Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Microbiology (2013), 159, 2626–2638 Editor’s Choice DOI 10.1099/mic.0.071019-0 Sulfite oxidation in the purple sulfur bacterium Allochromatium vinosum: identification of SoeABC as a major player and relevance of SoxYZ in the process Christiane Dahl, Bettina Franz,3 Daniela Hensen,4 Anne Kesselheim and Renate Zigann Correspondence Christiane Dahl Institut für Mikrobiologie & Biotechnologie, Rheinische Friedrich-Wilhelms-Universität Bonn, Meckenheimer Allee 168, 53115 Bonn, Germany [email protected] Received 1 July 2013 Accepted 11 September 2013 In phototrophic sulfur bacteria, sulfite is a well-established intermediate during reduced sulfur compound oxidation. Sulfite is generated in the cytoplasm by the reverse-acting dissimilatory sulfite reductase DsrAB. Many purple sulfur bacteria can even use externally available sulfite as a photosynthetic electron donor. Nevertheless, the exact mode of sulfite oxidation in these organisms is a long-standing enigma. Indirect oxidation in the cytoplasm via adenosine-59phosphosulfate (APS) catalysed by APS reductase and ATP sulfurylase is neither generally present nor essential. The inhibition of sulfite oxidation by tungstate in the model organism Allochromatium vinosum indicated the involvement of a molybdoenzyme, but homologues of the periplasmic molybdopterin-containing SorAB or SorT sulfite dehydrogenases are not encoded in genome-sequenced purple or green sulfur bacteria. However, genes for a membrane-bound polysulfide reductase-like iron–sulfur molybdoprotein (SoeABC) are universally present. The catalytic subunit of the protein is predicted to be oriented towards the cytoplasm. We compared the sulfide- and sulfite-oxidizing capabilities of A. vinosum WT with single mutants deficient in SoeABC or APS reductase and the respective double mutant, and were thus able to prove that SoeABC is the major sulfite-oxidizing enzyme in A. vinosum and probably also in other phototrophic sulfur bacteria. The genes also occur in a large number of chemotrophs, indicating a general importance of SoeABC for sulfite oxidation in the cytoplasm. Furthermore, we showed that the periplasmic sulfur substrate-binding protein SoxYZ is needed in parallel to the cytoplasmic enzymes for effective sulfite oxidation in A. vinosum and provided a model for the interplay between these systems despite their localization in different cellular compartments. INTRODUCTION Anoxygenic purple sulfur bacteria like the gammaproteobacterium Allochromatium vinosum, a member of the family Chromatiaceae, are able to derive energy from light by using reduced sulfur compounds as photosynthetic electron donors. The substrates of purple sulfur bacteria primarily include sulfide and elemental sulfur (Imhoff, 2005a). A. vinosum is a metabolically especially versatile 3Present address: Institut für Medizinische Mikrobiologie und Krankenhaushygiene, Zentrum der Hygiene, Universitätsklinikum Frankfurt, Paul-Ehrlich-Straße 40, 60596 Frankfurt am Main, Germany. 4Present address: Merck Millipore, Boulevard Industrial Park, Padge Road, Nottingham NG9 2JR, UK. Abbreviation: APS, adenosine-59-phosphosulfate. Two supplementary tables are available with the online version of this paper. 2626 purple sulfur bacterium that can also utilize thiosulfate and sulfite (Imhoff et al., 1998; Weissgerber et al., 2011). The first major process in the oxidation of thiosulfate and sulfide is the formation of intracellularly stored sulfur globules. The oxidation of thiosulfate to sulfate with sulfur globules as an intermediate involves the periplasmic Sox proteins SoxYZ, SoxB, SoxXAK and SoxL (Pott & Dahl, 1998; Hensen et al., 2006; Welte et al., 2009). For the oxidation of sulfide, A. vinosum possesses the genetic equipment for at least three different enzymes catalysing this reaction, namely the soluble periplasmic flavocytochrome c and the membrane-bound sulfide : quinone oxidoreductases SqrD and SqrF. The last two are both predicted to be oriented towards the periplasm (Reinartz et al., 1998; Gregersen et al., 2011; Weissgerber et al., 2011). In A. vinosum, the sulfur globules are deposited in the same cellular compartment as the periplasmic thiosulfateand sulfide-oxidizing enzymes. This is evidenced by the Downloaded from www.microbiologyresearch.org by 071019 G 2013 SGM IP: 88.99.165.207 On: Mon, 19 Jun 2017 01:13:25 Printed in Great Britain Sulfite oxidation in A. vinosum presence of signal peptide-encoding sequences in the genes for the three structural proteins constituting the sulfur globule envelope (Pattaragulwanit et al., 1998; Prange et al., 2004; Frigaard & Dahl, 2008). For further oxidation of stored sulfur, the so-called Dsr system is of essential importance (Pott & Dahl, 1998; Dahl et al., 2005; Lübbe et al., 2006; Sander et al., 2006). The product of the Dsr pathway is sulfite, generated by a reverse-acting dissimilatory sulfite reductase (DsrAB), an enzyme that is well known to be located in the cytoplasm (Hipp et al., 1997; Pott & Dahl, 1998; Frigaard & Dahl, 2008). The last step is the oxidation of sulfite, yielding sulfate as the final product. Sulfate formation from sulfite is energetically favourable and carried out by a wide range of organisms (Simon & Kroneck, 2013). Many sulfiteoxidizing enzymes are located outside the cytoplasmic membrane (in the periplasm in Gram-negative bacteria). The best-characterized enzyme belonging to this group, SorAB, stems from Starkeya novella and consists of a molybdopyranopterin cofactor-carrying subunit (SorA) and a monohaem cytochrome c (SorB) (Kappler et al., 2000; Kappler & Bailey, 2005). SorA-type molybdoproteins without a SorB subunit have been termed SorT (D’Errico et al., 2006; Wilson & Kappler, 2009), but recently this discrimination has been questioned (Simon & Kroneck, 2013). A second option for oxidation of sulfite in the periplasm is the Sox system. It has been shown that sulfite is accepted in vitro as a substrate of the reconstituted Sox system from the chemotroph Paracoccus denitrificans (Friedrich et al., 2001). Notably, Friedrich and coworkers proved this reaction to be independent of the presence of SoxCD, a molybdohaemoprotein catalysing the six-electron oxidation of SoxY-cysteine-bound persulfide to sulfone sulfur. Purple bacteria that form sulfur globules during thiosulfate oxidation contain the Sox system, albeit without the SoxCD proteins (Hensen et al., 2006; Meyer et al., 2007; Frigaard & Dahl, 2008). Oxidation of sulfite generated by the cytoplasmic Dsr proteins via the periplasmic pathways described would first require transport across the cytoplasmic membrane. However, such transport is probably not necessary in organisms that contain a further well-characterized sulfite oxidation pathway: it is firmly established that a number of purple as well as green anoxygenic phototrophic sulfur bacteria oxidize sulfite in the cytoplasm using an indirect pathway via adenosine-59-phosphosulfate (APS) catalysed by APS reductase and ATP sulfurylase (Dahl, 1996; Sánchez et al., 2001; Frigaard & Dahl, 2008; Rodriguez et al., 2011). The electrons generated by the oxidative formation of APS from sulfite and AMP are fed into the photosynthetic electron transport chain at the level of menaquinone either by AprM or by the much better characterized QmoABC/QmoABHdrCB complex (Meyer & Kuever, 2007; Rodriguez et al., 2011; Ramos et al., 2012; Grein et al., 2013). Notably, however, neither is the APS reductase pathway generally present in purple sulfur bacteria nor is it essential in A. vinosum (Dahl, 1996; Sánchez et al., 2001). http://mic.sgmjournals.org Recently, involvement of a putative heterotrimeric membrane-bound complex named SoeABC (sulfite-oxidizing enzyme) in sulfite oxidation in the cytoplasm of the organosulfonate-degrading chemotrophic alphaproteobacterium Ruegeria pomeroyi has been reported, although not rigorously documented, by Lehmann et al. (2012). The SoeABC protein appears to be a member of the complex iron–sulfur molybdoproteins and consists of an NrfD/PsrClike membrane anchor (SoeC) and two cytoplasmic subunits: an iron–sulfur protein (SoeB) and a molybdoprotein with an N-terminal iron–sulfur cluster binding site (SoeA). It should be noted that SoeABC and the periplasmic Sor-type sulfite dehydrogenases belong to completely different families of molybdoenzymes. SorA and relatives belong to the sulfite oxidase proteins, which bind a single molybdopterin without a second nucleotide. SoeA falls into the molybdopterin-binding MopB superfamily. In many characterized members of this family molybdopterin is present in the form of a dinucleotide, with two molybdopterin dinucleotide units per molybdenum. Similarities are obvious within each molybdoenzyme family sequence, whereas no significant homologies can be detected