Download Sulfite oxidation in the purple sulfur bacterium

Microbiology (2013), 159, 2626–2638
Editor’s Choice
DOI 10.1099/mic.0.071019-0
Sulfite oxidation in the purple sulfur bacterium
Allochromatium vinosum: identification of SoeABC
as a major player and relevance of SoxYZ in the
process
Christiane Dahl, Bettina Franz,3 Daniela Hensen,4 Anne Kesselheim
and Renate Zigann
Correspondence
Christiane Dahl
Institut für Mikrobiologie & Biotechnologie, Rheinische Friedrich-Wilhelms-Universität Bonn,
Meckenheimer Allee 168, 53115 Bonn, Germany
[email protected]
Received 1 July 2013
Accepted 11 September 2013
In phototrophic sulfur bacteria, sulfite is a well-established intermediate during reduced sulfur
compound oxidation. Sulfite is generated in the cytoplasm by the reverse-acting dissimilatory
sulfite reductase DsrAB. Many purple sulfur bacteria can even use externally available sulfite as a
photosynthetic electron donor. Nevertheless, the exact mode of sulfite oxidation in these
organisms is a long-standing enigma. Indirect oxidation in the cytoplasm via adenosine-59phosphosulfate (APS) catalysed by APS reductase and ATP sulfurylase is neither generally
present nor essential. The inhibition of sulfite oxidation by tungstate in the model organism
Allochromatium vinosum indicated the involvement of a molybdoenzyme, but homologues of the
periplasmic molybdopterin-containing SorAB or SorT sulfite dehydrogenases are not encoded in
genome-sequenced purple or green sulfur bacteria. However, genes for a membrane-bound
polysulfide reductase-like iron–sulfur molybdoprotein (SoeABC) are universally present. The
catalytic subunit of the protein is predicted to be oriented towards the cytoplasm. We compared
the sulfide- and sulfite-oxidizing capabilities of A. vinosum WT with single mutants deficient in
SoeABC or APS reductase and the respective double mutant, and were thus able to prove that
SoeABC is the major sulfite-oxidizing enzyme in A. vinosum and probably also in other
phototrophic sulfur bacteria. The genes also occur in a large number of chemotrophs, indicating a
general importance of SoeABC for sulfite oxidation in the cytoplasm. Furthermore, we showed
that the periplasmic sulfur substrate-binding protein SoxYZ is needed in parallel to the
cytoplasmic enzymes for effective sulfite oxidation in A. vinosum and provided a model for the
interplay between these systems despite their localization in different cellular compartments.
INTRODUCTION
Anoxygenic purple sulfur bacteria like the gammaproteobacterium Allochromatium vinosum, a member of the
family Chromatiaceae, are able to derive energy from light
by using reduced sulfur compounds as photosynthetic
electron donors. The substrates of purple sulfur bacteria
primarily include sulfide and elemental sulfur (Imhoff,
2005a). A. vinosum is a metabolically especially versatile
3Present address: Institut für Medizinische Mikrobiologie und
Krankenhaushygiene, Zentrum der Hygiene, Universitätsklinikum
Frankfurt, Paul-Ehrlich-Straße 40, 60596 Frankfurt am Main, Germany.
4Present address: Merck Millipore, Boulevard Industrial Park, Padge
Road, Nottingham NG9 2JR, UK.
Abbreviation: APS, adenosine-59-phosphosulfate.
Two supplementary tables are available with the online version of this
paper.
2626
purple sulfur bacterium that can also utilize thiosulfate and
sulfite (Imhoff et al., 1998; Weissgerber et al., 2011). The
first major process in the oxidation of thiosulfate and
sulfide is the formation of intracellularly stored sulfur
globules. The oxidation of thiosulfate to sulfate with sulfur
globules as an intermediate involves the periplasmic Sox
proteins SoxYZ, SoxB, SoxXAK and SoxL (Pott & Dahl,
1998; Hensen et al., 2006; Welte et al., 2009). For the
oxidation of sulfide, A. vinosum possesses the genetic
equipment for at least three different enzymes catalysing
this reaction, namely the soluble periplasmic flavocytochrome c and the membrane-bound sulfide : quinone
oxidoreductases SqrD and SqrF. The last two are both
predicted to be oriented towards the periplasm (Reinartz
et al., 1998; Gregersen et al., 2011; Weissgerber et al., 2011).
In A. vinosum, the sulfur globules are deposited in the
same cellular compartment as the periplasmic thiosulfateand sulfide-oxidizing enzymes. This is evidenced by the
Downloaded from www.microbiologyresearch.org by
071019 G 2013 SGM
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:13:25
Printed in Great Britain
Sulfite oxidation in A. vinosum
presence of signal peptide-encoding sequences in the genes
for the three structural proteins constituting the sulfur
globule envelope (Pattaragulwanit et al., 1998; Prange et al.,
2004; Frigaard & Dahl, 2008). For further oxidation of
stored sulfur, the so-called Dsr system is of essential
importance (Pott & Dahl, 1998; Dahl et al., 2005; Lübbe
et al., 2006; Sander et al., 2006). The product of the Dsr
pathway is sulfite, generated by a reverse-acting dissimilatory sulfite reductase (DsrAB), an enzyme that is well
known to be located in the cytoplasm (Hipp et al., 1997;
Pott & Dahl, 1998; Frigaard & Dahl, 2008).
The last step is the oxidation of sulfite, yielding sulfate as
the final product. Sulfate formation from sulfite is
energetically favourable and carried out by a wide range
of organisms (Simon & Kroneck, 2013). Many sulfiteoxidizing enzymes are located outside the cytoplasmic
membrane (in the periplasm in Gram-negative bacteria).
The best-characterized enzyme belonging to this group,
SorAB, stems from Starkeya novella and consists of a
molybdopyranopterin cofactor-carrying subunit (SorA)
and a monohaem cytochrome c (SorB) (Kappler et al.,
2000; Kappler & Bailey, 2005). SorA-type molybdoproteins
without a SorB subunit have been termed SorT (D’Errico
et al., 2006; Wilson & Kappler, 2009), but recently this
discrimination has been questioned (Simon & Kroneck,
2013). A second option for oxidation of sulfite in the
periplasm is the Sox system. It has been shown that sulfite
is accepted in vitro as a substrate of the reconstituted Sox
system from the chemotroph Paracoccus denitrificans
(Friedrich et al., 2001). Notably, Friedrich and coworkers
proved this reaction to be independent of the presence of
SoxCD, a molybdohaemoprotein catalysing the six-electron oxidation of SoxY-cysteine-bound persulfide to
sulfone sulfur. Purple bacteria that form sulfur globules
during thiosulfate oxidation contain the Sox system, albeit
without the SoxCD proteins (Hensen et al., 2006; Meyer
et al., 2007; Frigaard & Dahl, 2008).
Oxidation of sulfite generated by the cytoplasmic Dsr
proteins via the periplasmic pathways described would first
require transport across the cytoplasmic membrane.
However, such transport is probably not necessary in
organisms that contain a further well-characterized sulfite
oxidation pathway: it is firmly established that a number of
purple as well as green anoxygenic phototrophic sulfur
bacteria oxidize sulfite in the cytoplasm using an indirect
pathway via adenosine-59-phosphosulfate (APS) catalysed
by APS reductase and ATP sulfurylase (Dahl, 1996; Sánchez
et al., 2001; Frigaard & Dahl, 2008; Rodriguez et al., 2011).
The electrons generated by the oxidative formation of APS
from sulfite and AMP are fed into the photosynthetic
electron transport chain at the level of menaquinone
either by AprM or by the much better characterized
QmoABC/QmoABHdrCB complex (Meyer & Kuever,
2007; Rodriguez et al., 2011; Ramos et al., 2012; Grein
et al., 2013). Notably, however, neither is the APS reductase
pathway generally present in purple sulfur bacteria nor is it
essential in A. vinosum (Dahl, 1996; Sánchez et al., 2001).
http://mic.sgmjournals.org
Recently, involvement of a putative heterotrimeric membrane-bound complex named SoeABC (sulfite-oxidizing
enzyme) in sulfite oxidation in the cytoplasm of the
organosulfonate-degrading chemotrophic alphaproteobacterium Ruegeria pomeroyi has been reported, although not
rigorously documented, by Lehmann et al. (2012). The
SoeABC protein appears to be a member of the complex
iron–sulfur molybdoproteins and consists of an NrfD/PsrClike membrane anchor (SoeC) and two cytoplasmic
subunits: an iron–sulfur protein (SoeB) and a molybdoprotein with an N-terminal iron–sulfur cluster binding site
(SoeA). It should be noted that SoeABC and the periplasmic
Sor-type sulfite dehydrogenases belong to completely
different families of molybdoenzymes. SorA and relatives
belong to the sulfite oxidase proteins, which bind a single
molybdopterin without a second nucleotide. SoeA falls into
the molybdopterin-binding MopB superfamily. In many
characterized members of this family molybdopterin is present
in the form of a dinucleotide, with two molybdopterin dinucleotide units per molybdenum. Similarities are obvious
within each molybdoenzyme family sequence, whereas no
significant homologies can be detected between members of
different families (Kisker et al., 1998). Genes encoding
proteins related to SoeABC are present in purple as well as
green sulfur bacteria, and in the past years have repeatedly
been speculated to be involved in the oxidation of sulfite
generated by the Dsr system in the cytoplasm (Frigaard &
Bryant, 2008; Frigaard & Dahl, 2008). Notably, soeABC-like
genes co-localize with dsr genes not only in the metagenome-derived sequence of another bacterium that belongs
to the Roseobacter clade like R. pomeroyi (Lenk et al., 2012),
but also in several green sulfur bacteria and in Halorhodospira
halophila, a purple sulfur bacterium of the family Ectothiorhodospiraceae (Dahl, 2008; Frigaard & Dahl, 2008).
