Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
www.sakshieducation.com EAMCET Botany Model Test 1. 2. 3. 4. 5. [A]: Fungi have nitrogen containing cell wall material [R]: Cell wall of heterotrophic thallophytes has polymer made of nucleosides 1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A *3) A is true but R is false 4) A is false but R is true Study the following table and choose the correct combination Feature 1 Feature 2 Plant group I) Cryptogams Gametophytes can form asexual Sporophyte can also produce spores spores II) Algae Gametophyte cannot form spores Sporophyte can form spores III) Fungi Cannot trap light energy Do not have vacuoles. IV) Bryophytes Have sporophyte parasite on Gametophyte is independent gametophyte *1) I and IV 2) II and IV 3) I and III 4) I and II Study the following lists and match correctly List – I List – II A B C I I) Kills caterpillars A) LAB 1) II IV II) Vit.B12 II B) Flemming 2) IV V III) Uranium extraction C) Waksman 3) II IV V IV) Penicillin D) Bt. *4) II IV V V) Streptomyces grieseus D III I III I [A]: Iodine used during Gram’s staining [R]: It stains Gram negative but not gram positive bacteria 1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A *3) A is true but R is false 4) A is false but R is true Choose the incorrect statement. 1) Thickness of glycocalyx varies from species to species *2) In a given species of bacterium all bacteria cells either possess glycocalyx or lack glycocalyx 3) All bacteria have nucleoid 4) Cocci do not have flagella 6. [A]: Cells of E.coli do not divide [R]: The symbiotic bacterium of human intestine has no mesosomes 1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A 3) A is true but R is false *4) A is false but R is true 7. The amino acid and Micronutrient required for auxin synthesis are 1) Phenyl Alanine, Mn 8. 2) Tryptophan, Mo *3) Tryptophan, Zn 4) Tyrosine, Mg Arrange the following events of Gibberellin influenced seed germination in a sequence. I. Formation of Sugars II. α-amylase synthesis III. Energy liberation IV. Gibberellin synthesis 1) II, IV, I, III 2) IV, I, II, III *3) IV, II, I, III 4) I, II, IV, III 9. [A]: ABA is a growth inhibitor [R]: It inhibits the formation of seedlings from seeds *1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A 3) A is true but R is false 4) A is false but R is true 10. Choose the incorrect pair 1) Potato crop – Stress hormone 2) Pine Apple - Ethephon *3) Ethylene - Skoog 4) Dormancy hormone - Waring 11. C40H56O2 is involved in the synthesis of *1) Senescence hormone 2) Fruit ripening hormone www.sakshieducation.com www.sakshieducation.com 3) Richmond-Lang effect hormone 4) Bolting hormone 12. Read the following lists and choose the correct match List – I List – II Parasitic in cells having I) A) Virus with ssDNA 1) peptidoglycan cell wall Forms irregularly shape and sized B) Plant virus with dsDNA II) chloretic areas on leaf of plant with 2) 2n = 48 Causes disease in plant with C) Plant virus with dsRNA III) compound corymb and parietal *3) placentation Causes stunting in plants with D) Plant virus with ssRNA IV) 4) caryopsis fruit. Forms malformation in plants with V) hesperidium fruit 13. [A]: Triticum aestivum is naturally formed polyploid [R]: Polyploids are common in Poaceae 1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A 3) A is true but R is false *4) A is false but R is true 14. Crop variety that shows anti-ethylene influence is 1) Roundup ready *2) Flavr-Savr 3) Taipei A B C D II III IV V I II IV V I III IV II I V IV II 4) Transgenic papaya 15. Study the following lists and choose the correct match List – I List – II A I) Pure line selection A) Pusa Moti 1) IV II) Polyploidy breeding B) Kufri safed 2) V III) Clonal selection C) Aruna 3) III IV) Mutational breeding D) Bread wheat *4) V V) Mass selection 16. During stomatal opening of Photoactive