between members of different families (Kisker et al., 1998). Genes encoding proteins related to SoeABC are present in purple as well as green sulfur bacteria, and in the past years have repeatedly been speculated to be involved in the oxidation of sulfite generated by the Dsr system in the cytoplasm (Frigaard & Bryant, 2008; Frigaard & Dahl, 2008). Notably, soeABC-like genes co-localize with dsr genes not only in the metagenome-derived sequence of another bacterium that belongs to the Roseobacter clade like R. pomeroyi (Lenk et al., 2012), but also in several green sulfur bacteria and in Halorhodospira halophila, a purple sulfur bacterium of the family Ectothiorhodospiraceae (Dahl, 2008; Frigaard & Dahl, 2008). Independent experimental evidence for the involvement of a molybdoprotein was obtained by inhibition of sulfite oxidation in A. vinosum with the molybdate-antagonist tungstate (Dahl, 1996). In this work, we aimed to obtain a clearer picture of the proteins involved in the oxidation of sulfite in purple sulfur bacteria and chose A. vinosum as the model organism. An array of strains carrying single and multiple deletions of relevant genes was studied with regard to the oxidation of externally supplied and internally generated sulfite. Thereby, we identified AvSoeABC (Alvin_2491-2489) as a major player in the oxidation of sulfite. In addition, we present evidence that SoxYZ is also essential in sulfite oxidation, whilst the other Sox proteins are dispensable for the process. METHODS Bacterial strains, plasmids, PCR primers and growth conditions. The bacterial strains, plasmids and primers used in this study are listed in Table 1. A. vinosum strains were cultivated photoorganoheterotrophically in RCV medium (Weaver et al., 1975) or photolithoautotrophically in Pfennig medium (Pfennig & Trüper, Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Mon, 19 Jun 2017 01:13:25 2627 C. Dahl and others Table 1. Bacterial strains and plasmids used in this study Strain or plasmid Escherichia coli strain S17-1 Allochromatium vinosum strains Rif50 SM50 soxXVKm soxBXVKm DsoxY DsoxY+YZ DsoxY DsoeAEm aprB : : VKm DsoxY aprB : : VKm DsoeAEm aprB : : VKm DsoeAEm DsoxY aprB : : VKm DsoeAEm Plasmids pBBR1-MCS2 pDsoxY+YZ pNTS35 pK18mobsacB pK18mobsacBDsoeA pK18mobsacBDsoeAEm pUC19Ery pSUP301 pSUP301DsoeAEm Primers Avin2491fw1 Avin2491rev1 Avin2491fw2 Avin2491rev2 Genotype or phenotype 294 (recA thi pro hsdR2M+) Tpr Smr [RP4-2-Tc : : Mu-Km : Tn7] Simon et al. (1983) Rif r, spontaneous rifampicin-resistant mutant of DSM 180T Smr, spontaneous streptomycin-resistant mutant of DSM 180T Kmr, soxX : : VKm in DSM 180T Kmr, soxX : : VKm in DSM 180T Rif r, in-frame deletion of soxY in Rif50 Rif r Kmr, complementation of DsoxY Rif r Emr; DsoeA Em 51 nt upstream of soeA ATG in DsoxY Kmr Smr, aprB : : VKm in SM50 Kmr Rif r, aprB : : VKm in DsoxY Emr Rif r, DsoeA Em 51 nt upstream of soeA ATG in Rif50 Kmr Emr, Smr, DsoeA Em 51 nt upstream of soeA ATG in aprB : : VKm Kmr Emr Rif r, Em 51 nt upstream of soeA ATG in DsoxY aprB : : VKm Lübbe et al. (2006) Dahl (1996) Hensen et al. (2006) Hensen et al. (2006) Hensen et al. (2006) Hensen et al. (2006) This work Dahl (1996) This work This work This work This work Kmr Mob+, rep lacZa Kmr, 1.5 kb PCR fragment of soxYZ (XbaI) in XbaI of pBBR1-MCS2 Kmr cartridge (EcoRI) from pHP45VKm in PvuII within aprB Kmr Mob+, sacB oriV oriT lacZa Kmr HindIII fragment of PCR-amplified genome region around soeA (Alvin_2491) with deletion of 2864 bp of the soeA sequence Kmr Emr, 1.1 kb blunt-ended HindIII–EcoRI fragment from pUC19Ery in SspI of pK18mobsacBDsoeA Apr Emr, from pE194 in SmaI of pUC19 Apr Kmr Mob+ Apr Emr, 2.9 kb HindIII fragment from pK18mobsacBDsoeAEm in HindIII of pSUP301 Kovach et al. (1995) Hensen et al. (2006) Dahl (1996) Schäfer et al. (1994) This work GGCGGGAAGCTTTCCGAATGATCCGCT TTGCTTCCCGAAGATACTGGCTGGATCCTG CAGGATCCAGCCAGTATCTTCGGGAAGCAA GCGAACAAGCTTCCGACGGCATAGAAC This This This This 1992) without reduced sulfur compound, referred to as ‘0 medium’. Sulfide or sulfite was added as electron source at the desired concentration. The cultivation was performed under anoxic conditions and continuous illumination at 30 uC either in completely filled screw-capped culture bottles or in thermostatted glass fermenters. Escherichia coli was cultivated in LB medium (Sambrook et al., 1989). Antibiotics used for mutant selection were applied at the following concentrations: for E. coli: ampicillin 100 mg ml21, kanamycin 50 mg ml21, erythromycin 100 mg ml21, chloramphenicol 50 mg ml21; for A. vinosum: rifampicin 50 mg ml21, streptomycin 50 mg ml21, ampicillin 10 mg ml21, kanamycin 10–25 mg ml21, erythromycin 10 mg ml21. Recombinant DNA techniques. Standard methods were used for molecular biological techniques. Chromosomal DNA of A. vinosum strains was obtained by a modified sarcosyl lysis (Bazaeal & Helinski, 1968). The genotypes of the A. vinosum recombinants used in this study were confirmed by Southern hybridization and PCR. The latter is the only method of choice to confirm complementation strains. Southern hybridization was performed overnight at 68 uC. PCR amplifications with Taq DNA polymerase and Pfu DNA polymerase were done essentially as described previously (Dahl, 1996). DNA probes for Southern hybridization were digoxigenin labelled by PCR. 2628 Reference This work Leenhouts et al. (1990) Simon et al. (1983) This work work work work work Plasmid DNA from E. coli was purified using the QIAprep Spin Miniprep Kit (Qiagen). Construction of A. vinosum single-, double- and triple-mutant strains. For the substitution of soeA (Alvin_2491) in the genome of A. vinosum by an erythromycin cassette, SOE PCR (Horton, 1995) fragments were constructed using primer pairs Avin2491fw1/ Avin2491rev1 and Avin2491fw2/Avin2491rev2 (Table 1). The resulting fragment was inserted into plasmid pK18mobsacB (Schäfer et al., 1994) by HindIII restriction sites resulting in plasmid pK18mobsacBDsoeA. After digestion with HindIII and EcoRI the erythromycin cassette from pUC19Ery was blunt-ended using Klenow polymerase and ligated into the SspI site of pK18mobsacBDsoeA, resulting in pK18mobsacBDsoeAEm. The SspI site is situated 51 nt upstream of the soeA ATG start codon and 110 nt downstream of the TGA stop codon of the preceding gene Alvin_2492. Thus, it was guaranteed that expression of Alvin_2492 was not affected by insertion of the antibiotic resistance cassette. The 2.9 kb HindIII fragment of pK18mobsacBDsoeAEm was then inserted at the HindIII site of pSUP301. The final mobilizable construct pSUP301DsoeAEm. was transferred from E. coli S17-1 to A. vinosum strains Rif50, aprB : : VKm, DsoxY and DsoxY aprB : : VKm by conjugation (Pattaragulwanit & Dahl, 1995). For the insertional inactivation of Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Mon, 19 Jun 2017 01:13:25 Microbiology 159 Sulfite oxidation in A. vinosum aprB, plasmid pNTS35 (Dahl, 1996) was conjugationally transferred from E. coli S17-1 to A. vinosum strain DsoxY. Transconjugants were selected on RCV plates containing the appropriate antibiotics under anoxic conditions in the light. Double cross-over recombinants lost the vector-encoded ampicillin resistance. The genotype of double cross-over recombinants was verified by Southern hybridization experiments. Characterization of phenotypes, detection of sulfur species and protein determination. A. vinosum WT and mutant strains were characterized in batch culture experiments essentially as described previously (Prange et al., 2004; Hensen et al., 2006). Cells of A. vinosum, grown photo organoheterotrophically on malate [RCV medium (Weaver et al., 1975)] for 3 days were used as an inoculum for experiments concerned with transformation of sulfide and sulfite. The culture volume of the precultures was 500 ml. Inoculum cells were harvested by centrifugation (10 min, 2680 g) and washed once in ‘0 medium’. The culture volume for phenotypic analyses of WT and mutant strains on 5 mM sulfite was 250 ml. Experiments concerned with transformation of sulfide were performed in 1.5 l fermenters. To maintain pH 7.0, sterile HCl (0.5 M) and Na2CO3 (0.5 M) solutions were added automatically. Sulfide, thiosulfate and sulfate were determined either by HPLC (Rethmeier et al., 1997), or by classical colorimetric or turbidometric methods as described previously (Dahl, 1996). Elemental sulfur and tetrathionate were determined colorimetrically by cyanolysis (Bartlett & Skoog, 1954; Kelly et al., 1969; Dahl, 1996). Sulfite was determined via the fuchsin method as described by Dahl (1996). Protein concentrations were determined using the Bradford reagent (Sigma) as specified by the manufacturer. RESULTS Occurrence of sulfite oxidation-related genes in genome-sequenced purple sulfur bacteria A survey of all genome sequences available for a physiologically