translational termination two codons into TM as
illustrated.
486
L. De Moerlooze and others
Fig. 3. Skeletal defects associated with
Fgfr2(IIIb)−/− mice. (A,B) Heterozygous and
homozygous littermates, respectively, at E19.5.
Bar, 2 mm. (C,D) Skeletal preparations of
heterozygous and homozygous littermates at
E19.5, respectively. Note in D, the abnormal
fusion of the clavicle to the deformed scapula.
(E) Upper panels show lateral views of scapulae
taken from heterozygous and homozygous
fetuses at E19.5. Asterisk, the blade; arrowhead,
the acromion; arrows, the coracoid process.
Lower panels show one half of the pelvic
girdles taken from E19.5 heterozygous and
homozygous fetuses, respectively. Bars, 500
µm. (F,G) Wild-type and homozygous mutant
E16.5 skeletal preparations of the caudal
vertebrae. Arrowheads point to malformed and
fused vertebrae.
3A,B), and skeletal staining revealed an
apparent premature fusion of the suture
between the parietal and squamous temporal
bones (Fig. 4). In addition, the skulls of
Fgfr2(IIIb)−/− fetuses showed otic capsules
of greatly reduced size and cleft palate.
type littermates in all respects and have remained healthy for
more than a year. Interbreeding of heterozygous mutant mice
resulted in approximately 25% homozygous mutant embryos,
indicating no significant lethality in utero due to the loss of the
Fgfr2(IIIb) receptor isoform. The homozygous mutant fetuses
survived to term but died at birth due to failure of lung
formation (see below). They were smaller than their
littermates, and had no forelimbs or hindlimbs, an abnormally
curled tail and open eyes due to an apparent absence of eyelids
(Fig. 3A,B). To investigate the skeletal changes, fetuses were
stained with Alizarin red and Alcian blue to show bone and
cartilage structures, respectively (McLeod, 1980); Fig. 3C,D).
The skeletal stain confirmed the absence of limb rudiments in
Fgfr2(IIIb)−/− mice and showed that the scapula, particularly
the blade and coracoid process, was greatly reduced in size and
the acromion failed to form (Fig. 3E). The clavicle, which
normally joins to the acromion, was fused to the coracoid
process. The Fgfr2(IIIb)−/− mice also showed a severely
malformed pelvic girdle, with only a rudimentary ileum and
ischium, and the absence of discernible pubis and ischial rami
(Fig. 3E). An examination of the tail at E16.5 showed
malformed and fused caudal vertebrae that would account for
the curled tail phenotype (Fig. 3F,G).
The heads of homozygous mutant fetuses appeared more
domed than their heterozygous or wild-type counterparts (Fig.
Failure of limb bud initiation
To investigate the stage at which limb
formation fails, embryos from earlier stages
of development were examined. E10.5
Fgfr2(IIIb)−/− embryos were the most
revealing, since they showed the beginning
of limb bud initiation but no thickening of
the epithelium characteristic of an apical
endodermal ridge (Fig. 5A,B). Moreover,
TUNEL staining of adjacent sections
showed extensive apoptosis in the
presumptive limb bud mesoderm, as well as some apoptotic
cells in the overlying epithelium (Fig. 5C,D). By contrast, the
control wild-type limb buds showed a well-demarcated AER
and virtually no apoptotic cells.
Non-skeletal defects of the head and neck
Dissection and serial sectioning of the ear from homozygous
mutants demonstrated that semicircular canal formation was
grossly abnormal and the whole inner ear was generally cystic
in appearance (data not shown). The malformation of the inner
ear can in part be explained by an earlier failure, in some mice,
of endolymphatic duct formation as shown in sections of E10.5
embryos (Fig. 6).
Sagittal sections of the head region from E12.5-16.5
embryos revealed several other abnormalities. The teeth of
Fgfr2(IIIb)−/− mutant mice did not develop normally and failed
to progress beyond the bud stage, which normally occurs at
E13.5 (Fig. 7A,B) (Thesleff and Sharpe, 1997). Embryos from
E12.5 to E16.5 were examined for the development of salivary
glands. As shown in Fig. 7C,D, E14.5 Fgfr2(IIIb)−/− embryos
showed clear deficiencies in salivary gland formation.
Transverse and sagittal sectioning of E12.5 and E14.5
embryos demonstrated the absence of an anterior pituitary and
its precursor, Rathke’s pouch (Fig. 8A,B). However, the
infundibular recess and its derivative, the neural component of
FGFR2(IIIb) signalling in mouse development
487
Fig. 4. Skull abnormalities at E19.5. (A,C,E) Heterozygous mouse;
(B,D,F) Fgfr2(IIIb)−/− mouse. (A,B) Ventral view of the skulls;
asterisk, an otic capsule. (C,D) Lateral views of A and B,
respectively. An incisor is indicated by the arrow in C. Dashed boxes
indicate the region of premature suture formation presented at higher
magnification in E and F. p, parietal bone; sq, the squamous temporal
bone.
diverticulum. Furthermore, TUNEL staining shows
widespread apoptosis in the pouch epithelium of
Fgfr2(IIIb)−/− embryos (Fig. 8C-F). Wild-type embryos
showed only a few apoptotic cells at the base of the
diverticulum, consistent with the formation of Rathke’s pouch
from the oral epithelium.