plants, the decrease in water potential of B III III IV III C V IV V IV D I I II II guard cells is due to 1) Passive movement of H+ into guard cells 2) Active movement of Cl- into guard cells 3) Active movement of K+ into guard cells *4) Active movement of H+ into subsidiary cells 17. If the number of ATP used for the production of 6 hexoses in dark reaction of Maize is equal to the number of ATP used during carbon assimilation in the dark reaction of Chlorella for the production of ‘n’ number of hexoses, then ‘n’ is 1) 12 *2) 10 3) 6 4) 18 18. The following reaction is catalyzed by a protein in mitochondrial matrix but the reaction is not an integral part of Tricarboxylic acid cycle. 1) Conversion of Phosphoenol pyruvic acid to Pyruvic acid *2) Oxidative decarboxylation of Pyruvic acid 3) Oxidative decarboxylation of Oxalo Succinic acid 4) Oxidation of Succinic acid. 19. Genetic code for serine is degenerate, because the codons for Serine are I. UCG II. CGU III. GCU IV. AGU 1) II, III *2) I, IV 3) I, III 4) I, II, III 20. Study the following table showing the components of water potential during day time in linearly arranged mesophyll cells P, Q, R, and S from xylem towards substomatal chamber. Arrange them in a sequence of nearest to farthest to sub-stomatal chamber. Cell Osmotic potential (MPa) Pressure potential (MPa) www.sakshieducation.com www.sakshieducation.com -0.31 0.031 -0.50 0.40 -0.44 0.23 -0.25 0.10 1) Q,P,R,S *2) P, R, S, Q 3) Q, R, P, S4) Q, S, R, P 21. [A]: Calcium is an essential element in Plant Nutrition [R]: Calcium plays an important role in mitosis *1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A 3) A is true but R is false 4) A is false but R is true 22. Choose the pair of physiological effects of two phytohormones that are synthesized from P Q R S connecting link of Glycolysis and Kreb’s cycle. I. Promotion of seed germination II. Inhibition of seed germination III. Promotion of Apical dominance IV. Promotion of Stomatal opening *1) I, II 3) I, III 2) III, IV 4) II, IV 23. Arrange the following with respect to the correct order of formation of the following sugar phosphates in Calvin cycle. I. Glyceraldehyde phosphate II. Ribulose monophosphate III. Xylulose monophosphate IV. Fructose monophosphate 1) I, IV, II, III 2) IV, I, III, II 2) Energy conservation site of respiratory electron transport chain is I. Complex I II. Complex II III. Complex III IV. Complex IV 1) I, II 2) II, III, IV 3) III and IV *4) I, III, IV *3) I, IV, III, II 4) I, III, IV, II 24. [A]: Citric acid cycle is an oxidation pathway [R]: C-C bonds are not formed during TCA cycle 1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A *3) A is true but R is false 4) A is false but R is true 25. This intermediate of Glycolysis, which is CO2 acceptor in C4 plants is formed by the catalytic activity of 1) Mutase 2) Kinase *3) Enolase 4) Dehydrogenase 26. Study the following table with respect to C2 cycle and choose the correct combinations Chloroplast Peroxisome Mitochondrion I) O2 is utilized O2 is generated NH4+ is released II) ATP are utilized O2 is utilized NADPH are generated III) CO2 is utilized H2O2 is liberated CO2 is liberated IV) NADPH are produced NADPH are used Glycine is formed 1) II, III 2) I, IV *3) I, II 4) III, IV 27. [A]: Calvin Benson cycle is also called as Reductive Pentose Phosphate cycle [R]: In C3 cycle the oxidation state of Carbon of CO2 is reduced to zero or one or two. *1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A 3) A is true but R is false 4) A is false but R is true 28. Xylulose-5-phosphate formed in C3 cycle has the carbon atoms directly obtained from I. Glyceraldehyde-3-phosphate II. Fructose-6-phosphate III. Sedohaptulose-7-phosphate IV. Dihydroxyacetone phosphate 1) I, II 3) II,III, IV 2) II, III *4) I, II, III 29. [A]: Light harvesting complex is involved in Photochemical