coherent group of bacteria can provide revealing insights into pathways of general, major or possibly only minor importance. We therefore searched the currently completely sequenced phototrophic members of the families Chromatiaceae and Ectothiorhodospiraceae for the presence of sulfite oxidation-related genes. Table 2 provides a compilation of our results. From these findings, it is evident that periplasmic sulfite-oxidizing systems are not present universally in purple sulfur bacteria. Whilst the sulfur substrate-binding protein SoxYZ is present irrespective of the organisms’ substrate range, with only one exception (Thioflaviococcus mobilis), the presence of SoxXA(K) and SoxB appears to be strictly linked to the ability of the cells to utilize thiosulfate (Table 2). Nevertheless, participation of the Sox system in sulfite oxidation in those strains that contain Sox proteins is not completely excluded. Furthermore, our survey showed that only a single purple sulfur bacterium, T. mobilis, contains a sorA-like gene (Table 2), implying that the encoded enzyme is of very restricted importance in this organism group. The cytoplasmic APS reductase pathway occurs in several, although not all, purple sulfur bacteria. The electronaccepting unit for AprBA appears to be AprM in most cases, but is replaced by QmoABHdrBC in Thiocystis http://mic.sgmjournals.org violascens (Table 2). The only probable sulfite-oxidizing unit that is encoded in all sequenced purple sulfur bacteria is SoeABC (Table 2), pointing to a general and major importance of this membrane-bound complex iron–sulfur molybdoprotein. In A. vinosum, SoeABC is encoded by genes Alvin_2491 (soeA), Alvin_2490 (soeB) and Alvin_2489 (soeC). The protein consists of the 108.95 kDa molybdoprotein SoeA carrying one [Fe4S4] cluster at the N-terminus, the 26.995 kDa iron–sulfur protein SoeB, which upon comparison with related structurally characterized proteins (Jormakka et al., 2008) is predicted to bind four [Fe4S4] clusters, and a 35.715 kDa NrfD/PsrC-like membrane protein (Simon & Kern, 2008) with eight transmembrane helices. Neither AvSoeA and AvSoeB nor any of the other purple sulfur bacterial SoeA or SoeB proteins listed in Table 2 are synthesized with cleavable TAT signal peptides that are usually present on the active-site subunits of the biochemically well-characterized periplasmic sulfur-metabolizing complex iron–sulfur molybdoproteins, i.e. polysulfide and sulfur reductase (PsrABC, SreABC), thiosulfate reductase (PhsABC) or tetrathionate reductase (TtrABC) (Krafft et al., 1992; Heinzinger et al., 1995; Hensel et al., 1999; Laska et al., 2003). We can thus state conservatively that SoeA and SoeB are located in the cytoplasm and attached to the cytoplasmic membrane by interaction with SoeC. The holoprotein would therefore be well suited for oxidation of sulfite generated in the cytoplasm. Further indication for an involvement of SoeABC in dissimilatory sulfur oxidation in A. vinosum was gathered during recent genome-wide transcriptional profiling (Weissgerber et al., 2013). Relative transcription of all three A. vinosum soe genes was found to be increased ~3fold during photolithoautotrophic growth on sulfide or thiosulfate compared to photo organoheterotrophic growth on malate (2.99-, 2.77- and 2.93-fold increase on sulfide and 1.96, 1.98 and 3.00-fold increase on thiosulfate, for soeA, -B and -C, respectively). Changes in the same range were observed for the genes encoding the enzymes of the APS reductase pathway when thiosulfate replaced malate, whilst relative transcript levels for the sat-aprMBA genes were 7.6- to 9.7-fold higher in the presence of sulfide compared with the presence of malate. Oxidation of externally supplied sulfite by A. vinosum: role of SoeABC and APS reductase To assess the importance of the SoeABC protein in A. vinosum, a mutant strain (A. vinosum DsoeAEm) was constructed that carries a deletion of the soeA gene and an insertion of an erythromycin resistance cassette. The latter was positioned immediately upstream of the original soeA gene, but well downstream of the stop codon of the preceding gene Alvin_2492, thereby ensuring that expression of Alvin_2492 was not affected. The same DsoeAEm mutation was also introduced into an A. vinosum strain already lacking APS reductase (Dahl, 1996). Previously, we Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Mon, 19 Jun 2017 01:13:25 2629 C. Dahl and others 2630 Table 2. Proteins related to sulfite oxidation encoded in genome-sequenced purple sulfur bacteria With the exception of Thiorhodospira sibirica all organisms listed in this table contain a complete set of dsr genes (dsrABEFHCMKLJOPN).The soxCD genes are not listed here because they do not occur in any of the sequenced anoxygenic phototrophic bacteria. The absence of signal peptides was confirmed for all SoeA and SoeB homologues listed here. The proteins are thus predicted to be cytoplasmic. Organism Sulfur substrate Sat AprBA AprM Qmo SorA SoeABC SoxXAK SoxB SoxYZ Family Chromatiaceae Allochromatium vinosum T Sulfide, S0, thiosulfate, Alvin_1118 Alvin_1120-1121 Alvin_1119 – – Alvin_2491-2489 Alvin_2168-2170 Thi970DRAFT_ Thi970DRAFT_00963- Thi970DRAFT_00962 – – Thi970DRAFT_ – Alvin_2167 Alvin_2111-2112 sulfite DSM 180 Thiorhodovibrio sp. 970 Sulfide, S0 (thiosulfate and sulfite not reported) Thiocapsa marina 5811 T (DSM 5653 ) Thiocystis violascens DSM 198T Sulfide, S0, thiosulfate, 00964 00961 ThimaDRAFT_1689 ThimaDRAFT_ sulfite Sulfide, S0, thiosulfate, ThimaDRAFT_4550 – – 4551-4552 Thivi_0893 – Thi970DRAFT_01660-01661 00955-00957 Thivi_3300-3299 ThimaDRAFT_ 0331-0329 – sulfite Thivi_3114-3111 ThimaDRAFT_ ThimaDRAFT_4579 ThimaDRAFT_0728-0729, ThimaDRAFT_3536-3537 4578-4576 – Thivi_4531-4533 Thivi_3804-3802 Thivi_2200 Thivi_3138-3139 – ThidrDRAFT_ ThidrDRAFT_ ThidrDRAFT_2415 ThidrDRAFT_2534-2535 2883-2881 2416–2418 (qmoABhdrCB), no QmoC Thiorhodococcus drewsii Sulfide, S0, thiosulfate ThidrDRAFT_3161 AZ1 (DSM 15006T) Thioflaviococcus mobilis T DSM 8321 Marichromatium purpuratum 984 (DSM ThidrDRAFT_ ThidrDRAFT_1494 – 1495-1496 Sulfide, S0 (sulfite not Thimo_1948 Thimo_1220-1219 Thimo_1221 – Thimo_2977 – – Thimo_1580-1582 – – – tested) Sulfide, S0, thiosulfate – – – (sulfite not tested) MarpuDRAFT_ 2159-2161 MarpuDRAFT_ MarpuDRAFT_0224 MarpuDRAFT_0579-0580 0223-0221 1591T) Family Ectothiorhodospiraceae Thiorhodospira sibirica ATCC 700588T Sulfide, S0 (sulfite not – – – – – tested) ThisiDRAFT_1377, – – ThisiDRAFT_0337-0336 ThisiDRAFT_0834, ThisiDRAFT_2148 Halorhodospira halophila Sulfide, thiosulfate – – – – – Hhal_1936-1934 SL1 (DSM 244T) Hhal_1948 (fused Hhal_1939 Hhal_1941-1942 soxXA), no soxK Microbiology 159 The genes for the following biochemically well characterized proteins served as baits: aprMBA and sat genes from A. vinosum and qmoABC from Desulfovibrio desulfuricans for the APS reductase pathway, soxYZ, soxXAK and soxL from A. vinosum and soxCD from Paracoccus pantotrophus for the Sox pathway, sorAB from S. novella and soeABC from R. pomeroyi. In the case of the soeABC genes, a function for the encoded proteins has been reported but not rigorously documented (Lehmann et al., 2012). References for substrate ranges: Bryantseva et al. (1999), Zaar et al. (2003), Caumette et al. (2004) and Imhoff (2005a, b). Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Mon, 19 Jun 2017 01:13:25 Sulfite oxidation in A. vinosum reported that crude extracts of WT A. vinosum catalysed sulfite-dependent ferricyanide reduction in the absence of AMP (Dahl, 1996). This activity was no longer detectable in the A. vinosum DsoeAEm mutant strain. We concluded therefore that the protein encoded by the soeABC genes is identical with the AMP-independent sulfite-oxidizing entity in A. vinosum. In a first set of experiments, we studied the phenotypes of A. vinosum WT, the APS reductase and SoeABC-deficient single-mutant strains as well as that of the corresponding double mutant regarding the oxidation of externally supplied sulfite under anoxic conditions in the light. The experiments were performed in batch culture in 250 ml bottles that were completely filled with medium containing 5 mM sulfite as the only source of sulfur and electrons. The A. vinosum strain lacking only APS reductase exhibited a phenotype clearly discernible from that of the WT, i.e. sulfite was oxidized with a significantly lower rate (Table 3). This finding is in agreement with results reported by Sánchez et al. (2001) who compared sulfide oxidation by A. vinosum WT and the APS reductase-deficient strain in continuous culture. While Sánchez et al. (2001) observed only small differences between WT and APS reductasedeficient strains at light-limiting irradiances, the presence of the APS reductase pathway was clearly advantageous for A. vinosum at high irradiances. This finding