Visceral abnormalities
Dissection of the thoracic cavity of Fgfr2(IIIb)-deficient E18.5
fetuses showed a clear absence of lungs. However, defective
lung development was already apparent much earlier at E10.5.
The tracheal bifurcation which generates the bronchi was
evident in heterozygous and wild-type embryos, but was not
observed in Fgfr2(IIIb)−/− embryos (Fig. 9A,B). However,
sagittal sections of E12.5 embryos showed a finger of
mesenchyme surrounded by a single layer of epithelium but,
by E14.5, the mesenchyme is full of picnotic nuclei, a sign of
extensive apoptosis (Fig. 9D,F). By contrast, the normal mouse
lung at E14.5 showed considerable bronchi with branching and
bronchioles that were beginning to differentiate (Fig. 9C,E).
The stomach also appeared relatively smaller in mutant fetuses
and had some differences in tissue architecture compared to
heterozygous mice (data not shown).
the pituitary (pars nervosa), was present and appeared
morphologically normal. At E9.5, Rathke’s pouch starts to
form from the oral cavity ectoderm and, a half day later, the
infundibular recess derives from the neural epithelium
(Kaufman, 1992). Coronal sections through E10.5 embryos
show these processes in both wild-type and homozygous
mutant embryos (Fig. 8C,D). However, the appearance of
Rathke’s pouch in the Fgfr2(IIIb)−/− embryos appears poorly
formed with fewer cell layers forming the walls of the
Skin development
The skin of the Fgfr2(IIIb)−/− mice was lighter in colour and
more translucent compared to the normal pink wrinkled
appearance of their heterozygous and wild-type littermates
(Fig. 3A,B). Transverse sections through the dorsal skin of the
mutant mice demonstrated a marked reduction in thickness
that accounted, at least in part, for its appearance (Fig. 11A,E).
To analyse the phenotype in more detail, we used an
immunohistochemical approach to compare a
number of differentiation markers. Examples of
the staining patterns for cytokeratins 1 and 5, and
loricrin are shown in Fig. 10. In essence, all the
normal cell lineages found in heterozygous and
wild-type skin were detected in their correct
relative position within the mutant skin,
indicating that epidermal differentiation was
grossly similar. However, the different stratified
layers of the epidermis and the dermis were
significantly thinner and appeared to be less well
Fig. 5. Limb bud defects. (A,C) Sections of wild-type
forelimb buds at E10.5 stained with H&E and by
TUNEL, respectively. (B,D) Equivalent sections taken
and stained from a null littermate. Asterisk, forelimb
bud; arrowhead in A, AER; arrowheads in D, brown
immunoperoxidase staining of apoptotic cells in the
ectoderm. Note too, the widespread
immunoperoxidase staining of the mesoderm. The
position of the AER is indicated in C. This structure is
missing in null mice. Bars, 100 µm.
488
L. De Moerlooze and others
Fig. 6. Otocyst formation. (A,B) H&E-stained sections through the
hindbrain region at the level of the otic vesicles (asterisk) for wildtype (A) and Fgfr2(IIIb)−/− (B) embryos at E10.5. The arrowhead in
A points to the endolymphatic duct, which is absent in B. Bar, 100
µm.
organised, particularly those of the basal keratinocyte layer
between the hair follicles. More significantly, in the
Fgfr2(IIIb)−/− fetuses, there was no discernible panniculus
carnosus muscle layer that normally lies beneath the dermis
(Fig. 11A,E). To investigate cell proliferation rates, an
antibody to Ki-67, which stains cells in the division cycle, was
used and a decrease in the number of cycling cells was
observed in the basal layer of the homozygous mutant mice.
However, staining of the outer hair follicle sheath appeared
similar for all genotypes. Apoptotic cells were detected by
TUNEL staining as described. Few cells appeared to stain in
this assay and there was no noticeable difference between
mutant and control skin samples (data not shown).
Fgfr2 expression in the skin
As mouse skin is well characterised in terms of its cellular
architecture and expression of Fgfr2, it was used to further
investigate the splicing pattern of the receptor in normal and
mutant fetuses (Orr-Urtreger et al., 1993; Peters et al., 1992).
In situ hybridisation was performed with probes to the IIIb and
IIIc exons and the TK domain of the Fgfr2 receptor (Fig. 11).
The basal keratinocyte layer and the hair follicle sheaths of the
heterozygous and wild-type skin were strongly positive with
probes against the TK and IIIb domains of Fgfr2, while a probe
from the IIIc exon gave a weaker hybridization signal in the
dermis and panniculus carnosus. The mutant embryos did not
express the IIIb exon as expected. Nevertheless, the TK probe
gave a similar pattern of expression on mutant and wild-type
skin sections, indicating that despite the removal of the IIIb
exon in mutant embryos, similar levels of Fgfr2 RNA were
present. This finding is consistent with the IIIa to TM switch
occurring in the absence of the IIIb exon (Fig. 2), and agrees
with previous studies demonstrating that splicing of the
receptor isoforms is mutually exclusive and positively
regulated (Carstens et al., 1997, 1998; Del Gatto et al., 1997;
Gilbert et al., 1993).