reaction. [R]: Light harvesting complex pigments transfer the absorbed light energy to reaction centre www.sakshieducation.com www.sakshieducation.com 1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A 3) A is true but R is false *4) A is false but R is true 30. [A]: Grana thylakoids have more PS II than PS I [R]: Granum has more oppressed region than non-oppressed region *1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A 3) A is true but R is false 4) A is false but R is true 31. [A]: Q cycle helps in transport of more protons than electrons [R]: During photosynthetic electron transport, out of two electrons accepted by PQ, one is transported linearly and the remaining one is carried in cyclic manner via Cytochrome b6. *1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A 3) A is true but R is false 4) A is false but R is true 32. From the following explanations, identify the correct ones with respect to respiration of an obligate aerobe which is provided one molecule of Glucose and one molecule of Oxygen. I. The net gain of ATP is 6 II. Krebs cycle does not occur III. Electron transport system is not operated IV. Respiration comes to an end with the formation of Pyruvic acid 1) I, II 2) II, III, IV 3) I, II, IV 4) III, IV 33. Study the following with respect to inner membrane of Mitochondrion and choose the correct groups. Component Function 1 Function 2 + I) Complex I Transfers H from matrix to Reduces UQ perimitochondrial space II) Complex II Involved in ETS and Krebs cycle Reduces Co.Q III) Complex III Has Cytochrome C1 Can directly reduce O2 IV) Complex IV Has no Fe-S centers For each e- transfer removes 4 H+ from matrix 1) II, III *2) I, II 3) I, IV 4) II, IV 34. Arrange the following components of ETS in a sequence with respect to their first involvement during aerobic breakdown of a molecule of Glucose. A. Complex I B. Complex II E. Cytochrome C F. Complex IV 1) A, B, C, D, E, F 2) B, C, D, E, F, A C. UQ D. Complex III *3) C, D, E, F, A, B 4) C, D, E, F, B, A 35. During Aerobic oxidation a molecule of Glucose, after removal of how many protons of the matrix of mitochondrion, there is involvement of Complex II. 1) 72 2) 80 3) 104 *4) 88 36. Arrange the following respiratory substrates in an order of gradual increase in the number of Oxygen atoms consumed during oxidation of each its molecules. I. Oleic acid II. Tartaric acid III. Malic acid IV. Tripalmitin 1) II, III, IV, I 2) III, II, I, IV 3) III, II, IV, I *4) II, III, I, IV 37. The sequence of bases in the coding region of mRNA of E.coli is 5' AUGUGUAGCUUUUGA 3'. If its translation is started with reading frame having GUG, the following events of translation do not occur for the translation of the given mRNA. I. Activation of amino acids II. Chain initiation III. Involvement of Releasing factors IV. Chain elongation 1) II, IV *3) Only IV 2) I, III, IV 4) All 38. Arrange the involvement of following parts of initiator tRNA in correct sequence during translation. I. Anticodon arm II. Acceptor arm III. DHU arm IV. Ribosome recognition arm 1) II, I, III, IV 2) II, III, I, IV *3) III, II, I, IV www.sakshieducation.com 4) II, IV, III, I www.sakshieducation.com 39. Choose the correct statements with respect to biological nitrogen fixation. I. Both component I and Component II of nitrogenase have Mo. - + II. Nitrogenase accepts both e and H from Ferredoxin. III. Pyruvic acid supplies both e- and H+ for the reduction of N2. IV. 2 ATP are utilized for the transfer of an electron from Pyruvic acid to N2. 1) I, III 2) II, III *3) III, IV 4) II, IV 40. The following stage of nitrogen cycle can not be completed with the involvement of only one species. 