Independent experimental evidence for the involvement of a
molybdoprotein was obtained by inhibition of sulfite
oxidation in A. vinosum with the molybdate-antagonist
tungstate (Dahl, 1996).
In this work, we aimed to obtain a clearer picture of the
proteins involved in the oxidation of sulfite in purple sulfur
bacteria and chose A. vinosum as the model organism. An
array of strains carrying single and multiple deletions of
relevant genes was studied with regard to the oxidation of
externally supplied and internally generated sulfite.
Thereby, we identified AvSoeABC (Alvin_2491-2489) as a
major player in the oxidation of sulfite. In addition, we
present evidence that SoxYZ is also essential in sulfite
oxidation, whilst the other Sox proteins are dispensable for
the process.
METHODS
Bacterial strains, plasmids, PCR primers and growth conditions. The bacterial strains, plasmids and primers used in this study
are listed in Table 1. A. vinosum strains were cultivated photoorganoheterotrophically in RCV medium (Weaver et al., 1975) or
photolithoautotrophically in Pfennig medium (Pfennig & Trüper,
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:13:25
2627
C. Dahl and others
Table 1. Bacterial strains and plasmids used in this study
Strain or plasmid
Escherichia coli strain
S17-1
Allochromatium vinosum strains
Rif50
SM50
soxXVKm
soxBXVKm
DsoxY
DsoxY+YZ
DsoxY DsoeAEm
aprB : : VKm
DsoxY aprB : : VKm
DsoeAEm
aprB : : VKm DsoeAEm
DsoxY aprB : : VKm DsoeAEm
Plasmids
pBBR1-MCS2
pDsoxY+YZ
pNTS35
pK18mobsacB
pK18mobsacBDsoeA
pK18mobsacBDsoeAEm
pUC19Ery
pSUP301
pSUP301DsoeAEm
Primers
Avin2491fw1
Avin2491rev1
Avin2491fw2
Avin2491rev2
Genotype or phenotype
294 (recA thi pro hsdR2M+) Tpr Smr [RP4-2-Tc : : Mu-Km : Tn7]
Simon et al. (1983)
Rif r, spontaneous rifampicin-resistant mutant of DSM 180T
Smr, spontaneous streptomycin-resistant mutant of DSM 180T
Kmr, soxX : : VKm in DSM 180T
Kmr, soxX : : VKm in DSM 180T
Rif r, in-frame deletion of soxY in Rif50
Rif r Kmr, complementation of DsoxY
Rif r Emr; DsoeA Em 51 nt upstream of soeA ATG in DsoxY
Kmr Smr, aprB : : VKm in SM50
Kmr Rif r, aprB : : VKm in DsoxY
Emr Rif r, DsoeA Em 51 nt upstream of soeA ATG in Rif50
Kmr Emr, Smr, DsoeA Em 51 nt upstream of soeA ATG in aprB : : VKm
Kmr Emr Rif r, Em 51 nt upstream of soeA ATG in DsoxY aprB : : VKm
Lübbe et al. (2006)
Dahl (1996)
Hensen et al. (2006)
Hensen et al. (2006)
Hensen et al. (2006)
Hensen et al. (2006)
This work
Dahl (1996)
This work
This work
This work
This work
Kmr Mob+, rep lacZa
Kmr, 1.5 kb PCR fragment of soxYZ (XbaI) in XbaI of pBBR1-MCS2
Kmr cartridge (EcoRI) from pHP45VKm in PvuII within aprB
Kmr Mob+, sacB oriV oriT lacZa
Kmr HindIII fragment of PCR-amplified genome region around soeA
(Alvin_2491) with deletion of 2864 bp of the soeA sequence
Kmr Emr, 1.1 kb blunt-ended HindIII–EcoRI fragment from pUC19Ery
in SspI of pK18mobsacBDsoeA
Apr Emr, from pE194 in SmaI of pUC19
Apr Kmr Mob+
Apr Emr, 2.9 kb HindIII fragment from pK18mobsacBDsoeAEm in
HindIII of pSUP301
Kovach et al. (1995)
Hensen et al. (2006)
Dahl (1996)
Schäfer et al. (1994)
This work
GGCGGGAAGCTTTCCGAATGATCCGCT
TTGCTTCCCGAAGATACTGGCTGGATCCTG
CAGGATCCAGCCAGTATCTTCGGGAAGCAA
GCGAACAAGCTTCCGACGGCATAGAAC
This
This
This
This
1992) without reduced sulfur compound, referred to as ‘0 medium’.
Sulfide or sulfite was added as electron source at the desired
concentration. The cultivation was performed under anoxic conditions and continuous illumination at 30 uC either in completely filled
screw-capped culture bottles or in thermostatted glass fermenters.
Escherichia coli was cultivated in LB medium (Sambrook et al., 1989).
Antibiotics used for mutant selection were applied at the following
concentrations: for E. coli: ampicillin 100 mg ml21, kanamycin 50 mg
ml21, erythromycin 100 mg ml21, chloramphenicol 50 mg ml21; for
A. vinosum: rifampicin 50 mg ml21, streptomycin 50 mg ml21,
ampicillin 10 mg ml21, kanamycin 10–25 mg ml21, erythromycin
10 mg ml21.
Recombinant DNA techniques. Standard methods were used for
molecular biological techniques. Chromosomal DNA of A. vinosum
strains was obtained by a modified sarcosyl lysis (Bazaeal & Helinski,
1968). The genotypes of the A. vinosum recombinants used in this
study were confirmed by Southern hybridization and PCR. The latter
is the only method of choice to confirm complementation strains.
Southern hybridization was performed overnight at 68 uC. PCR
amplifications with Taq DNA polymerase and Pfu DNA polymerase
were done essentially as described previously (Dahl, 1996). DNA
probes for Southern hybridization were digoxigenin labelled by PCR.
2628
Reference
This work
Leenhouts et al. (1990)
Simon et al. (1983)
This work
work
work
work
work
Plasmid DNA from E. coli was purified using the QIAprep Spin
Miniprep Kit (Qiagen).
Construction of A. vinosum single-, double- and triple-mutant
strains. For the substitution of soeA (Alvin_2491) in the genome of
A. vinosum by an erythromycin cassette, SOE PCR (Horton, 1995)
fragments were constructed using primer pairs Avin2491fw1/
Avin2491rev1 and Avin2491fw2/Avin2491rev2 (Table 1). The resulting fragment was inserted into plasmid pK18mobsacB (Schäfer
et al., 1994) by HindIII restriction sites resulting in plasmid
pK18mobsacBDsoeA. After digestion with HindIII and EcoRI the
erythromycin cassette from pUC19Ery was blunt-ended using Klenow
polymerase and ligated into the SspI site of pK18mobsacBDsoeA,
resulting in pK18mobsacBDsoeAEm. The SspI site is situated 51 nt
upstream of the soeA ATG start codon and 110 nt downstream of the
TGA stop codon of the preceding gene Alvin_2492. Thus, it was
guaranteed that expression of Alvin_2492 was not affected by
insertion of the antibiotic resistance cassette. The 2.9 kb HindIII
fragment of pK18mobsacBDsoeAEm was then inserted at the HindIII
site of pSUP301. The final mobilizable construct pSUP301DsoeAEm.
was transferred from E. coli S17-1 to A. vinosum strains Rif50,
aprB : : VKm, DsoxY and DsoxY aprB : : VKm by conjugation
(Pattaragulwanit & Dahl, 1995). For the insertional inactivation of
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:13:25
Microbiology 159
Sulfite oxidation in A. vinosum
aprB, plasmid pNTS35 (Dahl, 1996) was conjugationally transferred
from E. coli S17-1 to A. vinosum strain DsoxY. Transconjugants were
selected on RCV plates containing the appropriate antibiotics under
anoxic conditions in the light. Double cross-over recombinants lost
the vector-encoded ampicillin resistance. The genotype of double
cross-over recombinants was verified by Southern hybridization
experiments.
Characterization of phenotypes, detection of sulfur species
and protein determination. A. vinosum WT and mutant strains
were characterized in batch culture experiments essentially as
described previously (Prange et al., 2004; Hensen et al., 2006). Cells
of A. vinosum, grown photo organoheterotrophically on malate [RCV
medium (Weaver et al., 1975)] for 3 days were used as an inoculum
for experiments concerned with transformation of sulfide and sulfite.
The culture volume of the precultures was 500 ml. Inoculum cells
were harvested by centrifugation (10 min, 2680 g) and washed once
in ‘0 medium’. The culture volume for phenotypic analyses of WT
and mutant strains on 5 mM sulfite was 250 ml. Experiments
concerned with transformation of sulfide were performed in 1.5 l
fermenters. To maintain pH 7.0, sterile HCl (0.5 M) and Na2CO3
(0.5 M) solutions were added automatically.
Sulfide, thiosulfate and sulfate were determined either by HPLC
(Rethmeier et al., 1997), or by classical colorimetric or turbidometric
methods as described previously (Dahl, 1996). Elemental sulfur and
tetrathionate were determined colorimetrically by cyanolysis (Bartlett
& Skoog, 1954; Kelly et al., 1969; Dahl, 1996). Sulfite was determined
via the fuchsin method as described by Dahl (1996). Protein
concentrations were determined using the Bradford reagent (Sigma)
as specified by the manufacturer.