DISCUSSION
We have used the Cre-loxP recombination system to generate
mice that are specifically deficient for the IIIb isoform of Fgfr2,
while leaving the IIIc isoform intact (Gu et al., 1993). The
results of RT/PCR analysis show that, in the absence of exon
IIIb, a novel mRNA is created that splices directly from exon
IIIa to TM. This behaviour is in agreement with previous
studies that have demonstrated a tight regulation of alternative
splicing in different cell types (Carstens et al., 1997, 1998; Del
Gatto et al., 1997; Gilbert et al., 1993). The predicted truncated
receptor would comprise a defective ligand-binding domain,
and no transmembrane or tyrosine kinase domain. Therefore,
it could not function as a signalling receptor and its defective
ligand-binding domain makes it unlikely that it could serve as
a dominant negative receptor. In situ hybridisation results on
skin sections using IIIb- and IIIc-specific probes are consistent
with the RT/PCR results and show the loss of IIIb-specific
signals in the homozygous mutant mice. Moreover, by using a
TK-specific probe abundant Fgfr2 RNA can be detected in the
cell types that normally express Fgfr2(IIIb), indicating
replacement by the IIIa/TM spliced RNA. It is
also worth noting that heterozygous mice of
greater than one year of age have not shown
any abnormalities, suggesting no gain of
function results from removing exon IIIb.
Mice lacking a functional Fgfr2 receptor
gene die around implantation, while we show
here that mice specifically deficient for the IIIb
isoform of Fgfr2 survive to birth, although they
Fig. 7. Defects in tooth and salivary gland
development. (A,B) H&E-stained sagittal sections
through the tooth primordia at E14.5
(arrowheads). Note that the teeth of the
heterozygote has progressed normally to the late
cap stage (A) while in the Fgfr2(IIIb)−/− mice (B)
the teeth fail to progress beyond the bud stage. t,
tongue. (C,D) H & E sections through the
mandibular region showing Meckel’s cartilage (m)
and salivary gland primordia (arrows).
Bar, 200 µm.
FGFR2(IIIb) signalling in mouse development
489
Fig. 8. Anterior pituitary
dysmorphogenesis.
(A,B) Histological sagittal
sections of heterozygous (A) and
Fgfr2(IIIb)−/− (B) pituitary gland
at E14.5. (B) Rathke’s pouch
(the anterior pituitary precursor)
is absent. (C-F) TUNEL staining
in the pituitary at E10.5. In wildtype mice (C,E), Rathke’s pouch
and the infundibular recess can
be seen with very few apoptotic
cells. In contrast, sections from
Fgfr2(IIIb)−/− mice (D,F) show a
poorly formed Rathke’s pouch
containing numerous apoptotic
cells (arrowheads). Asterisk,
infundibular recess; R, Rathke’s
pouch. Bars: 200 µm for A,B;
40 µm in C-F.
cannot survive outside the uterus as they have no lungs (Fig. 9).
At E10.5, wild-type mice show the presence of bilateral primary
bronchi surrounded by mesenchyme, whereas Fgfr2(IIIb)−/−
mice develop a tracheal bud consisting primarily of
mesenchyme but without apparent bronchi. Several lines of
investigation have implicated Fgfr2(IIIb) and its major ligands
in lung morphogenesis. Expression of a dominant negative form
of Fgfr2(IIIb) in the bronchial epithelium resulted in an
inhibition of branching morphogenesis after primary bronchial
bifurcation (Peters et al., 1994). Moreover, a similar lung
phenotype to that described here was found in Fgf10−/− mice
(Min et al., 1998; Sekine et al., 1999). This is consistent with
Fgf10 acting as a major ligand for Fgfr2(IIIb) and its expression
in the lung mesenchyme prior to the initiation of lung bud
branching (Bellusci et al., 1997; Igarashi et al., 1998; Xu et al.,
1998). Interestingly, the lung mesenchyme also expresses Fgf7,
which exclusively activates Fgfr2(IIIb), but this ligand does not
substitute for Fgf10 as an inducer of lung branching
morphogenesis (Bellusci et al., 1997; Mason et al., 1994; Ornitz
et al., 1996). Furthermore, mice lacking Fgf7 appear to have
normal lungs (Guo et al., 1996). This would suggest either a
subtle difference in spatial expression pattern, or signalling
potential, between Fgf7 and Fgf10 (Bellusci et al., 1997; Mason
et al., 1994). Some evidence for the latter comes from
embryonic lung explant studies which show different responses
to these ligands (Bellusci et al., 1997; Cardoso et al., 1997).
The absence of the anterior pituitary in Fgfr2(IIIb)-deficient
mice is of particular interest, since its induction has been
associated with Fgf8 (Ericson et al., 1998; Treier et al., 1998).