explains why initial batch culture experiments performed in 1.5 l culture vessels allowing only limited light penetration to the centre of the culture failed to demonstrate an effect of APS reductase deficiency (Dahl, 1996). As evident from Table 3, the SoeABC-deficient A. vinosum mutant exhibited an even more apparent phenotype with Table 3. Sulfite oxidation rates in A. vinosum WT and mutant strains lacking functional APS reductase, SoeABC, SoxYZ or combinations thereof Strain WT aprB : : VKm DsoeAEm aprB : : VKm DsoeAEm DsoxY DsoxY aprB : : VKm DsoxY DsoeAEm DsoxY aprB : : VKm DsoeAEm Sulfite oxidation rate [nmol min”1 (mg protein)”1] 64.6±4.6 26.0±8.2 10.9±8.0 4.5±0.5 5.2±0.4 6.4±1.2 6.5±0.6 4.0±1.2 Initial sulfite concentration: 5 mM. Experiments were performed in completely filled 250 ml culture bottles. A background rate of chemical sulfite oxidation was determined for medium incubated under the same experimental conditions (0.33 nmol min21 ml21) and has already been deducted from the rates given. Initial protein concentration: 56–134 mg ml21. http://mic.sgmjournals.org regard to the oxidation of externally added sulfite than the mutant solely lacking APS reductase. The specific sulfite oxidation rate of the former amounted to only 17±10 % of the WT (Table 3). This finding is again in full agreement with Sánchez et al. (2001), who reported that under all the conditions tested an APS reductase-independent pathway was responsible for most of the sulfur flow to sulfate (69– 100 %) in A. vinosum. A knockout of both aprB and soeA led to an additive effect with a residual specific rate of sulfite oxidation for whole cells of only ~7 % of the WT (Table 3). Oxidation of externally supplied sulfite by A. vinosum: role of Sox proteins As already outlined in the Introduction, it has been demonstrated convincingly that sulfite is accepted in vitro as a substrate of the reconstituted Sox system from the chemotroph P. denitrificans (Rother et al., 2001). In this case, the reaction cycle has been proposed to be simpler than that needed for oxidation of thiosulfate. The cycle would start with SoxXA-catalysed oxidative coupling of sulfite to the cysteine in the C-terminal SoxY ‘GGCGG’ motif followed by a SoxB-mediated hydrolysis reaction releasing sulfate (Sauvé et al., 2007; Kappler & Maher, 2013). An involvement of the periplasmic Sox proteins in the oxidation of sulfite in purple sulfur bacteria is thus not a priori excluded, especially where the oxidation of external sulfite is concerned. We therefore conducted a series of experiments in which we studied the effect of a deficiency in various Sox proteins on sulfite oxidation in A. vinosum. The assumption that coordinated action of the A. vinosum Sox proteins is necessary for their in vivo function originally led us to the conclusion that, if any phenotype of Sox protein deficiency was detectable, it should be the same or at least very similar, irrespective of which specific Sox protein or which combination thereof is removed. However, surprisingly this was not the case. While both an A. vinosum mutant lacking functional SoxXAK and a mutant additionally lacking SoxB behaved virtually indiscernibly from the WT (Table S1, available in Microbiology Online), the DsoxY mutant showed a significant decrease in sulfite oxidation rate (Tables 3 and S1). It should be emphasized that the experiments compiled in Tables 3 and S1 were not performed under exactly the same experimental conditions. The experiments summarized in Table S1 were run in 1.5 l culture vessels and thus light intensities in the centre of the cultures were lower than in the 250 ml cultures used for the experiments compiled in Table 3. It is evident that the specific sulfite oxidation rates for WT A. vinosum are higher at higher irradiance [64.6±4.6 versus 36.2±1.6 nmol min21 (mg protein)21 in 250 ml and 1.5 l cultures, respectively]. The lack of a protein important for sulfite oxidation (SoxYZ in this case) has a more drastic effect under high irradiances, just as has already been found for APS reductase (Sanchez et al., 2001). Reintroduction of soxYZ into the soxY-deficient mutant (strain A. vinosum DsoxY+YZ) resulted in complete restoration of the WT Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Mon, 19 Jun 2017 01:13:25 2631 C. Dahl and others Oxidation of sulfide in A. vinosum strains deficient in SoeABC, APS reductase and/or SoxYZ We now set out to define the roles of the newly detected cytoplasmically oriented membrane-bound molybdenum cofactor-containing SoeABC complex as well as the periplasmic SoxYZ protein in the very complex transformation of sulfur compounds occurring during oxidation of sulfide to sulfate. To this end, a suitable set of A. vinosum mutant strains was studied in 1.5 l fermenter cultures under pH control. This experimental design guaranteed full comparability of results obtained for this multi-step process and enabled sampling for various different sulfur compounds at ample time points. We could thus lay a special focus on intermediates of the process as well as the final sulfur product(s). The WT A. vinosum control cultures behaved as expected: sulfide was rapidly converted (Fig. 1a) to sulfur, which transiently accumulated in sulfur globules (Fig. 1b). Polysulfides were formed as intermediates in the process (Prange et al., 2004), but are not shown here for better clarity. In the next step, sulfite was generated in the cytoplasm by the Dsr proteins. In WT cultures, sulfite does not accumulate in the medium to more than 30 mM (Dahl, 1996) (Fig. 1c). Finally, the end product sulfate appeared in the medium (Fig. 1d). Thiosulfate and tetrathionate concentrations were below detection limits once sulfide was used up. In accordance with previous results (Dahl, 1996), the phenotype of the APS reductase-negative mutant was indiscernible from the WT under the conditions chosen and is therefore not shown in Fig. 1. 2632 Sulfide (mM) 3.0 2.0 1.0 4.0 (b) Intracellular sulfur (mM) To further dissect the importance of SoxYZ in relation to the cytoplasmic sulfite-oxidizing systems we constructed A. vinosum mutants lacking SoxYZ as well as SoeABC and/or APS reductase. It now appeared that the specific sulfite oxidation rates of neither the double nor the triple mutants were significantly different from that of the DsoxY single mutant (Table 3). These observations suggest that SoxYZ is needed for oxidation of externally added sulfite in A. vinosum even in the presence of both cytoplasmic sulfiteoxidizing systems. The requirement of SoxYZ is not absolute, though, because we found conditions under which the SoxYZ-deficient mutant still exhibited a sulfite oxidation rate well above background (Table S1). 4.0 3.0 2.0 1.0 4.0 (c) 3.0 Sulfite (mM) Oxidation of externally supplied sulfite by A. vinosum: connection of cytoplasmic systems and SoxYZ (a) 2.0 1.0 (d) 4.0 Sulfate/thiosulfate/ tetrathionate (mM) phenotype with regard to oxidation of externally supplied sulfite (Table S1). These findings suggested the periplasmic sulfur substrate-binding protein SoxYZ as another important player in sulfite metabolism in A. vinosum, whilst SoxXAK and SoxB do not appear to play a significant role in this process. 3.0 2.0 1.0 0.0 0 10 20 30 40 50 Time (h) 60 70 80 140 150 Fig. 1. Sulfide oxidation in A. vinosum WT and mutant strains. Representative experiments of biological triplicates are shown. (a) Sulfide, (b) intracellular sulfur, (c) sulfite, and (d) sulfate, thiosulfate and tetrathionate. A. vinosum strains: WT ($), DsoeAEm (h), DsoxY (D), aprB : : VKm DsoeAEm (&), DsoxY aprB : : VKm DsoeAEm (#). Thiosulfate and tetrathionate concentrations are depicted in (d) using dotted and dashed lines, respectively. Initial protein concentration: WT 0.19 mg ml”1, DsoeAEm 0.17 mg ml”1, DsoxY 0.11 mg ml”1, aprB : : VKm DsoeAEm 0.13 mg ml”1 and DsoxY aprB : : VKm DsoeAEm 0.14 mg ml”1. Note the break in timescale. The period between 84 and 134 h was omitted to enable a good overview of the ongoing sulfur transformations during the first 3 days of the experiments and to depict the final situation for the triple-mutant strain in the same figure. Like the apr-negative A. vinosum mutant strain, neither the SoeABC-deficient mutant nor the tested double mutant was affected with regard to sulfide removal from the Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Mon, 19 Jun 2017 01:13:25 Microbiology 159 Sulfite oxidation in A. vinosum cultures, whilst the DsoxY aprB : : VKm DsoeAEm triple mutant exhibited a significantly reduced sulfide oxidation rate (Table 4). We conclude that neither SoxYZ nor APS reductase and SoeABC is involved directly in oxidation of sulfide to intracellular sulfur in A. vinosum. Oxidation rates for intracellularly stored sulfur were found to be reduced by ~50 % in the SoeABC-deficient and the SoxYZ-deficient