1) Nitrogen fixation 2) Ammonification *3) Nitrification 4) Denitrification 41. Match the following List – I Anoxygenic host associated A) with oxygenic diazotroph Haploid oxygenic host B) associated with oxygenic diazotroph Diploid oxygenic host C) associated with oxygenic diazotroph List – II A B C D I) Anthoceros 1) V I IV III II) Parasponia 2) II I IV V 3) V II IV I *4) V I IV II B V V III II C I IV II I D II II V IV III) Solanum Diploid oxygenic host D) associated with anoxygenic IV) Azolla diazotroph V) Basidiomycete 42. Choose the incorrect statement *1) All amino acids involved in protein synthesis are indicated by more than one codon. 2) 3 codons of genetic code do not indicate any amino acid 3) Initiating codons are sense codons. 4) Serine is indicated by six codons 43. Study the following with respect to nitrogen cycle and identify the correct math List – I A) B) C) D) List – II N2 → 2NH3 RCHNH2COOH → NH3 NH3 → NO2 NO3 → N2 I) II) III) IV) V) Nitrosomonas Micrococcus Clostridium Nitrobacter *1) 2) 3) 4) A III III IV III Bacillus 44. Study the following table with respect to structures of Symbiotic Biological nitrogen fixation and choose the correct combinations Microsymbiont I) Rhizobium II) Frankia III) Nostoc IV) Anabaena Host character 1 Anterior odd petal Whorled phyllotaxy Sporophyte parasitic on gametophyte Free floating hydrophyte Host character 2 Marginal placentation Sorosis Atracheate Sessile archegonia 1) All except IV 2) All *3) All except I 4) II and III only 45. If the coding region of mRNA has 600 nucleotides, the number of tRNA molecules that can bind to A-site of ribosome during translation is 1) 200 2) 199 *3) 198 4) 598 46. Codons that can not be recognized by tRNA are recognized by 1) rRNA 2) IF3 3) EFT *4) RF2 47. Arrange the involvement of the following in correct sequence during translation for the formation of a polypeptide chain. I. RF3 II. IF2 V. RF1 VI. IF1 III. EFG www.sakshieducation.com IV. IF3 www.sakshieducation.com 1) VI, II, IV, III, V, I *2) IV, VI, II, III, V, I 3) IV, II, VI, III, V, I 4) IV, VI, II, III, I, V 48. If a mRNA has information for the formation of protein as 5' AUGUUUUCAAGUUCGGGGUAA 3', the amino acid with free –COOH group in the formed protein must be 1) Serine 2) Phenyl Alanine 3) Methionine *4) Glycine 49. If the number of translocations during the formation of a polypeptide chain on a ribosome is 200, the total number of GTP utilized during translation is 1) 399 2) 199 3) 201 *4) 401 50. Study the following table and choose the correct combination Substrate/s I) Oxaloacetate, Aectyl Co.A II) Succinyl Co.A, ADP III) Fumaric acid IV) Citric acid Enzyme Citrate synthetase Product/s Citric acid, Co.A Thiokinase Succinic acid, ATP, Co.A Fumarase Aconitase Malic acid Cis-aconitic aicid From the above identify the correct sets that utilize H2O in their respective reactions. 1) I, II 2) III, IV 3) II, III, IV *4) I, II, III 51. Identify the respiratory substrates whose RQ in aerobic respiration is equivalent to Glucose I. Pyruvic acid II. Glyceraldehyde-3-phosphate III. Acetyl Co.A IV. 1,3 bisphospho glyceric acid 1) I, II *2) II, III 3) only II 4) III, IV 52. Morphologically similar Parenchyma cells A, B, C and D are kept respectively in solution P having 1% Sucrose, Q with 2% sucrose solution, R with 3% sucrose solution and S with 4% sucrose solution. Cell D has shown withdrawal of plasma membrane at the corners and the other cells have not shown any such signs. Choose the correct statements among the following. I. Cell A is isotonic to solution P II. Cell B is isotonic to solution Q III. Cell C is isotonic to solution R IV. Cell D is hypotonic to solution S 1) All except IV 2) All except III *3) All except I and II 4) All except III and IV 53. Match the following List – I List – II A) A virus is a virus Disproved the theory of B) spontaneous generation C) Viruses as Nucleoproteins I) Stanley II) Gierer III) L. Pasteur 1) A IV B V C II D I 2) IV III V I 3) V IV I II V II Nucleic acid as infectious III IV) A. Lwoff *4) IV agent V) Pierie 