RESULTS
Occurrence of sulfite oxidation-related genes in
genome-sequenced purple sulfur bacteria
A survey of all genome sequences available for a
physiologically coherent group of bacteria can provide
revealing insights into pathways of general, major or
possibly only minor importance. We therefore searched the
currently completely sequenced phototrophic members of
the families Chromatiaceae and Ectothiorhodospiraceae for
the presence of sulfite oxidation-related genes. Table 2
provides a compilation of our results. From these findings,
it is evident that periplasmic sulfite-oxidizing systems are
not present universally in purple sulfur bacteria. Whilst the
sulfur substrate-binding protein SoxYZ is present irrespective of the organisms’ substrate range, with only one
exception (Thioflaviococcus mobilis), the presence of
SoxXA(K) and SoxB appears to be strictly linked to the
ability of the cells to utilize thiosulfate (Table 2).
Nevertheless, participation of the Sox system in sulfite
oxidation in those strains that contain Sox proteins is not
completely excluded. Furthermore, our survey showed that
only a single purple sulfur bacterium, T. mobilis, contains a
sorA-like gene (Table 2), implying that the encoded enzyme
is of very restricted importance in this organism group.
The cytoplasmic APS reductase pathway occurs in several,
although not all, purple sulfur bacteria. The electronaccepting unit for AprBA appears to be AprM in most
cases, but is replaced by QmoABHdrBC in Thiocystis
http://mic.sgmjournals.org
violascens (Table 2). The only probable sulfite-oxidizing
unit that is encoded in all sequenced purple sulfur bacteria
is SoeABC (Table 2), pointing to a general and major
importance of this membrane-bound complex iron–sulfur
molybdoprotein.
In A. vinosum, SoeABC is encoded by genes Alvin_2491
(soeA), Alvin_2490 (soeB) and Alvin_2489 (soeC). The
protein consists of the 108.95 kDa molybdoprotein SoeA
carrying one [Fe4S4] cluster at the N-terminus, the
26.995 kDa iron–sulfur protein SoeB, which upon comparison with related structurally characterized proteins
(Jormakka et al., 2008) is predicted to bind four [Fe4S4]
clusters, and a 35.715 kDa NrfD/PsrC-like membrane
protein (Simon & Kern, 2008) with eight transmembrane
helices. Neither AvSoeA and AvSoeB nor any of the other
purple sulfur bacterial SoeA or SoeB proteins listed in
Table 2 are synthesized with cleavable TAT signal peptides
that are usually present on the active-site subunits of the
biochemically well-characterized periplasmic sulfur-metabolizing complex iron–sulfur molybdoproteins, i.e. polysulfide and sulfur reductase (PsrABC, SreABC), thiosulfate
reductase (PhsABC) or tetrathionate reductase (TtrABC)
(Krafft et al., 1992; Heinzinger et al., 1995; Hensel et al.,
1999; Laska et al., 2003). We can thus state conservatively
that SoeA and SoeB are located in the cytoplasm and
attached to the cytoplasmic membrane by interaction with
SoeC. The holoprotein would therefore be well suited for
oxidation of sulfite generated in the cytoplasm.
Further indication for an involvement of SoeABC in
dissimilatory sulfur oxidation in A. vinosum was gathered
during recent genome-wide transcriptional profiling
(Weissgerber et al., 2013). Relative transcription of all
three A. vinosum soe genes was found to be increased ~3fold during photolithoautotrophic growth on sulfide
or thiosulfate compared to photo organoheterotrophic
growth on malate (2.99-, 2.77- and 2.93-fold increase on
sulfide and 1.96, 1.98 and 3.00-fold increase on thiosulfate,
for soeA, -B and -C, respectively). Changes in the same
range were observed for the genes encoding the enzymes of
the APS reductase pathway when thiosulfate replaced
malate, whilst relative transcript levels for the sat-aprMBA
genes were 7.6- to 9.7-fold higher in the presence of sulfide
compared with the presence of malate.
Oxidation of externally supplied sulfite by
A. vinosum: role of SoeABC and APS reductase
To assess the importance of the SoeABC protein in A.
vinosum, a mutant strain (A. vinosum DsoeAEm) was
constructed that carries a deletion of the soeA gene and an
insertion of an erythromycin resistance cassette. The latter
was positioned immediately upstream of the original soeA
gene, but well downstream of the stop codon of the
preceding gene Alvin_2492, thereby ensuring that expression of Alvin_2492 was not affected. The same DsoeAEm
mutation was also introduced into an A. vinosum strain
already lacking APS reductase (Dahl, 1996). Previously, we
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:13:25
2629
C. Dahl and others
2630
Table 2. Proteins related to sulfite oxidation encoded in genome-sequenced purple sulfur bacteria
With the exception of Thiorhodospira sibirica all organisms listed in this table contain a complete set of dsr genes (dsrABEFHCMKLJOPN).The soxCD genes are not listed here because they do not
occur in any of the sequenced anoxygenic phototrophic bacteria. The absence of signal peptides was confirmed for all SoeA and SoeB homologues listed here. The proteins are thus predicted to be
cytoplasmic.
Organism
Sulfur substrate
Sat
AprBA
AprM
Qmo
SorA
SoeABC
SoxXAK
SoxB
SoxYZ
Family Chromatiaceae
Allochromatium vinosum
T
Sulfide, S0, thiosulfate,
Alvin_1118
Alvin_1120-1121
Alvin_1119
–
–
Alvin_2491-2489
Alvin_2168-2170
Thi970DRAFT_
Thi970DRAFT_00963-
Thi970DRAFT_00962
–
–
Thi970DRAFT_
–
Alvin_2167
Alvin_2111-2112
sulfite
DSM 180
Thiorhodovibrio sp. 970
Sulfide, S0 (thiosulfate and
sulfite not reported)
Thiocapsa marina 5811
T
(DSM 5653 )
Thiocystis violascens
DSM 198T
Sulfide, S0, thiosulfate,
00964
00961
ThimaDRAFT_1689 ThimaDRAFT_
sulfite
Sulfide, S0, thiosulfate,
ThimaDRAFT_4550
–
–
4551-4552
Thivi_0893
–
Thi970DRAFT_01660-01661
00955-00957
Thivi_3300-3299
ThimaDRAFT_
0331-0329
–
sulfite
Thivi_3114-3111
ThimaDRAFT_
ThimaDRAFT_4579
ThimaDRAFT_0728-0729,
ThimaDRAFT_3536-3537
4578-4576
–
Thivi_4531-4533
Thivi_3804-3802
Thivi_2200
Thivi_3138-3139
–
ThidrDRAFT_
ThidrDRAFT_
ThidrDRAFT_2415
ThidrDRAFT_2534-2535
2883-2881
2416–2418
(qmoABhdrCB),
no QmoC
Thiorhodococcus drewsii
Sulfide, S0, thiosulfate
ThidrDRAFT_3161
AZ1 (DSM 15006T)
Thioflaviococcus mobilis
T
DSM 8321
Marichromatium
purpuratum 984 (DSM
ThidrDRAFT_
ThidrDRAFT_1494
–
1495-1496
Sulfide, S0 (sulfite not
Thimo_1948
Thimo_1220-1219
Thimo_1221
–
Thimo_2977
–
–
Thimo_1580-1582
–
–
–
tested)
Sulfide, S0, thiosulfate
–
–
–
(sulfite not tested)
MarpuDRAFT_
2159-2161
MarpuDRAFT_
MarpuDRAFT_0224
MarpuDRAFT_0579-0580
0223-0221
1591T)
Family
Ectothiorhodospiraceae
Thiorhodospira sibirica
ATCC 700588T
Sulfide, S0 (sulfite not
–
–
–
–
–
tested)
ThisiDRAFT_1377,
–
–
ThisiDRAFT_0337-0336
ThisiDRAFT_0834,
ThisiDRAFT_2148
Halorhodospira halophila
Sulfide, thiosulfate
–
–
–
–
–
Hhal_1936-1934
SL1 (DSM 244T)
Hhal_1948 (fused
Hhal_1939
Hhal_1941-1942
soxXA), no soxK
Microbiology 159
The genes for the following biochemically well characterized proteins served as baits: aprMBA and sat genes from A. vinosum and qmoABC from Desulfovibrio desulfuricans for the APS reductase
pathway, soxYZ, soxXAK and soxL from A. vinosum and soxCD from Paracoccus pantotrophus for the Sox pathway, sorAB from S. novella and soeABC from R. pomeroyi. In the case of the soeABC
genes, a function for the encoded proteins has been reported but not rigorously documented (Lehmann et al., 2012). References for substrate ranges: Bryantseva et al. (1999), Zaar et al. (2003),
Caumette et al. (2004) and Imhoff (2005a, b).
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:13:25
Sulfite oxidation in A. vinosum
reported that crude extracts of WT A. vinosum catalysed
sulfite-dependent ferricyanide reduction in the absence of
AMP (Dahl, 1996). This activity was no longer detectable
in the A. vinosum DsoeAEm mutant strain. We concluded
therefore that the protein encoded by the soeABC genes is
identical with the AMP-independent sulfite-oxidizing
entity in A. vinosum.
In a first set of experiments, we studied the phenotypes of
A. vinosum WT, the APS reductase and SoeABC-deficient
single-mutant strains as well as that of the corresponding
double mutant regarding the oxidation of externally
supplied sulfite under anoxic conditions in the light. The
experiments were performed in batch culture in 250 ml
bottles that were completely filled with medium containing
5 mM sulfite as the only source of sulfur and electrons. The
A. vinosum strain lacking only APS reductase exhibited a
phenotype clearly discernible from that of the WT, i.e.
sulfite was oxidized with a significantly lower rate (Table
3). This finding is in agreement with results reported by
Sánchez et al. (2001) who compared sulfide oxidation by A.
vinosum WT and the APS reductase-deficient strain in
continuous culture. While Sánchez et al. (2001) observed
only small differences between WT and APS reductasedeficient strains at light-limiting irradiances, the presence
of the APS reductase pathway was clearly advantageous for
A. vinosum at high irradiances. This finding explains why
initial batch culture experiments performed in 1.5 l culture
vessels allowing only limited light penetration to the centre
of the culture failed to demonstrate an effect of APS
reductase deficiency (Dahl, 1996).