mutant, whilst the rate was even further reduced in the strain lacking both cytoplasmic sulfite-oxidizing systems, and found to be only 20 % of the original rate in the triple mutant (Table 4). Quantitative analysis of inorganic sulfur compounds in the medium revealed that all mutants lacking SoeABC and/or SoxYZ accumulated massive amounts of sulfite up to a maximum of 1.2 mM in the aprB : : VKm DsoeAEm strain that is no longer capable of cytoplasmic sulfite oxidation. Up to 0.43 mM sulfite accumulated in the DsoeAEm strain, again underlining the major importance of direct SoeABCcatalysed sulfite oxidation over the indirect APS reductase pathway. In both tested mutants still containing SoxYZ, i.e. DsoeAEm and aprB : : VKm DsoeAEm mutants, sulfate was formed as the only detectable final product (Fig. 1d). Thiosulfate was not detected at any time in these cultures. In contrast, the DsoxY mutant produced not just sulfate, but also thiosulfate (Fig. 1d). Part of this thiosulfate was further oxidized to tetrathionate, which can be explained by the action of the periplasmic thiosulfate dehydrogenase (Denkmann et al., 2012). The amount of thiosulfate consumed (0.473 mM in the experiment shown in Fig. 1d) and that of tetrathionate formed (0.210 mM) adhered exactly to the predicted 2 : 1 stoichiometry. Once formed, thiosulfate could obviously no longer be transformed into sulfate in the DsoxY strain. This result is in complete agreement with earlier findings that tetrathionate is the only product of thiosulfate-exposed A. vinosum DsoxY cells (Hensen et al., 2006). The inability of the DsoxY strain to form sulfate from thiosulfate is clearly due to the incompleteness of the Sox system. Nevertheless, the mutant formed sulfate as the major end product of the oxidation of sulfide. This is explained by the presence and action of the APS reductase/SoeABC systems in the cytoplasm. In contrast, the triple mutant lacking SoxYZ as well as the cytoplasmic sulfite-oxidizing enzymes appeared to be completely incapable of sulfate formation. The small amount of sulfate found in the medium after prolonged incubation (144 h) is completely accounted for by chemical formation from sulfite. The main product in the sulfide-exposed triple-mutant strain was thiosulfate, which to some extent was again transformed to tetrathionate by the action of the periplasmic thiosulfate dehydrogenase. DISCUSSION In this work, we identified the membrane-bound iron– sulfur molybdoprotein SoeABC as a major enzyme catalysing direct oxidation of sulfite to sulfate in the cytoplasm of A. vinosum. The function of SoeABC was proven by strongly reduced specific oxidation rates for externally supplied sulfite and by massive excretion of sulfite into the medium during oxidation of sulfide in A. vinosum SoeABC-deficient strains. Our conclusion is corroborated by the lack of AMP-independent sulfiteoxidizing activity in the crude extract of SoeABC-deficient A. vinosum. SoeABC appears to be of general importance in purple sulfur bacteria because it is encoded in all genomes of organisms belonging to this group (Table 2). Database searches revealed the presence of three linked genes related closely to soeABC and encoding the three subunits of a cytoplasmically oriented membrane-bound iron–sulfur molybdoprotein not only in phototrophic sulfur oxidizers, but also in a large number of chemotrophic bacteria. Examples are compiled in Table S2. Whilst the so-far sequenced epsilon- and deltaproteobacteria do not appear to contain soeABC, these genes occur in several chemotrophic sulfur oxidizers belonging to the gammaproteobacteria including the bacterial endosymbionts of Riftia pachyptila and Tevnia jerichonana, Thioalkalivibrio species and Acidithiobacillus species. Furthermore, a number of known sulfur oxidizers belonging to the betaproteobacteria contain the genes, including Sulfuricella denitrificans, Thiomonas species as well as Thiobacillus denitrificans. Among the alphaproteobacteria containing soeABC, Magnetospirillum species and Magnetococcus species are established sulfur Table 4. Rates for oxidation of externally added sulfide and intracellular sulfur in A. vinosum WT, single- and double-mutant strains defective in soe, apr and/or sox genes Strain WT DsoeAEm DsoxY aprB : : VKm DsoeAEm DsoxY aprB : : VKm DsoeAEm Sulfide oxidation rate [nmol min”1 (mg protein)”1] Sulfur oxidation rate [nmol min”1 (mg protein)”1] 69.3±4.5 69.0±6.3 94.8±5.8 73.3±20.9 10.5±5.4 26.5±4.0 15.3±1.3 13.4±1.2 10.2±2.3 4.4±0.8 Initial sulfide concentration: 4 mM. Protein concentration at the onset of fermentations: 110–193 mg ml21. http://mic.sgmjournals.org Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Mon, 19 Jun 2017 01:13:25 2633 C. Dahl and others oxidizers. The presence and genomic linkage of soeABC with dsr and sox genes in bacteria belonging to the Roseobacter clade has recently been noted by Mussmann and coworkers (Lenk et al., 2012). The genes are also present in several genome-sequenced Roseovarius species and Roseobacter species. Among the soeABC-containing alpha- and betaproteobacteria, we find a number of species for which sulfuroxidizing capabilities have not been described and/or tested (e.g. Herminiimonas arsenicoxydans and several Burkholderia species) or in which sulfur-oxidizing capabilities are restricted to oxidizing sulfite released as an intermediate during organosulfur compound degradation, as in the Roseobacter clade bacterium R. pomeroyi (Lehmann et al., 2012). We can thus state that the A. vinosum and the currently not well described R. pomeroyi soeABC genes encode the prototypes of a new protein family within the complex iron–sulfur molybdoenzymes that is widespread among several branches of proteobacteria. We propose that the so-far largely unrecognized SoeABC sulfite dehydrogenase is of major importance for the oxidation of sulfite in the cytoplasm generated either by the Dsr system or by cytoplasmic desulfonating enzymes like sulfoacetaldehyde acetyltransferase (Xsc) in a wide range of physiologically and phylogenetically diverse bacteria. Furthermore, the compilation of the occurrence of cytoplasmic sulfite-generating and sulfite-oxidizing systems in selected proteobacteria in Table S2 shows that there is no tight correlation between specific modes of sulfite generation (here, Dsr or Xsc) and the sulfite-oxidizing module present (here, SoeABC or AprBA combined with either AprM or QmoABHdrCB). In most cases, the presence of Xsc is coupled with the presence of SoeABC; however, ‘Candidatus Pelagibacter ubique’ is a well-recognized exception (Meyer & Kuever 2007, Table S2). The Dsr system may occur in parallel with SoeABC alone, with AprBA alone (e.g. in ‘Candidatus Ruthia magnifica’, see Table S2) or with a combination of both systems. The possession of the APS reductase pathway in addition to or instead of SoeABC may be advantageous because additional energy is gained by substrate phosphorylation in the ATP sulfurylase-catalysed step by transferring the AMP moiety of APS onto pyrophosphate (Parey et al., 2013). Furthermore, it may be especially advantageous to be equipped with the Qmo-related electron-accepting unit for APS reductase. Irrespective of whether SoeABC or AprMBA is used, the electrons stemming from sulfite are proposed to enter the electron transport chain at the energetic level of quinones (via SoeC or AprM). However, the presence of the HdrA-like QmoA in the Qmo complex opens the possibility that – in a reverse manner to the mechanism suggested for sulfate reducers (Ramos et al., 2012; Grein et al., 2013) – an electron bifurcation occurs that could result in simultaneous reduction of low-potential electron acceptors like ferredoxin or NAD+. Such a process would be of significant energetic advantage especially for chemolithoautotrophic growth because it would result in a lower energy demand for reverse electron flow. 2634 In the current work, we furthermore collected evidence for an involvement of the periplasmic sulfur substrate-binding protein SoxYZ in the sulfite metabolism in A. vinosum, whilst other Sox proteins (SoxXAK and SoxB) do not appear to play a significant role in this process. We suggest that SoxYZ may serve the same function – and thus be of considerably higher importance than previously assumed – in other purple sulfur bacteria as well. This is suggested by our observation that genes encoding the protein are almost universally present in this group of organisms irrespective of whether the organism contains further sox genes and is able to metabolize thiosulfate (Table 1). The exact nature of SoxYZ participation in sulfite metabolism cannot yet be deduced from in vitro experiments, but nevertheless can be pinpointed by our experiments with A. vinosum mutant strains. One important conclusion from these studies is that SoxYZ cannot be