Although Fgf8 is not a ligand for Fgfr2(IIIb), signalling
through this receptor is associated with the subsequent
activation of Fgf8 during limb bud initiation. Rathke’s pouch
is first seen at E9.5 as a pocket arising from the roof of the oral
cavity ectoderm and, approximately 12 hours later, the
infundibular recess starts to form as a pocket from, and is
continuous with, the neural ectoderm of the diencephalon
(Kaufman, 1992). Fgf8 is strongly expressed throughout the
infundibulum from as early as E10 and continues to be
expressed as the anterior pituitary undergoes lineage
specification, expansion and terminal differentiation to
corticotropes, thyrotropes, gonadotropes, somatotropes and
lactotropes. More pertinent for Fgfr2(IIIb) involvement, Fgf10
mRNA is strongly expressed in the rat infundibulum at a stage
approximately equivalent to E12 in the mouse (Yamasaki et al.,
1996), and studies are currently underway to establish whether
Fgf10 expression occurs earlier when induction is thought
to take place. However, it is clear that, in the homozygous
mutant mice, there is an initial inductive phase, which starts to
produce a diverticulum from the oral
epithelium but, by E10.5, the structure
is undergoing apoptotic disintegration
(Fig. 8).
Several organs including the brain,
Fig. 9. Lung agenesis. H&E-stained
transverse sections through the lung
region of wild-type (A) and Fgfr2(IIIb)−/−
mice (B) at E10.5. Arrowheads,
oesophagus; arrows, primary bronchi in
A, which are absent in B. (C-E) H&Estained sagittal sections of heterozygous
(C,E) and Fgfr2(IIIb)−/− (D,F) lung at
E14.5. Note the dark staining picnotic
nuclei typical of apoptosis in F.
(C,D) Arrowheads point to the right lung.
Bars (A,B) 100 µm; (C,D) 250 µm;
(E,F) 100 µm.
490
L. De Moerlooze and others
Fig. 10. Immunohistochemical staining for skin differentiation and
proliferation markers. Transverse sections of dorsal skin from
heterozygous (A-D) and Fgfr2(IIIb)−/− fetuses (E-H) at E18.5 stained
with antibodies to cytokeratin 1 (A,E), cytokeratin 5 (B,F), loricrin
(C,G) and Ki67 (D,H). Bar, 100 µm.
heart, liver and kidney showed no discernible abnormalities in
the null embryos up to E18.5. Mice null for Fgf7 have kidneys
with a decreased volume by E16, and a reduced number of
nephrons was observed in adult animals (Qiao et al., 1999). We
were unable to examine postnatal tissue development as the
Fgfr2(IIIb)−/− mice die at birth, and the fetuses are too abnormal
to make a meaningful assessment of kidney size to body weight.
The homozygous mutant mice showed a number of skeletal
abnormalities. The most obvious was the lack of forelimbs,
hindlimbs and defective scapulae and pelvic girdle (Fig. 3). Two
Fgfs have been implicated in the initiation and formation of the
early limb; Fgf10, which is expressed in the lateral plate
mesoderm prior to overt limb bud initiation (Ohuchi et al., 1997),
and Fgf8, which subsequently appears in the apical ectodermal
ridge (AER) and stimulates limb bud outgrowth (Crossley et al.,
1996; Mahmood et al., 1995; Ohuchi et al., 1997; Vogel et al.,
1996). Fgfr2(IIIb) is expressed in the ectoderm of the
presumptive limb bud, which gives rise to the AER (Orr-Urtreger
et al., 1993; Xu et al., 1998). The results reported here support
these previous findings and show that presumptive limb buds
appear but fail to form a discernible AER. Moreover, by E10.5,
there is already a marked amount of apoptosis in the mesoderm
and overlying epithelium. Evidence for the involvement of Fgfr2
in limb initiation was suggested by mice homozygous for a
hypomorphic mutant allele of this receptor, which showed no
limb bud initiation, and limb defects of variable severity were
found in mice expressing a soluble dominant negative form of
Fgfr2(IIIb) (Celli et al., 1998; Xu et al., 1998). Finally, mice
deficient for Fgf10 were also shown to lack limbs (Min et al.,
1998; Sekine et al., 1999). Taken together, there is compelling
evidence that Fgf10 in the lateral plate mesoderm initiates limb
development by signalling through Fgfr2-(IIIb) to induce
formation of the AER and subsequent Fgf8 expression.
The skulls of Fgfr2(IIIb)-deficient mice showed a thinner
mandible, the absence of visible incisors and a cleft palate,
phenotypic defects similar to those found for mice deficient for
the homeobox gene Msx1 (Satokata and Maas, 1994). This
homeobox transcription factor is associated with mesenchymalepithelial interactions, particularly for bone and teeth, and
Fig. 11. In situ hybridization of dorsal skin to examine the expression of Fgfr2 isoforms. Skin sections from Fgfr2(IIIb)−/+ fetuses (A-D) and
Fgfr2(IIIb)−/− fetuses (E-H) were taken at E18.5. (A,E) Sections (same as B,F) stained with Giemsa in bright-field illumination to reveal the
cellular structure of the skin. pc, panniculus carnosus layer in the heterozygous skin absent in Fgfr2(IIIb)−/− mice. For the in situ hybridisation
analysis, the following antisense probes were used: (A,B,E,F) Fgfr2-TK, (C,G) Fgfr2(IIIb), (D,H) Fgfr2(IIIc). Bar, 100 µm.