As evident from Table 3, the SoeABC-deficient A. vinosum
mutant exhibited an even more apparent phenotype with
Table 3. Sulfite oxidation rates in A. vinosum WT and mutant
strains lacking functional APS reductase, SoeABC, SoxYZ or
combinations thereof
Strain
WT
aprB : : VKm
DsoeAEm
aprB : : VKm DsoeAEm
DsoxY
DsoxY aprB : : VKm
DsoxY DsoeAEm
DsoxY aprB : : VKm DsoeAEm
Sulfite oxidation rate
[nmol min”1 (mg protein)”1]
64.6±4.6
26.0±8.2
10.9±8.0
4.5±0.5
5.2±0.4
6.4±1.2
6.5±0.6
4.0±1.2
Initial sulfite concentration: 5 mM. Experiments were performed in
completely filled 250 ml culture bottles. A background rate of
chemical sulfite oxidation was determined for medium incubated
under the same experimental conditions (0.33 nmol min21 ml21)
and has already been deducted from the rates given. Initial protein
concentration: 56–134 mg ml21.
http://mic.sgmjournals.org
regard to the oxidation of externally added sulfite than the
mutant solely lacking APS reductase. The specific sulfite
oxidation rate of the former amounted to only 17±10 % of
the WT (Table 3). This finding is again in full agreement
with Sánchez et al. (2001), who reported that under all the
conditions tested an APS reductase-independent pathway
was responsible for most of the sulfur flow to sulfate (69–
100 %) in A. vinosum. A knockout of both aprB and soeA
led to an additive effect with a residual specific rate of
sulfite oxidation for whole cells of only ~7 % of the WT
(Table 3).
Oxidation of externally supplied sulfite by
A. vinosum: role of Sox proteins
As already outlined in the Introduction, it has been
demonstrated convincingly that sulfite is accepted in vitro
as a substrate of the reconstituted Sox system from the
chemotroph P. denitrificans (Rother et al., 2001). In this
case, the reaction cycle has been proposed to be simpler
than that needed for oxidation of thiosulfate. The cycle
would start with SoxXA-catalysed oxidative coupling of
sulfite to the cysteine in the C-terminal SoxY ‘GGCGG’
motif followed by a SoxB-mediated hydrolysis reaction
releasing sulfate (Sauvé et al., 2007; Kappler & Maher,
2013). An involvement of the periplasmic Sox proteins in
the oxidation of sulfite in purple sulfur bacteria is thus not
a priori excluded, especially where the oxidation of external
sulfite is concerned. We therefore conducted a series of
experiments in which we studied the effect of a deficiency
in various Sox proteins on sulfite oxidation in A. vinosum.
The assumption that coordinated action of the A. vinosum
Sox proteins is necessary for their in vivo function
originally led us to the conclusion that, if any phenotype
of Sox protein deficiency was detectable, it should be the
same or at least very similar, irrespective of which specific
Sox protein or which combination thereof is removed.
However, surprisingly this was not the case. While both an
A. vinosum mutant lacking functional SoxXAK and a
mutant additionally lacking SoxB behaved virtually indiscernibly from the WT (Table S1, available in Microbiology
Online), the DsoxY mutant showed a significant decrease in
sulfite oxidation rate (Tables 3 and S1). It should be
emphasized that the experiments compiled in Tables 3 and
S1 were not performed under exactly the same experimental conditions. The experiments summarized in Table
S1 were run in 1.5 l culture vessels and thus light intensities
in the centre of the cultures were lower than in the 250 ml
cultures used for the experiments compiled in Table 3. It is
evident that the specific sulfite oxidation rates for WT A.
vinosum are higher at higher irradiance [64.6±4.6 versus
36.2±1.6 nmol min21 (mg protein)21 in 250 ml and 1.5 l
cultures, respectively]. The lack of a protein important for
sulfite oxidation (SoxYZ in this case) has a more drastic
effect under high irradiances, just as has already been found
for APS reductase (Sanchez et al., 2001). Reintroduction of
soxYZ into the soxY-deficient mutant (strain A. vinosum
DsoxY+YZ) resulted in complete restoration of the WT
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:13:25
2631
C. Dahl and others
Oxidation of sulfide in A. vinosum strains
deficient in SoeABC, APS reductase and/or
SoxYZ
We now set out to define the roles of the newly detected
cytoplasmically oriented membrane-bound molybdenum
cofactor-containing SoeABC complex as well as the
periplasmic SoxYZ protein in the very complex transformation of sulfur compounds occurring during oxidation of sulfide to sulfate. To this end, a suitable set of A.
vinosum mutant strains was studied in 1.5 l fermenter
cultures under pH control. This experimental design
guaranteed full comparability of results obtained for this
multi-step process and enabled sampling for various
different sulfur compounds at ample time points. We
could thus lay a special focus on intermediates of the
process as well as the final sulfur product(s).
The WT A. vinosum control cultures behaved as expected:
sulfide was rapidly converted (Fig. 1a) to sulfur, which
transiently accumulated in sulfur globules (Fig. 1b).
Polysulfides were formed as intermediates in the process
(Prange et al., 2004), but are not shown here for better
clarity. In the next step, sulfite was generated in the
cytoplasm by the Dsr proteins. In WT cultures, sulfite does
not accumulate in the medium to more than 30 mM (Dahl,
1996) (Fig. 1c). Finally, the end product sulfate appeared in
the medium (Fig. 1d). Thiosulfate and tetrathionate
concentrations were below detection limits once sulfide
was used up. In accordance with previous results (Dahl,
1996), the phenotype of the APS reductase-negative
mutant was indiscernible from the WT under the
conditions chosen and is therefore not shown in Fig. 1.
2632
Sulfide (mM)
3.0
2.0
1.0
4.0
(b)
Intracellular sulfur (mM)
To further dissect the importance of SoxYZ in relation to
the cytoplasmic sulfite-oxidizing systems we constructed A.
vinosum mutants lacking SoxYZ as well as SoeABC and/or
APS reductase. It now appeared that the specific sulfite
oxidation rates of neither the double nor the triple mutants
were significantly different from that of the DsoxY single
mutant (Table 3). These observations suggest that SoxYZ is
needed for oxidation of externally added sulfite in A.
vinosum even in the presence of both cytoplasmic sulfiteoxidizing systems. The requirement of SoxYZ is not
absolute, though, because we found conditions under
which the SoxYZ-deficient mutant still exhibited a sulfite
oxidation rate well above background (Table S1).
4.0
3.0
2.0
1.0
4.0
(c)
3.0
Sulfite (mM)
Oxidation of externally supplied sulfite by
A. vinosum: connection of cytoplasmic systems
and SoxYZ
(a)
2.0
1.0
(d)
4.0
Sulfate/thiosulfate/
tetrathionate (mM)
phenotype with regard to oxidation of externally supplied
sulfite (Table S1). These findings suggested the periplasmic
sulfur substrate-binding protein SoxYZ as another important player in sulfite metabolism in A. vinosum, whilst
SoxXAK and SoxB do not appear to play a significant role
in this process.
3.0
2.0
1.0
0.0
0
10
20
30
40 50
Time (h)
60
70
80 140 150
Fig. 1. Sulfide oxidation in A. vinosum WT and mutant strains.
Representative experiments of biological triplicates are shown. (a)
Sulfide, (b) intracellular sulfur, (c) sulfite, and (d) sulfate, thiosulfate
and tetrathionate. A. vinosum strains: WT ($), DsoeAEm (h),
DsoxY (D), aprB : : VKm DsoeAEm (&), DsoxY aprB : : VKm
DsoeAEm (#). Thiosulfate and tetrathionate concentrations are
depicted in (d) using dotted and dashed lines, respectively. Initial
protein concentration: WT 0.19 mg ml”1, DsoeAEm 0.17 mg ml”1,
DsoxY 0.11 mg ml”1, aprB : : VKm DsoeAEm 0.13 mg ml”1 and
DsoxY aprB : : VKm DsoeAEm 0.14 mg ml”1. Note the break in
timescale. The period between 84 and 134 h was omitted to
enable a good overview of the ongoing sulfur transformations
during the first 3 days of the experiments and to depict the final
situation for the triple-mutant strain in the same figure.
Like the apr-negative A. vinosum mutant strain, neither the
SoeABC-deficient mutant nor the tested double mutant
was affected with regard to sulfide removal from the
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:13:25
Microbiology 159
Sulfite oxidation in A. vinosum
cultures, whilst the DsoxY aprB : : VKm DsoeAEm triple
mutant exhibited a significantly reduced sulfide oxidation
rate (Table 4). We conclude that neither SoxYZ nor APS
reductase and SoeABC is involved directly in oxidation of
sulfide to intracellular sulfur in A. vinosum. Oxidation rates
for intracellularly stored sulfur were found to be reduced
by ~50 % in the SoeABC-deficient and the SoxYZ-deficient
mutant, whilst the rate was even further reduced in the
strain lacking both cytoplasmic sulfite-oxidizing systems,
and found to be only 20 % of the original rate in the triple
mutant (Table 4).