54. Match the following with respect to TMV particle List – I List – II A B C I) 6,500 V II A) No. of capsomers 1) IV IV I II) 300 B) No. of nucleotides 2) V I V III) 3000 C) No. of aminoacids in capsomere 3) IV I V IV) 2130 D) Length in Angstroms *4) IV V) 158 55. Arrange the role of following structures of T4 bacteriophage during its replication D) I. Lysozyme II. Tail fibres III. DNA IV. Tail sheath 1) II, IV, I, III *2) II, I, IV, III 3) I, II, IV, III 4) II, IV, III, I D III II II III 56. If a Spirogyra free floating filament with 20 cells is broken into pieces with each fragment consisting of 5 cells, how many mitotic divisions have to occur to form daughter filaments with each filament having same number of cells as that of parental filament www.sakshieducation.com www.sakshieducation.com 1) 76 *2) 60 3) 40 4) 80 57. A, B, C and D are the mycelia of a species of Rhizopus. Zygospore formation is seen when A is grown along with D. Zygospore formation is noticed when B is grown along with C. When C is with D no such zygospore formatin is noticed. With respect to this information choose the correct statements. I. Zygospores can be formed when C is grown with A. II. Zygophore formation can be noticed when B is grown with D. III. Zygospores are not formed when B is grown with A. IV. A and C belong to one type of strain and C and D belong to another type of strain. *1) All except IV 2) All except III 3) only I and II are correct 4) II and IV are correct 58. Choose the wrong statements 1) A sporophyll of Pteris longifolia has 50 sori. 2) A sporophyll of Pteris vittata has 54 sori 3) Number of sori of Pteris sporophyll is equivalent to number of false indusia *4) A unipinnate sporophyll of Pteris has 52 sori. 59. [A]: Bulbils of Cycas are adventitious buds [R]: Vegetatively propagating structures of Cycas are formed on woody portions of its stem. *1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A 3) A is true but R is false 4) A is false but R is true 60. Identify the pairs of cells formed simultaneously during the development of Cycas male gametophyte I. Tube cell – Antheridial cell II. Body cell – Male gamete III. Stalk cell – Body cell IV. Prothallial cell – Antheridial cell 1) I and III 2) II and IV *3) I and IV 4) III and IV 61. Lock and Key model explains the following property of Enzymes 1) Activity in minute quantity *2) Specificity 3) Reversibility 4) Thermolability 62. Arrange the following events of Secondary active transport mediated by Symporter in correct sequence. + I. Neither H binding site nor the ‘S’ binding sites of the symporter exposed towards the solution of outside of plasma membrane. II. ‘S’ binding site of the Symporter neither exposed towards the solution of outside nor cytoplasmic side of plasma membrane. + III. Both H binding site and the ‘S’ binding site are exposed towards solution of outside of Plasma membrane. IV. Release of H+ and ‘S’ into symplast. 1) I, II, III, IV 2) III, II, I, IV *3) II, III, I, IV 4) II, I, III, IV 63. If the Stomatal Index of lower surface of Solanum leaf with 960 epidermal cells in mm2 area is 1/25, how many guard cells are present in that area. 1) 40 2) 20 *3) 80 4) 160 64. Study the following table and choose the correct combinations Type of Biofertiliser I) Azolla pinnata II) Glomus III) Azospirillum IV) Rhizobium Crop in which it is applied Paddy Significance Reduces the heavy metal levels in the crop plants Improves the pest tolerance of the crop Provides Growth hormones to crop Potato Wheat Soybean Improves tolerance to water stress in the crop 1) I and II 2) III and IV *3) II and III 4) III and IV 65. If a C3 plant Rubisco enzyme is involved in adding 6 CO2 to RuBP and later 6 O2 to another 6 RuBP in the same chloroplast, the ratio between the carbon atoms fixed to carbon atoms lost in the cell is www.sakshieducation.com www.sakshieducation.com 