a component of a sulfite-oxidizing pathway running independently of the cytoplasmic pathways. Mutants lacking SoxYZ and mutants lacking both cytoplasmic sulfite oxidation pathways are each very strongly affected with regard to degradation of external sulfite as well as with regard to turnover of sulfite formed as an intermediate by the cells. The effects are not additive, rather both SoxYZ and the cytoplasmic pathways need to co-exist. Obviously, both the periplasmic SoxYZ and the cytoplasmic sulfite-oxidizing enzymes are needed in parallel for effective sulfite oxidation in A. vinosum, suggesting some kind of interplay between these systems despite localization in two different cellular compartments. The simplest model into which these results and considerations can be integrated is the suggestion that SoxYZ may act as a sulfite-binding protein in the periplasm of A. vinosum and that in this function the protein acts independently of the other Sox proteins, i.e. SoxXAK and SoxB. Originally, we rationalized that binding of sulfite to SoxYZ may only be possible in an oxidative step yielding SoxY-cysteine-sulfonate catalysed by a protein containing a redox-active site. However, in vivo such a process is obviously not exerted by the most likely candidate SoxXA since the sulfite oxidation capability of the SoxXA-deficient strain is undisturbed. An alternative mode for attachment of sulfite to SoxYZ not involving a redox reaction is the reaction of the thiolate of the conserved SoxY-cysteine (Sox-Cys2) with aqueous sulfite yielding SoxY-cysteine-Ssulfinate (SoxY-Cys-SO22). Such a reaction is indeed feasible at the moderate pH values prevalent in the bacterial periplasm (Steudel & Steudel, 2010). However, it should be kept in mind that the reaction has so far only been shown for free cysteine and not for an active-site residue of a complex protein. We also considered an alternative mechanism for the generation of SoxY-cysteineS-sulfinate. In aqueous solution sulfite can form disulfite by a chemical reaction (2 HSO32(aq) > S2O522(aq) + H2O, equation 1). This disulfite could serve as substrate for SoxZY according to equation 2: SoxZY-Cys2 + [O2S-SO3]2–+H+ « SoxZY-Cys-SO22+HSO32. Based on this mechanism, SoxYZ could act as a binding protein not Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Mon, 19 Jun 2017 01:13:25 Microbiology 159 Sulfite oxidation in A. vinosum only shielding components of the periplasm from chemical reactions with sulfite, but possibly also delivering sulfite for transport into the cytoplasm. We suggest that the SoxYcysteine-S-sulfinate may act as a substrate donor for an asyet unknown transport system importing sulfite into the cytoplasm. Either sulfite could be released by the transporter by simple addition of water to the SoxYcysteine-S-sulfinate or disulfite may be released in reverse of equation 2 shown above. In Fig. 2, the role of SoxYZ as a donor for a sulfite-importing system is depicted for the simplest case, i.e. the degradation of externally available sulfite. The A. vinosum genome contains an array of genes encoding putative (ABC) transporters that could in principle serve such a function and work together with a sulfite-binding protein. Once in the cytoplasm, sulfite is immediately oxidized to sulfate via the direct SoeABC and/ or the indirect APS reductase pathway. At present, we cannot discount the possibility that sulfite is also taken up into the cytoplasm in the absence of SoxYZ – albeit with a significantly slower rate – as the DsoxY mutant shows residual sulfite-oxidizing capability under light-limited conditions (Table S1). We also present a model for the interplay of SoxYZ and cytoplasmic sulfite oxidation when sulfide, the most readily available substrate in its natural habitat, is metabolized by A. vinosum. Here, the picture is much more complicated. It was already outlined above that zero-valent sulfur stored in sulfur globules is an intermediate during the oxidation of this most highly reduced sulfur compound to sulfate. Sulfite is also a well-established intermediate further downstream in the process. Although this intermediate is formed in the cytoplasm, it appears to be excreted, i.e. transported across the cytoplasmic membrane, to some extent even by WT cells. This is evidenced by the detection SoxZY-Cys–+ HSO–3 SoxZY-Cys-SO2–+ H2O Periplasm AprM Apr Cytoplasm AprA MKH2 MK AMP APS PPi ATP SoeC SO2– 4 MKH2 MK H+ B H2O MoCo HSO–3 SoeA SO2– 4 2 H+ Fig. 2. Model for oxidation of external sulfite in A. vinosum WT. The thiolate of conserved SoxY-Cys152 is predicted to react with hydrogen sulfite, resulting in the corresponding sulfinate derivative. Such a mechanism is feasible at moderate pH values as shown by Steudel & Steudel (2010). The SoxY-sulfinate could then serve as a substrate donor for an as-yet unknown sulfite transport system. Hydrogen sulfite (HSO3”) has a pKa of 6.97 and therefore exists predominantly in the protonated form at the slightly acidic pH of the bacterial periplasm. http://mic.sgmjournals.org of sulfite in WT culture supernatants albeit at only very low concentrations (Dahl, 1996). Once formed, sulfite is obviously removed with high efficiency. Two principally different mechanisms appear to play a role here. The first is the oxidation to sulfate in the cytoplasm either by SoeABC alone or by a combination of the SoeABC/APS reductase pathways depending on the organism (Table 1). The second mechanism working in parallel to avoid any accumulation of sulfite in the cytoplasm would be transfer across the cytoplasmic membrane into the periplasm. Transporters mediating such a sulfite efflux have not yet been described for purple sulfur bacteria. Putative permeases resembling sulfite exporters of the TauE/SafE family (Pfam accession no. PF01925) (Weinitschke et al., 2007; Krejčı́k et al., 2008) are encoded in some purple sulfur bacteria including A. vinosum (Alvin_1107), but not in all genome-sequenced members of this group. Other described sulfite efflux pumps stem from fungal sources, e.g. SSU1 from Saccharomyces cerevisiae (Park & Bakalinsky, 2000; Nardi et al., 2010) or Aspergillus fumigatus (Léchenne et al., 2007). However, genes encoding closely related proteins are not present in the currently sequenced purple sulfur bacteria with the exception of Thiorhodococcus drewsii. Once sulfite anions reach the periplasm, they are possibly bound by SoxYZ just as outlined above. We considered the possibility that either the SoxY-Cyssulfinate could act as a substrate for oxidation to SoxYCys-sulfonate or sulfite could be oxidatively bound to the conserved cysteine of SoxY in a reaction catalysed by a periplasmic enzyme other than SoxXA. The membranebound trihaem cytochrome c DsrJ would be a candidate for catalysing such a reaction as it contains a putative active site similar to that of SoxXA. It has been proposed that DsrJ catalyses oxidation of a sulfur substrate and uses the released electrons for transmembrane electron transfer to a disulfide of DsrC via the other components of the DsrMKJOP complex (Grein et al., 2010a, b). However, in such a process, production of each sulfite molecule in the cytoplasm would require oxidation of exactly one molecule of sulfite in the periplasm. Sulfite oxidation in the cytoplasm would be obsolete and thus such a mechanism is discounted. It is more likely that SoxYZ acts as a ‘sulfite buffer’ again shielding periplasmic components from reaction with free sulfite (see above) and also keeping sulfite on hold for reimport into the cytoplasm. We attribute the accumulation of external sulfite in the DsoxY single mutant to the latter of the proposed functions. When the major cytoplasmic sulfite-oxidizing system is absent (SoeABC) or sulfite oxidation in the cytoplasm is no longer possible at all, as in the A. vinosum SoeABC/APS reductase double mutant, the whole system runs out of balance even in the presence of SoxYZ and free sulfite starts to accumulate outside of the cells in the medium. When cells still contain periplasmically stored zero-valent sulfur in such a situation, this sulfur is in principle accessible to abiotic attack by the strong nucleophile sulfite. Such a reaction would yield thiosulfate (Roy & Trudinger, 1970; Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Mon, 19 Jun 2017 01:13:25 2635 C. Dahl and others Suzuki, 1999). In cells with a complete Sox system, such as the DsoeAEm and the DsoeAEm aprB : : VKm mutants, thiosulfate should still to be completely degraded to sulfate. The oxidized sulfone group of thiosulfate would be released immediately by SoxB, whilst the sulfane sulfur would be hooked up again to stored sulfur, which would in turn be transformed to cytoplasmic sulfite by the Dsr proteins. Sulfite would then be transported out of the cytoplasm, leading to thiosulfate formation and the same series