Quantitative analysis of inorganic sulfur compounds in the
medium revealed that all mutants lacking SoeABC and/or
SoxYZ accumulated massive amounts of sulfite up to a
maximum of 1.2 mM in the aprB : : VKm DsoeAEm strain
that is no longer capable of cytoplasmic sulfite oxidation.
Up to 0.43 mM sulfite accumulated in the DsoeAEm strain,
again underlining the major importance of direct SoeABCcatalysed sulfite oxidation over the indirect APS reductase
pathway. In both tested mutants still containing SoxYZ, i.e.
DsoeAEm and aprB : : VKm DsoeAEm mutants, sulfate was
formed as the only detectable final product (Fig. 1d).
Thiosulfate was not detected at any time in these cultures.
In contrast, the DsoxY mutant produced not just sulfate,
but also thiosulfate (Fig. 1d). Part of this thiosulfate was
further oxidized to tetrathionate, which can be explained
by the action of the periplasmic thiosulfate dehydrogenase
(Denkmann et al., 2012). The amount of thiosulfate
consumed (0.473 mM in the experiment shown in Fig.
1d) and that of tetrathionate formed (0.210 mM) adhered
exactly to the predicted 2 : 1 stoichiometry. Once formed,
thiosulfate could obviously no longer be transformed into
sulfate in the DsoxY strain. This result is in complete
agreement with earlier findings that tetrathionate is the
only product of thiosulfate-exposed A. vinosum DsoxY cells
(Hensen et al., 2006). The inability of the DsoxY strain to
form sulfate from thiosulfate is clearly due to the
incompleteness of the Sox system. Nevertheless, the mutant
formed sulfate as the major end product of the oxidation of
sulfide. This is explained by the presence and action of the
APS reductase/SoeABC systems in the cytoplasm. In
contrast, the triple mutant lacking SoxYZ as well as the
cytoplasmic sulfite-oxidizing enzymes appeared to be
completely incapable of sulfate formation. The small
amount of sulfate found in the medium after prolonged
incubation (144 h) is completely accounted for by
chemical formation from sulfite. The main product in
the sulfide-exposed triple-mutant strain was thiosulfate,
which to some extent was again transformed to tetrathionate by the action of the periplasmic thiosulfate
dehydrogenase.
DISCUSSION
In this work, we identified the membrane-bound iron–
sulfur molybdoprotein SoeABC as a major enzyme
catalysing direct oxidation of sulfite to sulfate in the
cytoplasm of A. vinosum. The function of SoeABC was
proven by strongly reduced specific oxidation rates for
externally supplied sulfite and by massive excretion of
sulfite into the medium during oxidation of sulfide in A.
vinosum SoeABC-deficient strains. Our conclusion is
corroborated by the lack of AMP-independent sulfiteoxidizing activity in the crude extract of SoeABC-deficient
A. vinosum. SoeABC appears to be of general importance in
purple sulfur bacteria because it is encoded in all genomes
of organisms belonging to this group (Table 2).
Database searches revealed the presence of three linked genes
related closely to soeABC and encoding the three subunits of
a cytoplasmically oriented membrane-bound iron–sulfur
molybdoprotein not only in phototrophic sulfur oxidizers,
but also in a large number of chemotrophic bacteria.
Examples are compiled in Table S2. Whilst the so-far
sequenced epsilon- and deltaproteobacteria do not appear to
contain soeABC, these genes occur in several chemotrophic
sulfur oxidizers belonging to the gammaproteobacteria
including the bacterial endosymbionts of Riftia pachyptila
and Tevnia jerichonana, Thioalkalivibrio species and
Acidithiobacillus species. Furthermore, a number of known
sulfur oxidizers belonging to the betaproteobacteria contain
the genes, including Sulfuricella denitrificans, Thiomonas
species as well as Thiobacillus denitrificans. Among the
alphaproteobacteria containing soeABC, Magnetospirillum
species and Magnetococcus species are established sulfur
Table 4. Rates for oxidation of externally added sulfide and intracellular sulfur in A. vinosum WT, single- and double-mutant strains
defective in soe, apr and/or sox genes
Strain
WT
DsoeAEm
DsoxY
aprB : : VKm DsoeAEm
DsoxY aprB : : VKm DsoeAEm
Sulfide oxidation rate
[nmol min”1 (mg protein)”1]
Sulfur oxidation rate
[nmol min”1 (mg protein)”1]
69.3±4.5
69.0±6.3
94.8±5.8
73.3±20.9
10.5±5.4
26.5±4.0
15.3±1.3
13.4±1.2
10.2±2.3
4.4±0.8
Initial sulfide concentration: 4 mM. Protein concentration at the onset of fermentations: 110–193 mg ml21.
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:13:25
2633
C. Dahl and others
oxidizers. The presence and genomic linkage of soeABC with
dsr and sox genes in bacteria belonging to the Roseobacter
clade has recently been noted by Mussmann and coworkers
(Lenk et al., 2012). The genes are also present in several
genome-sequenced Roseovarius species and Roseobacter
species. Among the soeABC-containing alpha- and betaproteobacteria, we find a number of species for which sulfuroxidizing capabilities have not been described and/or tested
(e.g. Herminiimonas arsenicoxydans and several Burkholderia
species) or in which sulfur-oxidizing capabilities are
restricted to oxidizing sulfite released as an intermediate
during organosulfur compound degradation, as in the
Roseobacter clade bacterium R. pomeroyi (Lehmann et al.,
2012). We can thus state that the A. vinosum and the
currently not well described R. pomeroyi soeABC genes
encode the prototypes of a new protein family within the
complex iron–sulfur molybdoenzymes that is widespread
among several branches of proteobacteria. We propose that
the so-far largely unrecognized SoeABC sulfite dehydrogenase is of major importance for the oxidation of sulfite in the
cytoplasm generated either by the Dsr system or by
cytoplasmic desulfonating enzymes like sulfoacetaldehyde
acetyltransferase (Xsc) in a wide range of physiologically and
phylogenetically diverse bacteria.
Furthermore, the compilation of the occurrence of cytoplasmic sulfite-generating and sulfite-oxidizing systems in
selected proteobacteria in Table S2 shows that there is no
tight correlation between specific modes of sulfite generation (here, Dsr or Xsc) and the sulfite-oxidizing module
present (here, SoeABC or AprBA combined with either
AprM or QmoABHdrCB). In most cases, the presence of Xsc
is coupled with the presence of SoeABC; however,
‘Candidatus Pelagibacter ubique’ is a well-recognized
exception (Meyer & Kuever 2007, Table S2). The Dsr system
may occur in parallel with SoeABC alone, with AprBA alone
(e.g. in ‘Candidatus Ruthia magnifica’, see Table S2) or with
a combination of both systems. The possession of the APS
reductase pathway in addition to or instead of SoeABC may
be advantageous because additional energy is gained by
substrate phosphorylation in the ATP sulfurylase-catalysed
step by transferring the AMP moiety of APS onto pyrophosphate (Parey et al., 2013). Furthermore, it may be especially
advantageous to be equipped with the Qmo-related
electron-accepting unit for APS reductase. Irrespective of
whether SoeABC or AprMBA is used, the electrons
stemming from sulfite are proposed to enter the electron
transport chain at the energetic level of quinones (via SoeC
or AprM). However, the presence of the HdrA-like QmoA in
the Qmo complex opens the possibility that – in a reverse
manner to the mechanism suggested for sulfate reducers
(Ramos et al., 2012; Grein et al., 2013) – an electron
bifurcation occurs that could result in simultaneous
reduction of low-potential electron acceptors like ferredoxin
or NAD+. Such a process would be of significant energetic
advantage especially for chemolithoautotrophic growth
because it would result in a lower energy demand for
reverse electron flow.
2634
In the current work, we furthermore collected evidence for
an involvement of the periplasmic sulfur substrate-binding
protein SoxYZ in the sulfite metabolism in A. vinosum,
whilst other Sox proteins (SoxXAK and SoxB) do not
appear to play a significant role in this process. We suggest
that SoxYZ may serve the same function – and thus be of
considerably higher importance than previously assumed –
in other purple sulfur bacteria as well. This is suggested by
our observation that genes encoding the protein are almost
universally present in this group of organisms irrespective
of whether the organism contains further sox genes and is
able to metabolize thiosulfate (Table 1). The exact nature
of SoxYZ participation in sulfite metabolism cannot yet be
deduced from in vitro experiments, but nevertheless can be
pinpointed by our experiments with A. vinosum mutant
strains. One important conclusion from these studies is
that SoxYZ cannot be a component of a sulfite-oxidizing
pathway running independently of the cytoplasmic pathways. Mutants lacking SoxYZ and mutants lacking both
cytoplasmic sulfite oxidation pathways are each very
strongly affected with regard to degradation of external
sulfite as well as with regard to turnover of sulfite formed
as an intermediate by the cells. The effects are not additive,
rather both SoxYZ and the cytoplasmic pathways need to
co-exist. Obviously, both the periplasmic SoxYZ and the
cytoplasmic sulfite-oxidizing enzymes are needed in
parallel for effective sulfite oxidation in A. vinosum,
suggesting some kind of interplay between these systems
despite localization in two different cellular compartments.