FGFR2(IIIb) signalling in mouse development
including the limb, AER, facial primordia and dental follicle
mesenchyme. This suggests that Fgf signalling might be closely
linked, upstream or downstream to Msx gene expression.
Abnormal tooth development could also represent a further link
between Msx1 and Fgf signalling.
To date, many of the Fgfr2 mutations that underlie the human
craniosynostosis syndromes are found specifically in the IIIc
exon, but not the IIIb exon, of this receptor (DeMoerlooze and
Dickson, 1997). This would suggest that Fgfr2(IIIb) signalling
is not essential for suture formation. It is therefore interesting
that we found premature suture ossification associated with the
Fgfr2(IIIb)−/− fetuses. However, it is now known that Fgfr2(IIIb)
is expressed in differentiating osteoblasts at the osteogenic fronts
and therefore may have a role in normal suture formation (David
Rice, personal communication).
Two other aspects of the phenotype correlate with the defects
observed for Fgf3 null mice (Mansour et al., 1993). The fusion
of the caudal vertebrae giving rise to a curled tail (Fig. 3) and
the absence, in some mice, of an endolymphatic duct (Fig. 6),
which must contribute to the later inner ear malformations.
These abnormalities are consistent with previous findings that
show Fgf3 signals through the IIIb isoform of Fgfr2 and it is
expressed in the otic vesicle at E10.5 (Mathieu et al., 1995;
Wilkinson et al., 1989).
The skin of homozygous mutant mice was clearly abnormal
since the thickness of the dermis and epidermis were reduced
compared with control mice (Figs 10, 11). In addition, the
presumptive eyelids were absent in Fgfr2(IIIb) null fetuses and
may correlate with the normal expression of this receptor in the
underlying corneal epithelium (Orr-Urtreger et al., 1993).
However, an analysis of differentiation markers for skin revealed
a similar pattern of expression for cytokeratins 1, 5, 6, 10, 14 as
well as loricrin and involucrin (Fig. 10 and data not shown),
suggesting that there is an overall effect on proliferation but little
effect on differentiation. At this stage of development, we could
not exclude some functional defect of the hair follicle. This result
is somewhat different from two studies which have used
dominant negative Fgfr2(IIIb) receptors (Celli et al., 1998;
Werner et al., 1994). Targeting of a membrane-located dominant
negative Fgfr2(IIIb) to basal keratinocytes resulted in epidermal
atrophy and abnormalities in the hair follicles and a
hyperthickening of the dermis. However, expression of a soluble
dominant negative Fgfr2(IIIb) in the skin caused a reduction of
the dermis and epidermis, similar to the Fgfr2−/− mice, but, for
some mice, there were no hair follicles and the inappropriate
expression of cytokeratin 6, which is usually silent in normal
skin. These last two features were not part of the Fgfr2(IIIb)−/−
phenotype. These differences probably arise from the fact that
dominant negative receptors homodimerise and heterodimerise
with other Fgf receptors that bind to the same ligand giving rise
to a less specific inhibition of Fgf signalling. Thus, depending
on context, a dominant negative receptor could inhibit signalling
through several receptors and therefore give a more severe
phenotype than its equivalent germ line deletion.
Many of the observed abnormalities found in Fgfr2(IIIb)−/−
mice can be explained by mesenchyme-expressed ligand failing
to activate Fgfr2(IIIb) in adjacent epithelium. For the limb and
the lung, expression of the ligand (Fgf10) and receptor
(Fgfr2(IIIb) are well documented in adjacent cell lineages, and
fetuses deficient for Fgf10 show a similar phenotype to the
Fgfr2(IIIb)−/− mice. In the limb, there is compelling evidence of
491
signalling by Fgf10 in the lateral plate mesoderm to Fgfr2(IIIb)
in the overlying ectoderm, which leads to formation of the AER
(Ohuchi et al., 1997). The AER then acts as an important centre
for signalling to the underlying mesoderm thus establishing the
progress zone for continued growth and patterning. The data
herein indicate that AER formation is dependent upon
Fgfr2(IIIb) and its absence causes both the presumptive limb
ectoderm and mesoderm to undergo extensive apoptosis.
An analogous explanation could also account for the early
failure of lung and anterior pituitary development in the
Fgfr2(IIIb)−/− mice. Fgf10 is present in the lung mesoderm prior
to budding of the bronchi from the tracheal ectoderm, and in the
infundibulum during pituitary development. For the lung,
Fgfr2(IIIb) is known to be present in the responding ectoderm.
Furthermore, the importance of this signalling mechanism, not
only for the limb, lung and anterior pituitary, but also for several
other tissues and structures is suggested by defects found in the
skin, salivary gland, tooth, and inner ear.