of reactions would restart. Finally, sulfate would be the only detectable end product. In fact, this is exactly what we observed in our experiments: degradation of stored sulfur took significantly longer in the DsoeAEm and the DsoeAEm aprB : : VKm mutants than in the WT, and the final product in all cases was sulfate. In these cultures, thiosulfate never accumulated, whilst this was clearly the case for cells that lacked SoxYZ and could thus not run a complete Sox cycle. The only transformation that thiosulfate underwent in SoxYZ-deficient cultures was oxidation to tetrathionate catalysed by a completely independent enzyme, thiosulfate dehydrogenase (Denkmann et al., 2012). In the A. vinosum triple mutant, neither sulfite nor thiosulfate could be further metabolized, leading to a very significant reduction not only of the rate of degradation, but also of formation of sulfur globules and furthermore to a complete inability of the cells to produce sulfate. Our proposal for a more general role of SoxYZ not only as a thiosulfate- but also as a sulfite-binding protein goes well along with our finding that the respective genes occur even in purple sulfur bacteria that do not contain other sox genes and have accordingly been reported not to be capable of thiosulfate utilization (Table 1). The only exception to this pattern is T. mobilis. However, T. mobilis is the only genome-sequenced purple sulfur bacterium so far that contains a gene encoding a periplasmic sulfite dehydrogenase of the SorA type. It is thus tempting to speculate that the periplasmic sulfite-binding SoxYZ is not necessary in the presence of a periplasmic sulfate-forming enzyme. Obviously, purple sulfur bacteria are equipped with different modules, and thereby means, to cope with externally available and internally generated sulfite. This work was supported by the Deutsche Forschungsgemeinschaft (grant nos DA351/4-3 and DA351/4-4). REFERENCES Bartlett, J. K. & Skoog, D. A. (1954). Colorimetric determination of elemental sulfur in hydrocarbons. Anal Chem 26, 1008–1011. Bazaral, M. & Helinski, D. R. (1968). Circular DNA forms of colicinogenic factors E1, E2 and E3 from Escherichia coli. J Mol Biol 36, 185–194. Bryantseva, I. A., Gorlenko, V. M., Kompantseva, E. I., Imhoff, J. F., Süling, J. & Mityushina, L. (1999). Thiorhodospira sibirica gen. nov., sp. nov., a new alkaliphilic purple sulfur bacterium from a Siberian soda lake. Int J Syst Bacteriol 49, 697–703. Caumette, P., Guyoneaud, R., Imhoff, J. F., Süling, J. & Gorlenko, V. (2004). Thiocapsa marina sp. nov., a novel, okenone-containing, purple sulfur bacterium isolated from brackish coastal and marine environments. Int J Syst Evol Microbiol 54, 1031–1036. D’Errico, G., Di Salle, A., La Cara, F., Rossi, M. & Cannio, R. (2006). Identification and characterization of a novel bacterial sulfite oxidase with no heme binding domain from Deinococcus radiodurans. J Bacteriol 188, 694–701. Dahl, C. (1996). Insertional gene inactivation in a phototrophic sulphur bacterium: APS-reductase-deficient mutants of Chromatium vinosum. Microbiology 142, 3363–3372. Dahl, C. (2008). Inorganic sulfur compounds as electron donors in purple sulfur bacteria. In Sulfur in Phototrophic Organisms, pp. 289–317. Edited by R. Hell, C. Dahl, D. B. Knaff & T. Leustek. Dordrecht: Springer. Dahl, C., Engels, S., Pott-Sperling, A. S., Schulte, A., Sander, J., Lübbe, Y., Deuster, O. & Brune, D. C. (2005). Novel genes of the dsr gene cluster and evidence for close interaction of Dsr proteins during sulfur oxidation in the phototrophic sulfur bacterium Allochromatium vinosum. J Bacteriol 187, 1392–1404. Denkmann, K., Grein, F., Zigann, R., Siemen, A., Bergmann, J., van Helmont, S., Nicolai, A., Pereira, I. A. C. & Dahl, C. (2012). Thiosulfate dehydrogenase: a widespread unusual acidophilic c-type cytochrome. Environ Microbiol 14, 2673–2688. Friedrich, C. G., Rother, D., Bardischewsky, F., Quentmeier, A. & Fischer, J. (2001). Oxidation of reduced inorganic sulfur compounds by bacteria: emergence of a common mechanism? Appl Environ Microbiol 67, 2873–2882. Frigaard, N.-U. & Bryant, D. A. (2008). Genomic insights into the sulfur metabolism of phototrophic green sulfur bacteria. In Sulfur Metabolism in Phototrophic Organisms, pp. 337–355. Edited by R. Hell, C. Dahl, D. B. Knaff & T. Leustek. Dordrecht: Springer. Conclusions The results presented in this study clearly show that the membrane-bound, cytoplasmically oriented iron–sulfur molybdoprotein SoeABC plays a major role in the oxidation of sulfite in the cytoplasm of A. vinosum, and very probably also in other phototrophic and chemotrophic bacteria. The periplasmic SoxYZ protein and the cytoplasmic sulfiteoxidizing enzymes are needed in parallel for effective sulfite oxidation in A. vinosum, suggesting some kind of interplay between these systems despite their localization in two different cellular compartments. While the exact function of SoxYZ in sulfite oxidation remains elusive at this point, it is tempting to speculate that it acts as a periplasmic sulfitebinding protein. 2636 ACKNOWLEDGEMENTS Frigaard, N.-U. & Dahl, C. (2008). Sulfur metabolism in phototrophic sulfur bacteria. Adv Microb Physiol 54, 103–200. Gregersen, L. H., Bryant, D. A. & Frigaard, N.-U. (2011). Mechanisms and evolution of oxidative sulfur metabolism in green sulfur bacteria. Front Microbiol 2, 116. Grein, F., Pereira, I. A. C. & Dahl, C. (2010a). Biochemical characterization of individual components of the Allochromatium vinosum DsrMKJOP transmembrane complex aids understanding of complex function in vivo. J Bacteriol 192, 6369–6377. Grein, F., Venceslau, S. S., Schneider, L., Hildebrandt, P., Todorovic, S., Pereira, I. A. C. & Dahl, C. (2010b). DsrJ, an essential part of the DsrMKJOP transmembrane complex in the purple sulfur bacterium Allochromatium vinosum, is an unusual triheme cytochrome c. Biochemistry 49, 8290–8299. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Mon, 19 Jun 2017 01:13:25 Microbiology 159 Sulfite oxidation in A. vinosum Grein, F., Ramos, A. R., Venceslau, S. S. & Pereira, I. A. C. (2013). Unifying concepts in anaerobic respiration: insights from dissimilatory sulfur metabolism. Biochim Biophys Acta 1827, 145–160. Heinzinger, N. K., Fujimoto, S. Y., Clark, M. A., Moreno, M. S. & Barrett, E. L. (1995). Sequence analysis of the phs operon in Salmonella typhimurium and the contribution of thiosulfate reduction to anaerobic energy metabolism. J Bacteriol 177, 2813–2820. Hensel, M., Hinsley, A. P., Nikolaus, T., Sawers, G. & Berks, B. C. (1999). The genetic basis of tetrathionate respiration in Salmonella typhimurium. Mol Microbiol 32, 275–287. Krejčı́k, Z., Denger, K., Weinitschke, S., Hollemeyer, K., Paces, V., Cook, A. M. & Smits, T. H. M. (2008). Sulfoacetate released during the assimilation of taurine-nitrogen by Neptuniibacter caesariensis: purification of sulfoacetaldehyde dehydrogenase. Arch Microbiol 190, 159–168. Laska, S., Lottspeich, F. & Kletzin, A. (2003). Membrane-bound hydrogenase and sulfur reductase of the hyperthermophilic and acidophilic archaeon Acidianus ambivalens. Microbiology 149, 2357–2371. Léchenne, B., Reichard, U., Zaugg, C., Fratti, M., Kunert, J., Boulat, O. & Monod, M. (2007). Sulphite efflux pumps in Aspergillus fumigatus Hensen, D., Sperling, D., Trüper, H. G., Brune, D. C. & Dahl, C. (2006). Thiosulphate oxidation in the phototrophic sulphur bac- and dermatophytes. Microbiology 153, 905–913. terium Allochromatium vinosum. Mol Microbiol 62, 794–810. plasmids in the chromosome of Lactococcus lactis. Appl Environ Microbiol 56, 2726–2735. Hipp, W. M., Pott, A. S., Thum-Schmitz, N., Faath, I., Dahl, C. & Trüper, H. G. (1997). Towards the phylogeny of APS reductases and sirohaem sulfite reductases in sulfate-reducing and sulfur-oxidizing prokaryotes. Microbiology 143, 2891–2902. Horton, R. M. (1995). PCR-mediated recombination and mutagenesis. Mol Biotechnol 3, 93–99. Imhoff, J. F. (2005a). Family I. Chromatiaceae Bavendamm 1924, Leenhouts, K. J., Kok, J. & Venema, G. (1990). Stability of integrated Lehmann, S., Johnston, A. W. B., Curson, A. R. J., Todd, J. D. & Cook, A. M. (2012). SoeABC, a novel sulfite dehydrogenase in the Roseobacters? In Programme & Abstract Book EMBO Workshop on Microbial Sulfur Metabolism, Noordwijkerhout, p. 29. Lenk, S., Moraru, C., Hahnke, S., Arnds, J., Richter, M., Kube, M., Reinhardt, R., Brinkhoff, T., Harder, J. & other authors (2012). 125AL emend. Imhoff 1984b, 339. In Bergey’s Manual of Systematic Bacteriology, pp. 3–40. Edited by D. J. Brenner, N. R. Krieg, J. T. Staley & G. M. Garrity. New York: Springer. Roseobacter clade bacteria are abundant in coastal sediments and encode a novel combination of sulfur oxidation genes. ISME J 6, 2178–2187. Imhoff, J. F. (2005b). Family II. Ectothiorhodospiraceae Imhoff Lübbe, Y. J., Youn, H.