The simplest model into which these results and considerations can be integrated is the suggestion that SoxYZ
may act as a sulfite-binding protein in the periplasm of A.
vinosum and that in this function the protein acts
independently of the other Sox proteins, i.e. SoxXAK and
SoxB. Originally, we rationalized that binding of sulfite to
SoxYZ may only be possible in an oxidative step yielding
SoxY-cysteine-sulfonate catalysed by a protein containing a
redox-active site. However, in vivo such a process is
obviously not exerted by the most likely candidate SoxXA
since the sulfite oxidation capability of the SoxXA-deficient
strain is undisturbed. An alternative mode for attachment
of sulfite to SoxYZ not involving a redox reaction is the
reaction of the thiolate of the conserved SoxY-cysteine
(Sox-Cys2) with aqueous sulfite yielding SoxY-cysteine-Ssulfinate (SoxY-Cys-SO22). Such a reaction is indeed
feasible at the moderate pH values prevalent in the
bacterial periplasm (Steudel & Steudel, 2010). However,
it should be kept in mind that the reaction has so far only
been shown for free cysteine and not for an active-site
residue of a complex protein. We also considered an
alternative mechanism for the generation of SoxY-cysteineS-sulfinate. In aqueous solution sulfite can form disulfite
by a chemical reaction (2 HSO32(aq) > S2O522(aq) +
H2O, equation 1). This disulfite could serve as substrate
for SoxZY according to equation 2: SoxZY-Cys2 +
[O2S-SO3]2–+H+ « SoxZY-Cys-SO22+HSO32. Based on
this mechanism, SoxYZ could act as a binding protein not
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:13:25
Microbiology 159
Sulfite oxidation in A. vinosum
only shielding components of the periplasm from chemical
reactions with sulfite, but possibly also delivering sulfite for
transport into the cytoplasm. We suggest that the SoxYcysteine-S-sulfinate may act as a substrate donor for an asyet unknown transport system importing sulfite into the
cytoplasm. Either sulfite could be released by the
transporter by simple addition of water to the SoxYcysteine-S-sulfinate or disulfite may be released in reverse
of equation 2 shown above. In Fig. 2, the role of SoxYZ as a
donor for a sulfite-importing system is depicted for the
simplest case, i.e. the degradation of externally available
sulfite. The A. vinosum genome contains an array of genes
encoding putative (ABC) transporters that could in
principle serve such a function and work together with a
sulfite-binding protein. Once in the cytoplasm, sulfite is
immediately oxidized to sulfate via the direct SoeABC and/
or the indirect APS reductase pathway. At present, we
cannot discount the possibility that sulfite is also taken up
into the cytoplasm in the absence of SoxYZ – albeit with a
significantly slower rate – as the DsoxY mutant shows
residual sulfite-oxidizing capability under light-limited
conditions (Table S1).
We also present a model for the interplay of SoxYZ and
cytoplasmic sulfite oxidation when sulfide, the most readily
available substrate in its natural habitat, is metabolized by
A. vinosum. Here, the picture is much more complicated. It
was already outlined above that zero-valent sulfur stored in
sulfur globules is an intermediate during the oxidation of
this most highly reduced sulfur compound to sulfate.
Sulfite is also a well-established intermediate further
downstream in the process. Although this intermediate is
formed in the cytoplasm, it appears to be excreted, i.e.
transported across the cytoplasmic membrane, to some
extent even by WT cells. This is evidenced by the detection
SoxZY-Cys–+ HSO–3
SoxZY-Cys-SO2–+ H2O
Periplasm
AprM
Apr
Cytoplasm
AprA
MKH2
MK
AMP
APS
PPi
ATP
SoeC
SO2–
4
MKH2
MK
H+
B
H2O
MoCo
HSO–3
SoeA
SO2–
4
2 H+
Fig. 2. Model for oxidation of external sulfite in A. vinosum WT. The
thiolate of conserved SoxY-Cys152 is predicted to react with
hydrogen sulfite, resulting in the corresponding sulfinate derivative.
Such a mechanism is feasible at moderate pH values as shown by
Steudel & Steudel (2010). The SoxY-sulfinate could then serve as
a substrate donor for an as-yet unknown sulfite transport system.
Hydrogen sulfite (HSO3”) has a pKa of 6.97 and therefore exists
predominantly in the protonated form at the slightly acidic pH of
the bacterial periplasm.
http://mic.sgmjournals.org
of sulfite in WT culture supernatants albeit at only very low
concentrations (Dahl, 1996). Once formed, sulfite is
obviously removed with high efficiency. Two principally
different mechanisms appear to play a role here. The first is
the oxidation to sulfate in the cytoplasm either by SoeABC
alone or by a combination of the SoeABC/APS reductase
pathways depending on the organism (Table 1). The
second mechanism working in parallel to avoid any
accumulation of sulfite in the cytoplasm would be transfer
across the cytoplasmic membrane into the periplasm.
Transporters mediating such a sulfite efflux have not yet
been described for purple sulfur bacteria. Putative
permeases resembling sulfite exporters of the TauE/SafE
family (Pfam accession no. PF01925) (Weinitschke et al.,
2007; Krejčı́k et al., 2008) are encoded in some purple
sulfur bacteria including A. vinosum (Alvin_1107), but not
in all genome-sequenced members of this group. Other
described sulfite efflux pumps stem from fungal sources, e.g.
SSU1 from Saccharomyces cerevisiae (Park & Bakalinsky,
2000; Nardi et al., 2010) or Aspergillus fumigatus (Léchenne
et al., 2007). However, genes encoding closely related
proteins are not present in the currently sequenced purple
sulfur bacteria with the exception of Thiorhodococcus
drewsii. Once sulfite anions reach the periplasm, they are
possibly bound by SoxYZ just as outlined above.
We considered the possibility that either the SoxY-Cyssulfinate could act as a substrate for oxidation to SoxYCys-sulfonate or sulfite could be oxidatively bound to the
conserved cysteine of SoxY in a reaction catalysed by a
periplasmic enzyme other than SoxXA. The membranebound trihaem cytochrome c DsrJ would be a candidate for
catalysing such a reaction as it contains a putative active
site similar to that of SoxXA. It has been proposed that
DsrJ catalyses oxidation of a sulfur substrate and uses the
released electrons for transmembrane electron transfer to a
disulfide of DsrC via the other components of the
DsrMKJOP complex (Grein et al., 2010a, b). However, in
such a process, production of each sulfite molecule in the
cytoplasm would require oxidation of exactly one molecule
of sulfite in the periplasm. Sulfite oxidation in the
cytoplasm would be obsolete and thus such a mechanism
is discounted. It is more likely that SoxYZ acts as a ‘sulfite
buffer’ again shielding periplasmic components from
reaction with free sulfite (see above) and also keeping
sulfite on hold for reimport into the cytoplasm. We
attribute the accumulation of external sulfite in the DsoxY
single mutant to the latter of the proposed functions.
When the major cytoplasmic sulfite-oxidizing system is
absent (SoeABC) or sulfite oxidation in the cytoplasm is no
longer possible at all, as in the A. vinosum SoeABC/APS
reductase double mutant, the whole system runs out of
balance even in the presence of SoxYZ and free sulfite starts
to accumulate outside of the cells in the medium. When
cells still contain periplasmically stored zero-valent sulfur
in such a situation, this sulfur is in principle accessible to
abiotic attack by the strong nucleophile sulfite. Such a
reaction would yield thiosulfate (Roy & Trudinger, 1970;
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:13:25
2635
C. Dahl and others
Suzuki, 1999). In cells with a complete Sox system, such as
the DsoeAEm and the DsoeAEm aprB : : VKm mutants,
thiosulfate should still to be completely degraded to sulfate.
The oxidized sulfone group of thiosulfate would be released
immediately by SoxB, whilst the sulfane sulfur would be
hooked up again to stored sulfur, which would in turn be
transformed to cytoplasmic sulfite by the Dsr proteins.
Sulfite would then be transported out of the cytoplasm,
leading to thiosulfate formation and the same series of
reactions would restart. Finally, sulfate would be the only
detectable end product. In fact, this is exactly what we
observed in our experiments: degradation of stored sulfur
took significantly longer in the DsoeAEm and the DsoeAEm
aprB : : VKm mutants than in the WT, and the final product
in all cases was sulfate. In these cultures, thiosulfate never
accumulated, whilst this was clearly the case for cells that
lacked SoxYZ and could thus not run a complete Sox cycle.
The only transformation that thiosulfate underwent in
SoxYZ-deficient cultures was oxidation to tetrathionate
catalysed by a completely independent enzyme, thiosulfate
dehydrogenase (Denkmann et al., 2012). In the A. vinosum
triple mutant, neither sulfite nor thiosulfate could be
further metabolized, leading to a very significant reduction
not only of the rate of degradation, but also of formation of
sulfur globules and furthermore to a complete inability of
the cells to produce sulfate.
Our proposal for a more general role of SoxYZ not only as
a thiosulfate- but also as a sulfite-binding protein goes well
along with our finding that the respective genes occur even
in purple sulfur bacteria that do not contain other sox
genes and have accordingly been reported not to be capable
of thiosulfate utilization (Table 1). The only exception to
this pattern is T. mobilis. However, T. mobilis is the only
genome-sequenced purple sulfur bacterium so far that
contains a gene encoding a periplasmic sulfite dehydrogenase of the SorA type. It is thus tempting to speculate
that the periplasmic sulfite-binding SoxYZ is not necessary
in the presence of a periplasmic sulfate-forming enzyme.
Obviously, purple sulfur bacteria are equipped with
different modules, and thereby means, to cope with
externally available and internally generated sulfite.
This work was supported by the Deutsche Forschungsgemeinschaft
(grant nos DA351/4-3 and DA351/4-4).
REFERENCES
Bartlett, J. K. & Skoog, D. A. (1954). Colorimetric determination of
elemental sulfur in hydrocarbons. Anal Chem 26, 1008–1011.
Bazaral, M. & Helinski, D. R. (1968). Circular DNA forms of
colicinogenic factors E1, E2 and E3 from Escherichia coli. J Mol Biol
36, 185–194.