We thank H. Gu and F. Grosvelt for plasmids pGH1, pMC-Cre and
pCAGGS-Cre, respectively, C. Mahony, V. Fantl, the ICRF transgenic
unit and Histology unit for their expert technical help. We would also
thank G. Stamp, I. Thesleff, S. Werner, I. Mason A and F. Grosvelt for
advice, M. Owen and H. McNeil for critically reading the manuscript.
This work was supported by a grant from the Human Frontier Science
Program.
REFERENCES
Amaya, E., Musci, T. and Kirschner, M. (1991). Expression of a dominant
negative mutant of the FGF receptor disrupts mesoderm formation in xenopus
embryos. Cell 66, 257-270.
Araki, K., Araki, M., Miyazaki, J.-I. and Vassalli, P. (1995). Site-specific
recombination of a transgene in fertilized eggs by transient expression of Cre
recombinase. Proc. Natl. Acad. Sci. USA 92, 160-164.
Arman, E., Haffner-Krausz, R., Chen, Y., Heath, J. K. and Lonai, P. (1998).
Targeted disruption of fibroblast growth-factor (FGF) receptor-2 suggests a
role for FGF signaling in pregastrulation mammalian development. Proc. Natl.
Acad. Sci. USA 95, 5082-5087.
Bellusci, S., Grindley, J., Emoto, H., Itoh, N. and Hogan, B. L. M. (1997).
Fibroblast growth-factor 10(FGF10) and branching morphogenesis in the
embryonic mouse lung. Development 124, 4867-4878.
Cardoso, W. V., Itoh, A., Nogawa, H., Mason, I. and Brody, J. S. (1997).
FGF-1 and FGF-7 induce distinct patterns of growth and differentiation in
embryonic lung epithelium. Dev. Dyn. 208, 398-405.
Carstens, R., Mckeehan, W. and Garcia-Blanco, M. (1998). An intronic
sequence element mediates both activation and repression of rat fibroblast
growth factor receptor 2 Pre-mRNA splicing. Mol. Cell. Biol. 18, 22052217.
Carstens, R. P., Eaton, J. V., Krigman, H. R., Walther, P. J. and
Garciablanco, M. A. (1997). Alternative splicing of fibroblast-growth-factorreceptor-2 (FGF-r2) in human prostate-cancer. Oncogene 15, 3059-3065.
Celli, G., Larochelle, W. J., MacKem, S., Sharp, R. and Merlino, G. (1998).
Soluble dominant-negative receptor uncovers essential roles for fibroblast
growth-factors in multiorgan induction and patterning. EMBO J. 17, 16421655.
Ciruna, B. G., Schwartz, L., Harpal, K., Yamaguchi, T. P. and Rossant, J.
(1997). Chimeric analysis of fibroblast growth-factor receptor-1 (FGFR1)
function – a role for FGFR1 in morphogenetic movement through the
primitive streak. Development 124, 2829-2841.
Colvin, J. S., Bohne, B. A., Harding, G. W., McEwen, D. G. and Ornitz, D.
M. (1996). Skeletal overgrowth and deafness in mice lacking fibroblast growth
factor receptor 3. Nature Genet. 12, 390-397.
Crossley, P. H., Minowada, G., MacArthur, C. A. and Martin, G. R. (1996).
Roles for FGF8 in the induction, initiation, and maintenance of chick limb
development. Cell 84, 127-136.
Del Gatto, F., Plet, A., Gesnel, M.-C., Fort, C. and Breathnach, R. (1997).
Multiple interdependent sequence elements control splicing of a fibroblast
growth factor receptor 2 alternative exon. Mol. Cell. Biol. 17, 5106-5116.
492
L. De Moerlooze and others
DeMoerlooze, L. and Dickson, C. (1997). Skeletal disorders associated with
fibroblast growth-factor receptor mutations. Curr. Opin. Genet. Dev. 7, 378385.
Deng, C., Wynshaw, B. A., Zhou, F., Kuo, A. and Leder, P. (1996). Fibroblast
growth factor receptor 3 is a negative regulator of bone growth. Cell 84, 91121.
Deng, C. X., Bedford, M., Li, C. L., Xu, X. L., Yang, X., Dunmore, J. and
Leder, P. (1997). Fibroblast growth-factor receptor-1 (FGFR-1) is essential
for normal neural-tube and limb development. Dev. Biol. 185, 42-54.
Deng, C. X., Wynshaw-Boris, A., Shen, M. M., Daugherty, C., Ornitz, D. M.
and Leder, P. (1994). Murine FGFR-1 is required for early postimplantation
growth and axial organization. Genes Dev. 8, 3045-3057.
DeVore, D. L., Horvitz, H. R. and Stern, M. J. (1995). An FGF receptor
signaling pathway is required for the normal-cell migrations of the sex
myoblasts in C-elegans hermaphrodites. Cell 83, 611-620.
Ericson, J., Norlin, S., Jessell, T. M. and Edlund, T. (1998). Integrated FGF
and bmp signaling controls the progression of progenitor-cell differentiation
and the emergence of pattern in the embryonic anterior-pituitary. Development
125, 1005-1015.