-S., Timkovich, R. & Dahl, C. (2006). 1984b, 339VP. In Bergey’s Manual of Systematic Bacteriology, pp. 41– 57. Edited by D. J. Brenner, N. R. Krieg, J. T. Staley & G. M. Garrity. New York: Springer. Siro(haem)amide in Allochromatium vinosum and relevance of DsrL and DsrN, a homolog of cobyrinic acid a,c-diamide synthase, for sulphur oxidation. FEMS Microbiol Lett 261, 194–202. Imhoff, J. F., Süling, J. & Petri, R. (1998). Phylogenetic relationships Meyer, B. & Kuever, J. (2007). Molecular analysis of the distribution among the Chromatiaceae, their taxonomic reclassification and description of the new genera Allochromatium, Halochromatium, Isochromatium, Marichromatium, Thiococcus, Thiohalocapsa, and Thermochromatium. Int J Syst Bacteriol 48, 1129–1143. Meyer, B., Imhoff, J. F. & Kuever, J. (2007). Molecular analysis of the Jormakka, M., Yokoyama, K., Yano, T., Tamakoshi, M., Akimoto, S., Shimamura, T., Curmi, P. & Iwata, S. (2008). Molecular mechanism of energy conservation in polysulfide respiration. Nat Struct Mol Biol 15, 730–737. Kappler, U. & Bailey, S. (2005). Molecular basis of intramolecular and phylogeny of dissimilatory adenosine-59-phosphosulfate reductase-encoding genes (aprBA) among sulfur-oxidizing prokaryotes. Microbiology 153, 3478–3498. distribution and phylogeny of the soxB gene among sulfur-oxidizing bacteria – evolution of the Sox sulfur oxidation enzyme system. Environ Microbiol 9, 2957–2977. Nardi, T., Corich, V., Giacomini, A. & Blondin, B. (2010). A sulphite- inducible form of the sulphite efflux gene SSU1 in a Saccharomyces cerevisiae wine yeast. Microbiology 156, 1686–1696. electron transfer in sulfite-oxidizing enzymes is revealed by high resolution structure of a heterodimeric complex of the catalytic molybdopterin subunit and a c-type cytochrome subunit. J Biol Chem 280, 24999–25007. ATP sulfurylase from Allochromatium vinosum. PLoS ONE 8, e74707. Kappler, U. & Maher, M. J. (2013). The bacterial SoxAX cytochromes. Park, H. & Bakalinsky, A. T. (2000). SSU1 mediates sulphite efflux in Parey, K., Demmer, U., Warkentin, E., Wynen, A., Ermler, U. & Dahl, C. (2013). Structural, biochemical and genetic characterization of Cell Mol Life Sci 70, 977–992. Saccharomyces cerevisiae. Yeast 16, 881–888. Kappler, U., Bennett, B., Rethmeier, J., Schwarz, G., Deutzmann, R., McEwan, A. G. & Dahl, C. (2000). Sulfite : cytochrome c oxido- Pattaragulwanit, K. & Dahl, C. (1995). Development of a genetic reductase from Thiobacillus novellus. Purification, characterization, and molecular biology of a heterodimeric member of the sulfite oxidase family. J Biol Chem 275, 13202–13212. Kelly, D. P., Chambers, L. A. & Trudinger, P. A. (1969). Cyanolysis and spectrophotometric estimation of trithionate in mixture with thiosulfate and tetrathionate. Anal Chem 41, 898–901. Kisker, C., Schindelin, H., Baas, D., Rétey, J., Meckenstock, R. U. & Kroneck, P. M. (1998). A structural comparison of molybdenum cofactor-containing enzymes. FEMS Microbiol Rev 22, 503–521. Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson, G. T., Farris, M. A., Roop, R. M., II & Peterson, K. M. (1995). Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166, 175–176. Krafft, T., Bokranz, M., Klimmek, O., Schröder, I., Fahrenholz, F., Kojro, E. & Kröger, A. (1992). Cloning and nucleotide sequence of the psrA gene of Wolinella succinogenes polysulphide reductase. Eur J Biochem 206, 503–510. http://mic.sgmjournals.org system for a purple sulfur bacterium: conjugative plasmid transfer in Chromatium vinosum. Arch Microbiol 164, 217–222. Pattaragulwanit, K., Brune, D. C., Trüper, H. G. & Dahl, C. (1998). Molecular genetic evidence for extracytoplasmic localization of sulfur globules in Chromatium vinosum. Arch Microbiol 169, 434–444. Pfennig, N. & Trüper, H. G. (1992). The family Chromatiaceae. In The Prokaryotes. A Handbook on the Biology of Bacteria: Ecophysiology, Isolation, Identification, Applications, pp. 3200–3221. Edited by A. Balows, H. G. Trüper, M. Dworkin, W. Harder & K.-H. Schleifer. New York: Springer. Pott, A. S. & Dahl, C. (1998). Sirohaem sulfite reductase and other proteins encoded by genes at the dsr locus of Chromatium vinosum are involved in the oxidation of intracellular sulfur. Microbiology 144, 1881–1894. Prange, A., Engelhardt, H., Trüper, H. G. & Dahl, C. (2004). The role of the sulfur globule proteins of Allochromatium vinosum: mutagenesis of the sulfur globule protein genes and expression studies by realtime RT-PCR. Arch Microbiol 182, 165–174. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Mon, 19 Jun 2017 01:13:25 2637 C. Dahl and others Ramos, A. R., Keller, K. L., Wall, J. D. & Pereira, I. A. C. (2012). The Simon, J. & Kern, M. (2008). Quinone-reactive proteins devoid of membrane QmoABC complex interacts directly with the dissimilatory adenosine 59-phosphosulfate reductase in sulfate reducing bacteria. Front Microbiol 3, 137. haem b form widespread membrane-bound electron transport modules in bacterial respiration. Biochem Soc Trans 36, 1011–1016. Simon, J. & Kroneck, P. M. (2013). Microbial sulfite respiration. Adv Reinartz, M., Tschäpe, J., Brüser, T., Trüper, H. G. & Dahl, C. (1998). Microb Physiol 62, 45–117. Sulfide oxidation in the phototrophic sulfur bacterium Chromatium vinosum. Arch Microbiol 170, 59–68. Simon, R., Priefer, U. & Pühler, A. (1983). A broad host range Rethmeier, J., Rabenstein, A., Langer, M. & Fischer, U. (1997). Detection of traces of oxidized and reduced sulfur compounds in small samples by combination of different high- performance liquid chromatography methods. J Chromatogr A 760, 295–302. Rodriguez, J., Hiras, J. & Hanson, T. E. (2011). Sulfite oxidation in Chlorobaculum tepidum. Front Microbiol 2, 112. mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Biotechnology (N Y) 1, 784– 791. Steudel, R. & Steudel, Y. (2010). Derivatives of cysteine related to the thiosulfate metabolism of sulfur bacteria by the multi-enzyme complex ‘‘Sox’’ studied by B3LYP-PCM and G3X(MP2) calculations. Phys Chem Chem Phys 12, 630–644. Rother, D., Henrich, H. J., Quentmeier, A., Bardischewsky, F. & Friedrich, C. G. (2001). Novel genes of the sox gene cluster, Suzuki, I. (1999). Oxidation of inorganic sulfur compounds: chemical mutagenesis of the flavoprotein SoxF, and evidence for a general sulfur-oxidizing system in Paracoccus pantotrophus GB17. J Bacteriol 183, 4499–4508. Weaver, P. F., Wall, J. D. & Gest, H. (1975). Characterization of Roy, A. B. & Trudinger, P. A. (1970). The Biochemistry of Inorganic DUF81 protein TauE in Cupriavidus necator H16, a sulfite exporter in the metabolism of C2 sulfonates. Microbiology 153, 3055–3060. Compounds of Sulfur. London: Cambridge University Press. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Sánchez, O., Ferrera, I., Dahl, C. & Mas, J. (2001). In vivo role of adenosine-59-phosphosulfate reductase in the purple sulfur bacterium Allochromatium vinosum. Arch Microbiol 176, 301–305. Sander, J., Engels-Schwarzlose, S. & Dahl, C. (2006). Importance of the DsrMKJOP complex for sulfur oxidation in Allochromatium vinosum and phylogenetic analysis of related complexes in other prokaryotes. Arch Microbiol 186, 357–366. Sauvé, V., Bruno, S., Berks, B. C. & Hemmings, A. M. (2007). The SoxYZ complex carries sulfur cycle intermediates on a peptide swinging arm. J Biol Chem 282, 23194–23204. Schäfer, A., Tauch, A., Jäger, W., Kalinowski, J., Thierbach, G. & Pühler, A. (1994). Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145, 69–73. 2638 and enzymatic reactions. Can J Microbiol 45, 97–105. Rhodopseudomonas capsulata. Arch Microbiol 105, 207–216. Weinitschke, S., Denger, K., Cook, A. M. & Smits, T. H. M. (2007). The Weissgerber, T., Zigann, R., Bruce, D., Chang, Y.-J., Detter, J. C., Han, C., Hauser, L., Jeffries, C. D., Land, M. & other authors (2011). Complete genome sequence of Allochromatium vinosum DSM 180(T). Stand Genomic Sci 5, 311–330. Weissgerber, T., Dobler, N., Polen, T., Latus, J., Stockdreher, Y. & Dahl, C. (2013). Genome-wide transcriptional profiling of the purple sulfur bacterium Allochromatium vinosum DSM 180T during growth on different reduced sulfur compounds. J Bacteriol 195, 4231–4245. Welte, C., Hafner, S., Krätzer, C., Quentmeier, A. T., Friedrich, C. G. & Dahl, C. (2009). Interaction between Sox proteins of two physio- logically distinct bacteria and a new protein involved in thiosulfate oxidation. FEBS Lett 583, 1281–1286. Wilson, J. J. & Kappler, U. (2009). Sulfite oxidation in Sinorhizobium meliloti. Biochim Biophys Acta 1787, 1516–1525. Zaar, A., Fuchs, G., Golecki, J. R. & Overmann, J. (2003). A new purple sulfur bacterium isolated from a littoral microbial mat, Thiorhodococcus drewsii sp. nov. Arch Microbiol 179, 174–183. Edited by: D. Kelly Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Mon, 19 Jun 2017 01:13:25 Microbiology 159