Bryantseva, I. A., Gorlenko, V. M., Kompantseva, E. I., Imhoff, J. F.,
Süling, J. & Mityushina, L. (1999). Thiorhodospira sibirica gen. nov.,
sp. nov., a new alkaliphilic purple sulfur bacterium from a Siberian
soda lake. Int J Syst Bacteriol 49, 697–703.
Caumette, P., Guyoneaud, R., Imhoff, J. F., Süling, J. & Gorlenko, V.
(2004). Thiocapsa marina sp. nov., a novel, okenone-containing,
purple sulfur bacterium isolated from brackish coastal and marine
environments. Int J Syst Evol Microbiol 54, 1031–1036.
D’Errico, G., Di Salle, A., La Cara, F., Rossi, M. & Cannio, R. (2006).
Identification and characterization of a novel bacterial sulfite oxidase
with no heme binding domain from Deinococcus radiodurans.
J Bacteriol 188, 694–701.
Dahl, C. (1996). Insertional gene inactivation in a phototrophic
sulphur bacterium: APS-reductase-deficient mutants of Chromatium
vinosum. Microbiology 142, 3363–3372.
Dahl, C. (2008). Inorganic sulfur compounds as electron donors in
purple sulfur bacteria. In Sulfur in Phototrophic Organisms, pp. 289–317.
Edited by R. Hell, C. Dahl, D. B. Knaff & T. Leustek. Dordrecht: Springer.
Dahl, C., Engels, S., Pott-Sperling, A. S., Schulte, A., Sander, J.,
Lübbe, Y., Deuster, O. & Brune, D. C. (2005). Novel genes of the dsr
gene cluster and evidence for close interaction of Dsr proteins during
sulfur oxidation in the phototrophic sulfur bacterium Allochromatium
vinosum. J Bacteriol 187, 1392–1404.
Denkmann, K., Grein, F., Zigann, R., Siemen, A., Bergmann, J., van
Helmont, S., Nicolai, A., Pereira, I. A. C. & Dahl, C. (2012). Thiosulfate
dehydrogenase: a widespread unusual acidophilic c-type cytochrome.
Environ Microbiol 14, 2673–2688.
Friedrich, C. G., Rother, D., Bardischewsky, F., Quentmeier, A. &
Fischer, J. (2001). Oxidation of reduced inorganic sulfur compounds
by bacteria: emergence of a common mechanism? Appl Environ
Microbiol 67, 2873–2882.
Frigaard, N.-U. & Bryant, D. A. (2008). Genomic insights into the
sulfur metabolism of phototrophic green sulfur bacteria. In Sulfur
Metabolism in Phototrophic Organisms, pp. 337–355. Edited by R. Hell,
C. Dahl, D. B. Knaff & T. Leustek. Dordrecht: Springer.
Conclusions
The results presented in this study clearly show that the
membrane-bound, cytoplasmically oriented iron–sulfur
molybdoprotein SoeABC plays a major role in the oxidation
of sulfite in the cytoplasm of A. vinosum, and very probably
also in other phototrophic and chemotrophic bacteria. The
periplasmic SoxYZ protein and the cytoplasmic sulfiteoxidizing enzymes are needed in parallel for effective sulfite
oxidation in A. vinosum, suggesting some kind of interplay
between these systems despite their localization in two
different cellular compartments. While the exact function of
SoxYZ in sulfite oxidation remains elusive at this point, it is
tempting to speculate that it acts as a periplasmic sulfitebinding protein.
2636
ACKNOWLEDGEMENTS
Frigaard, N.-U. & Dahl, C. (2008). Sulfur metabolism in phototrophic
sulfur bacteria. Adv Microb Physiol 54, 103–200.
Gregersen, L. H., Bryant, D. A. & Frigaard, N.-U. (2011). Mechanisms
and evolution of oxidative sulfur metabolism in green sulfur bacteria.
Front Microbiol 2, 116.
Grein, F., Pereira, I. A. C. & Dahl, C. (2010a). Biochemical
characterization of individual components of the Allochromatium
vinosum DsrMKJOP transmembrane complex aids understanding of
complex function in vivo. J Bacteriol 192, 6369–6377.
Grein, F., Venceslau, S. S., Schneider, L., Hildebrandt, P., Todorovic,
S., Pereira, I. A. C. & Dahl, C. (2010b). DsrJ, an essential part of the
DsrMKJOP transmembrane complex in the purple sulfur bacterium
Allochromatium vinosum, is an unusual triheme cytochrome c.
Biochemistry 49, 8290–8299.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:13:25
Microbiology 159
Sulfite oxidation in A. vinosum
Grein, F., Ramos, A. R., Venceslau, S. S. & Pereira, I. A. C. (2013).
Unifying concepts in anaerobic respiration: insights from dissimilatory sulfur metabolism. Biochim Biophys Acta 1827, 145–160.
Heinzinger, N. K., Fujimoto, S. Y., Clark, M. A., Moreno, M. S. &
Barrett, E. L. (1995). Sequence analysis of the phs operon in
Salmonella typhimurium and the contribution of thiosulfate reduction
to anaerobic energy metabolism. J Bacteriol 177, 2813–2820.
Hensel, M., Hinsley, A. P., Nikolaus, T., Sawers, G. & Berks, B. C.
(1999). The genetic basis of tetrathionate respiration in Salmonella
typhimurium. Mol Microbiol 32, 275–287.
Krejčı́k, Z., Denger, K., Weinitschke, S., Hollemeyer, K., Paces, V.,
Cook, A. M. & Smits, T. H. M. (2008). Sulfoacetate released during the
assimilation of taurine-nitrogen by Neptuniibacter caesariensis:
purification of sulfoacetaldehyde dehydrogenase. Arch Microbiol
190, 159–168.
Laska, S., Lottspeich, F. & Kletzin, A. (2003). Membrane-bound
hydrogenase and sulfur reductase of the hyperthermophilic and
acidophilic archaeon Acidianus ambivalens. Microbiology 149, 2357–2371.
Léchenne, B., Reichard, U., Zaugg, C., Fratti, M., Kunert, J., Boulat, O.
& Monod, M. (2007). Sulphite efflux pumps in Aspergillus fumigatus
Hensen, D., Sperling, D., Trüper, H. G., Brune, D. C. & Dahl, C.
(2006). Thiosulphate oxidation in the phototrophic sulphur bac-
and dermatophytes. Microbiology 153, 905–913.
terium Allochromatium vinosum. Mol Microbiol 62, 794–810.
plasmids in the chromosome of Lactococcus lactis. Appl Environ
Microbiol 56, 2726–2735.
Hipp, W. M., Pott, A. S., Thum-Schmitz, N., Faath, I., Dahl, C. &
Trüper, H. G. (1997). Towards the phylogeny of APS reductases and
sirohaem sulfite reductases in sulfate-reducing and sulfur-oxidizing
prokaryotes. Microbiology 143, 2891–2902.
Horton, R. M. (1995). PCR-mediated recombination and mutagenesis.
Mol Biotechnol 3, 93–99.
Imhoff, J. F. (2005a). Family I. Chromatiaceae Bavendamm 1924,
Leenhouts, K. J., Kok, J. & Venema, G. (1990). Stability of integrated
Lehmann, S., Johnston, A. W. B., Curson, A. R. J., Todd, J. D. & Cook,
A. M. (2012). SoeABC, a novel sulfite dehydrogenase in the
Roseobacters? In Programme & Abstract Book EMBO Workshop on
Microbial Sulfur Metabolism, Noordwijkerhout, p. 29.
Lenk, S., Moraru, C., Hahnke, S., Arnds, J., Richter, M., Kube, M.,
Reinhardt, R., Brinkhoff, T., Harder, J. & other authors (2012).
125AL emend. Imhoff 1984b, 339. In Bergey’s Manual of Systematic
Bacteriology, pp. 3–40. Edited by D. J. Brenner, N. R. Krieg, J. T. Staley
& G. M. Garrity. New York: Springer.
Roseobacter clade bacteria are abundant in coastal sediments and
encode a novel combination of sulfur oxidation genes. ISME J 6,
2178–2187.
Imhoff, J. F. (2005b). Family II. Ectothiorhodospiraceae Imhoff
Lübbe, Y. J., Youn, H.-S., Timkovich, R. & Dahl, C. (2006).
1984b, 339VP. In Bergey’s Manual of Systematic Bacteriology, pp. 41–
57. Edited by D. J. Brenner, N. R. Krieg, J. T. Staley & G. M. Garrity.
New York: Springer.
Siro(haem)amide in Allochromatium vinosum and relevance of DsrL
and DsrN, a homolog of cobyrinic acid a,c-diamide synthase, for
sulphur oxidation. FEMS Microbiol Lett 261, 194–202.
Imhoff, J. F., Süling, J. & Petri, R. (1998). Phylogenetic relationships
Meyer, B. & Kuever, J. (2007). Molecular analysis of the distribution
among the Chromatiaceae, their taxonomic reclassification and
description of the new genera Allochromatium, Halochromatium,
Isochromatium, Marichromatium, Thiococcus, Thiohalocapsa, and
Thermochromatium. Int J Syst Bacteriol 48, 1129–1143.
Meyer, B., Imhoff, J. F. & Kuever, J. (2007). Molecular analysis of the
Jormakka, M., Yokoyama, K., Yano, T., Tamakoshi, M., Akimoto, S.,
Shimamura, T., Curmi, P. & Iwata, S. (2008). Molecular mechanism
of energy conservation in polysulfide respiration. Nat Struct Mol Biol
15, 730–737.