Fantl, V., Stamp, G., Andrews, A., Rosewell, I. and Dickson, C. (1995). Mice
lacking cyclin d1 are small and show defects in eye and mammary-gland
development. Genes Dev. 9, 2364-2372.
Finch, P., Cunha, G., Rubin, J., Wong, J. and Ron, D. (1995). Pattern of
keratinocyte growth factor and keratinocyte growth factor receptor expression
during mouse fetal development suggests a role mediating morphogenetic
mesenchymal-epithelial interactions. Develop. Dyn. 203, 223-240.
Gilbert, E., Del Gatto, F., Gesnel, M.-C., Fort, C. and Breathnach, R. (1993).
Control of BEK and K-SAM splice sites in alternative splicing of fibroblast
growth factor 2 Pre-mRNA. Mol. Cell. Biol. 13, 5461-5468.
Gu, H., Zou, Y.-R. and Rajewsky, K. (1993). Independent control of
immunoglobulin switch recombination at individual switch regions evidenced
through Cre-loxP-mediated gene targeting. Cell 73, 1155-1164.
Guo, L., Degenstein, L. and Fuchs, E. (1996). Keratinocyte growth factor is
required for hair development but not for wound healing. Genes Dev. 10, 165175.
Igarashi, M., Finch, P. and Aaronson, S. (1998). Characterization of
recombinant human fibroblast growth factor (FGF)-10 reveals functional
similarities with keratinocyte growth factor (FGF-7). J. Biol. Chem. 273,
13230-13235.
Jackson, D., Bresnick, J., Rosewell, I., Crafton, T., Poulsom, R., Stamp, G.
and Dickson, C. (1997). Fibroblast growth-factor receptor signaling has a role
in lobuloalveolar development of the mammary-gland. J. Cell. Sci. 110, 12611268.
Johnson, D. and Williams, L. (1993). Structural and functional diversity in the
FGF receptor multigene family. Adv Cancer Res. 60, 1-41.
Kaufman, M. H. (1992). The Atlas of Mouse Development. London: Academic
Press Ltd.
Kettunen, P., Karavanova, I. and Thesleff, I. (1998). Responsiveness of
developing dental tissues to fibroblast growth factors: Expression of splicing
alternatives of FGFR1, -2, -3, and of FGFR4; and stimulation of cell
proliferation by FGF-2, -4, -8, and –9. Dev. Gen. 22, 374-385.
Laird, P., Zijderveld, A., Linders, K., Rudnicki, M., Jaenisch, R. and Berns,
A. (1991). Simplified mammalian DNA isolation procedure. Nuc. Acids Res.
19, 4293.
Mahmood, R., Bresnick, J., Hornbruch, A., Mahony, C., Morton, N.,
Colquhoun, K., Martin, P., Lumsden, A., Dickson, C. and Mason, I.
(1995). A role for FGF-8 in the initiation and maintenance of vertebrate limb
bud outgrowth. Curr. Biol. 5, 797-806.
Mansour, S. L., Goddard, J. M. and Capecchi, M. R. (1993). Mice
homozygous for a targeted disruption of the protooncogene int-2 have
developmental defects in the tail and inner-ear. Development 117, 13-28.
Mason, I., Fuller-Pace, F., Smith, R. and Dickson, C. (1994). FGF7(keratinocyte growth factor) expression during mouse development suggests
roles in myogenesis, forebrain regionalisation and epithelial-mesenchymal
interactions. Mech. Dev. 45, 15-30.
Mathieu, M., Chatelain, E., Ornitz, D., Bresnick, J., Mason, I., Kiefer, P. and
Dickson, C. (1995). Receptor-binding and mitogenic properties of mouse
fibroblast-growth-factor-3 – modulation of response by heparin. J. Biol. Chem.
270, 24197-24203.
McKeehan, W. L., Wang, F. and Kan, M. (1998). The heparan-sulfate
fibroblast growth-factor family – diversity of structure and function. Prog.
Nucleic Acid Res. Mol. Biol. 59, 135-176.
McLeod, M. (1980). Differential staining of cartilage and bone in whole mouse
fetuses by alcian blue and alizarin red S. Teratology 22, 299-301.
Miki, T., Bottaro, D., Fleming, T., Smith, C. L., Burgess, W., Chan, A. and
Aaronson, S. (1992). Determination of ligand-binding specificity by
alternative splicing: Two distinct growth factor receptors encoded by a single
gene. Proc. Natl. Acad. Sci USA 89, 246-250.
Min, H., Danilenko, D., Scully, S., Bolon, B., Ring, B., Tarpley, J., DeRose,
M. and Simonet, W. (1998). Fgf-10 is required for both limb and lung
development and exhibits striking functional similarity to Drosophila
branchless. Genes Dev. 12, 3156-3161.
Ohuchi, H., Nakagawa, T., Yamamoto, A., Araga, A., Ohata, T., Ishimaru,
Y., Yoshioka, H., Kuwana, T., Nohno, T., Yamasaki, M., Itoh, N. and Noji,
S. (1997). The mesenchymal factor, FGF10, initiates and maintains the
outgrowth of the chick limb bud through interaction with FGF8, an apical
ectodermal factor. Development 124, 2235-2244.