Kappler, U. & Bailey, S. (2005). Molecular basis of intramolecular
and phylogeny of dissimilatory adenosine-59-phosphosulfate reductase-encoding genes (aprBA) among sulfur-oxidizing prokaryotes.
Microbiology 153, 3478–3498.
distribution and phylogeny of the soxB gene among sulfur-oxidizing
bacteria – evolution of the Sox sulfur oxidation enzyme system.
Environ Microbiol 9, 2957–2977.
Nardi, T., Corich, V., Giacomini, A. & Blondin, B. (2010). A sulphite-
inducible form of the sulphite efflux gene SSU1 in a Saccharomyces
cerevisiae wine yeast. Microbiology 156, 1686–1696.
electron transfer in sulfite-oxidizing enzymes is revealed by high
resolution structure of a heterodimeric complex of the catalytic
molybdopterin subunit and a c-type cytochrome subunit. J Biol Chem
280, 24999–25007.
ATP sulfurylase from Allochromatium vinosum. PLoS ONE 8, e74707.
Kappler, U. & Maher, M. J. (2013). The bacterial SoxAX cytochromes.
Park, H. & Bakalinsky, A. T. (2000). SSU1 mediates sulphite efflux in
Parey, K., Demmer, U., Warkentin, E., Wynen, A., Ermler, U. & Dahl,
C. (2013). Structural, biochemical and genetic characterization of
Cell Mol Life Sci 70, 977–992.
Saccharomyces cerevisiae. Yeast 16, 881–888.
Kappler, U., Bennett, B., Rethmeier, J., Schwarz, G., Deutzmann, R.,
McEwan, A. G. & Dahl, C. (2000). Sulfite : cytochrome c oxido-
Pattaragulwanit, K. & Dahl, C. (1995). Development of a genetic
reductase from Thiobacillus novellus. Purification, characterization,
and molecular biology of a heterodimeric member of the sulfite
oxidase family. J Biol Chem 275, 13202–13212.
Kelly, D. P., Chambers, L. A. & Trudinger, P. A. (1969). Cyanolysis and
spectrophotometric estimation of trithionate in mixture with
thiosulfate and tetrathionate. Anal Chem 41, 898–901.
Kisker, C., Schindelin, H., Baas, D., Rétey, J., Meckenstock, R. U. &
Kroneck, P. M. (1998). A structural comparison of molybdenum
cofactor-containing enzymes. FEMS Microbiol Rev 22, 503–521.
Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson, G. T., Farris, M. A.,
Roop, R. M., II & Peterson, K. M. (1995). Four new derivatives of the
broad-host-range cloning vector pBBR1MCS, carrying different
antibiotic-resistance cassettes. Gene 166, 175–176.
Krafft, T., Bokranz, M., Klimmek, O., Schröder, I., Fahrenholz, F.,
Kojro, E. & Kröger, A. (1992). Cloning and nucleotide sequence of the
psrA gene of Wolinella succinogenes polysulphide reductase. Eur J
Biochem 206, 503–510.
http://mic.sgmjournals.org
system for a purple sulfur bacterium: conjugative plasmid transfer in
Chromatium vinosum. Arch Microbiol 164, 217–222.
Pattaragulwanit, K., Brune, D. C., Trüper, H. G. & Dahl, C. (1998).
Molecular genetic evidence for extracytoplasmic localization of sulfur
globules in Chromatium vinosum. Arch Microbiol 169, 434–444.
Pfennig, N. & Trüper, H. G. (1992). The family Chromatiaceae. In The
Prokaryotes. A Handbook on the Biology of Bacteria: Ecophysiology,
Isolation, Identification, Applications, pp. 3200–3221. Edited by
A. Balows, H. G. Trüper, M. Dworkin, W. Harder & K.-H. Schleifer.
New York: Springer.
Pott, A. S. & Dahl, C. (1998). Sirohaem sulfite reductase and other
proteins encoded by genes at the dsr locus of Chromatium vinosum are
involved in the oxidation of intracellular sulfur. Microbiology 144,
1881–1894.
Prange, A., Engelhardt, H., Trüper, H. G. & Dahl, C. (2004). The role
of the sulfur globule proteins of Allochromatium vinosum: mutagenesis of the sulfur globule protein genes and expression studies by realtime RT-PCR. Arch Microbiol 182, 165–174.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:13:25
2637
C. Dahl and others
Ramos, A. R., Keller, K. L., Wall, J. D. & Pereira, I. A. C. (2012). The
Simon, J. & Kern, M. (2008). Quinone-reactive proteins devoid of
membrane QmoABC complex interacts directly with the dissimilatory
adenosine 59-phosphosulfate reductase in sulfate reducing bacteria.
Front Microbiol 3, 137.
haem b form widespread membrane-bound electron transport
modules in bacterial respiration. Biochem Soc Trans 36, 1011–1016.
Simon, J. & Kroneck, P. M. (2013). Microbial sulfite respiration. Adv
Reinartz, M., Tschäpe, J., Brüser, T., Trüper, H. G. & Dahl, C. (1998).
Microb Physiol 62, 45–117.
Sulfide oxidation in the phototrophic sulfur bacterium Chromatium
vinosum. Arch Microbiol 170, 59–68.
Simon, R., Priefer, U. & Pühler, A. (1983). A broad host range
Rethmeier, J., Rabenstein, A., Langer, M. & Fischer, U. (1997).
Detection of traces of oxidized and reduced sulfur compounds in
small samples by combination of different high- performance liquid
chromatography methods. J Chromatogr A 760, 295–302.
Rodriguez, J., Hiras, J. & Hanson, T. E. (2011). Sulfite oxidation in
Chlorobaculum tepidum. Front Microbiol 2, 112.
mobilization system for in vivo genetic engineering: transposon
mutagenesis in gram negative bacteria. Biotechnology (N Y) 1, 784–
791.
Steudel, R. & Steudel, Y. (2010). Derivatives of cysteine related to the
thiosulfate metabolism of sulfur bacteria by the multi-enzyme
complex ‘‘Sox’’ studied by B3LYP-PCM and G3X(MP2) calculations.
Phys Chem Chem Phys 12, 630–644.
Rother, D., Henrich, H. J., Quentmeier, A., Bardischewsky, F. &
Friedrich, C. G. (2001). Novel genes of the sox gene cluster,
Suzuki, I. (1999). Oxidation of inorganic sulfur compounds: chemical
mutagenesis of the flavoprotein SoxF, and evidence for a general
sulfur-oxidizing system in Paracoccus pantotrophus GB17. J Bacteriol
183, 4499–4508.
Weaver, P. F., Wall, J. D. & Gest, H. (1975). Characterization of
Roy, A. B. & Trudinger, P. A. (1970). The Biochemistry of Inorganic
DUF81 protein TauE in Cupriavidus necator H16, a sulfite exporter in
the metabolism of C2 sulfonates. Microbiology 153, 3055–3060.
Compounds of Sulfur. London: Cambridge University Press.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning:
a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring
Harbor Laboratory Press.
Sánchez, O., Ferrera, I., Dahl, C. & Mas, J. (2001). In vivo role of
adenosine-59-phosphosulfate reductase in the purple sulfur bacterium
Allochromatium vinosum. Arch Microbiol 176, 301–305.
Sander, J., Engels-Schwarzlose, S. & Dahl, C. (2006). Importance of
the DsrMKJOP complex for sulfur oxidation in Allochromatium
vinosum and phylogenetic analysis of related complexes in other
prokaryotes. Arch Microbiol 186, 357–366.
Sauvé, V., Bruno, S., Berks, B. C. & Hemmings, A. M. (2007). The
SoxYZ complex carries sulfur cycle intermediates on a peptide
swinging arm. J Biol Chem 282, 23194–23204.
Schäfer, A., Tauch, A., Jäger, W., Kalinowski, J., Thierbach, G. &
Pühler, A. (1994). Small mobilizable multi-purpose cloning vectors
derived from the Escherichia coli plasmids pK18 and pK19: selection
of defined deletions in the chromosome of Corynebacterium
glutamicum. Gene 145, 69–73.
2638
and enzymatic reactions. Can J Microbiol 45, 97–105.
Rhodopseudomonas capsulata. Arch Microbiol 105, 207–216.
Weinitschke, S., Denger, K., Cook, A. M. & Smits, T. H. M. (2007). The
Weissgerber, T., Zigann, R., Bruce, D., Chang, Y.-J., Detter, J. C., Han,
C., Hauser, L., Jeffries, C. D., Land, M. & other authors (2011).
Complete genome sequence of Allochromatium vinosum DSM 180(T).
Stand Genomic Sci 5, 311–330.
Weissgerber, T., Dobler, N., Polen, T., Latus, J., Stockdreher, Y. &
Dahl, C. (2013). Genome-wide transcriptional profiling of the purple
sulfur bacterium Allochromatium vinosum DSM 180T during growth
on different reduced sulfur compounds. J Bacteriol 195, 4231–4245.
Welte, C., Hafner, S., Krätzer, C., Quentmeier, A. T., Friedrich, C. G. &
Dahl, C. (2009). Interaction between Sox proteins of two physio-
logically distinct bacteria and a new protein involved in thiosulfate
oxidation. FEBS Lett 583, 1281–1286.
Wilson, J. J. & Kappler, U. (2009). Sulfite oxidation in Sinorhizobium
meliloti. Biochim Biophys Acta 1787, 1516–1525.
Zaar, A., Fuchs, G., Golecki, J. R. & Overmann, J. (2003). A new
purple sulfur bacterium isolated from a littoral microbial mat,
Thiorhodococcus drewsii sp. nov. Arch Microbiol 179, 174–183.
Edited by: D. Kelly
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 19 Jun 2017 01:13:25
Microbiology 159