Ornitz, D. M., Xu, J. S., Colvin, J. S., McEwen, D. G., MacArthur, C. A.,
Coulier, F., Gao, G. X. and Goldfarb, M. (1996). Receptor specificity of the
fibroblast growth-factor family. J. Biol. Chem. 271, 15292-15297.
Orr-Urtreger, A., Bedford, M., Burakova, T., Arman, E., Zimmer, Y., Yayon,
A., Givol, D. and Lonai, P. (1993). Developmental localization of the splicing
alternatives of fibroblast growth-factor receptor-2 (FGFR2). Dev. Biol. 158,
475-486.
Peters, K., Werner, S., Chen, G. and Williams, L. (1992). Two FGF receptor
genes are differentially expressed in epithelial and mesenchymal tissues
during limb formation and organogenesis in the mouse. Development 114,
233-243.
Peters, K., Werner, S., Liao, X., Wert, S., Whitsett, J. and Williams, L.
(1994). Targeted expression of a dominant negative FGF receptor blocks
branching morphogenesis and epithelial differentiation of the mouse lung.
EMBO J. 13, 3296-3301.
Qiao, J., Uzzo, R., Obara-Ishihara, T., Degenstein, L., Fuchs, E. and
Herzlinger, D. (1999). FGF-7 modulates ureteric bud growth and nephron
number in the developing kidney. Development 126, 547-554.
Reichman-Fried, M. and Shilo, B. Z. (1995). Breathless, a drosophila FGF
receptor homolog, is required for the onset of tracheal cell-migration and
tracheole formation. Mech. Dev. 52, 265-273.
Robinson, M. L., MacMillan-Crow, L. A., Thompson, J. A. and Overbeek,
P. A. (1995). Expression of a truncated FGF receptor results in defective lens
development in transgenic mice. Development 121, 3959-3967.
Satokata, I. and Maas, R. (1994). Msx1 deficient mice exhibit cleft palate and
abnormalities of craniofacial and tooth development. Nature Genet. 6, 348355.
Sekine, K., Ohuchi, H., Fujiwara, M., Yamasaki, M., Yoshizawa, T., Sato,
T., Yagishita, N., Matsui, D., Koga, Y., Itoh, N. and Kato, S. (1999). Fgf10
is essential for limb and lung formation. Nature Genet. 21, 138-141.
Thesleff, I. and Sharpe, P. (1997). Signalling networks regulating dental
development. Mech. Dev. 67, 111-123.
Treier, M., Gleiberman, A., O’Connell, S., Szeto, D., McMahon, J.,
McMahon, A. and Rosenfeld, M. (1998). Multistep signaling requirements
for pituitary organogenesis in vivo. Genes Dev. 12, 1691-1704.
Vogel, A., Rodriguez, C. and Izpisua-Belmonte, J. C. (1996). Involvement of
FGF-8 in initiation, outgrowth and patterning of the vertebrate limb.
Development 122, 1737-1750.
Weinstein, M., Xu, X. L., Ohyama, K. and Deng, C. X. (1998). FGFR-3 and
FGFR-4 function cooperatively to direct alveogenesis in the murine lung.
Development 125, 3615-3623.
Werner, S., Smola, H., Liao, X., Longaker, M., Krieg, T., Hofschneider, P.
and Williams, L. (1994). The function of KGF in morphogenesis of
epithelium and reepithelialization of wounds. Science 266, 819-822.
Werner, S., Weinberg, W., Liao, X., Peters, K., Blessing, M., Yuspa, S.,
Weiner, R. and Williams, L. (1993). Targeted expression of a dominantnegative FGF receptor mutant in the epidermis of transgenic mice reveals a
role of FGF in keratinocyte organization and differentiation. EMBO J. 12,
2635-2643.
Wilkinson, D., Bhatt, S. and McMahon, A. (1989). Expression pattern of the
FGF-related proto-oncogene int-2 suggests multiple roles in fetal
development. Development 105, 131-136.
Xu, X. L., Weinstein, M., Li, C. L., Naski, M., Cohen, R. I., Ornitz, D. M.,
Leder, P. and Deng, C. X. (1998). Fibroblast-growth-factor-receptor-2
(FGFR2)-mediated reciprocal regulation loop between FGF8 and FGF10 is
essential for limb induction. Development 125, 753-765.
Yamaguchi, F., Saya, H., Bruner, J. M. and Morrison, R. S. (1994).
Differential expression of 2 fibroblast growth factor-receptor genes is
associated with malignant progression in human astrocytomas. Proc. Natl.
Acad. Sci. USA 91, 484-488.
Yamaguchi, T. P. and Rossant, J. (1995). Fibroblast growth-factors in
mammalian development. Curr. Opin. Genet. Dev. 5, 485-491.
Yamasaki, M., Miyake, A., Tagashira, S. and Itoh, N. (1996). Structure and
expression of the rat messenger-RNA encoding a novel member of the
fibroblast growth-factor family. J. Biol. Chem. 271, 15918-15921.