1) 1:1 2) 4:3 3) 3:2 *4) 2:1 66. [A]: In Photosynthesis, the absorbed VIBYO of visible spectrum is used in the form of red photons. [R]: The reaction centres of Photosytems II and I respectively have P680 and P700. *1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A 3) A is true but R is false 4) A is false but R is true 67. Choose the correct statement 1) Plantlets can not be produced in tissue culture without embryogenesis *2) Plantlets can not be produced in tissue culture without organogenesis 3) Plantlets can not be produced in tissue culture without callus formation 4) Plantlets can not be produced in tissue culture without embryogenesis and callus formation 68. The principle of sterilization is applied during I. Nutrient medium preparation II. Preparation of Explant III. Inoculation of explant 1) I and III IV. Acclimatisation 2) II and IV 3) I and IV *4) II and III 69. [A]: Plants obtained through tissue culture should be acclimatized [R]: Plants developed in tissue culture method fail to develop cuticle of required thickness to survive in natural conditions *1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A 3) A is true but R is false 4) A is false but R is true 70. Match the following List – I A) Proteomics B) Bioremediation List – II I) Parentage disputes II) Minimising pollutants Application of information science III) for the study of Polypeptides IV) Usage of microbes as fertilizers C) Genomics D) DNA finger printing *1) 2) A III IV B II II C V V D I I 3) III IV II V 4) III V I II Computer based study of single set V) of chromosomes 71. Labeled single stranded DNA is called as 1) C-DNA 2) Satellite DNA *3) Probe DNA 4) Phasmid 72. [A]: Genetic engineering is based on the principle of crossing over [R]: Endonucleases and ligases are used in rDNA technology *1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A 3) A is true but R is false 4) A is false but R is true 73. The sequence of nitrogen bases (Nucleotides) of a DNA strand at its restriction site is identified from 5'→ 3' as “ 1G2C3T4A”. With respect to this match the following and identify the correct match. List – I List – II A) 1 I) A II) C III) T IV) G V) G B) 3 C) 2 D) 4 1) A III B V C II D IV 2) *3) 4) IV III III III IV V II I II I II I A B C D 74. Match the following with respect to Mushroom cultivation List – I Inocubation for A) production List – II Spawn I) 8 days 1) V III I II II) 20 days 2) IV V II I III) 80 days D) Interval between successive IV) 2 days *3) V IV II I 4) V IV III II Sterilisation compost C) Spawning B) of prepared www.sakshieducation.com www.sakshieducation.com flushes V) 15 days 75. Arrange the following events in correct sequence during Mushroom production. I. Harvesting Flushes II. Usage of Spawn III. Usage of Rice bran 0 IV. Maintainnace of 16 C temperature in production room *1) III, II, IV, I 2) III, IV, II, I 3) II, III, IV, I 4) I, IV, II, III 76. Study the following table and choose the correct combination SCP organism I) Scenedesmus II) Paecilomyces III) Chaetomium IV) Brevibacterium Plant Group Algae Demerit Low cell density Bacterium Fungus Bacterium High RNA content Slow growth rate Poor in Methionine *1) I, III 2) II, IV 3) I, II 77. Study the following table and choose the correct combination SCP organism I) Scenedesmus II) Paecilomyces III) Chaetomium IV) Brevibacterium 4) III, IV Plant Group Algae Bacterium Demerit Low cell density High RNA content Fungus Bacterium Slow growth rate Poor in Methionine *1) I, III 2) II, IV 3) I, II 78. Varieties developed by the following methods are always heterozygous 4) III, IV I. Mass selection II. Pureline selection III. Clonal selection 1) I and II 2) II and III *3) I and III 4) I, II, III 79. Study the following table and choose the correct combination Crop I) II) III) IV) Paddy Bajra Cotton Mango Method used for development Pureline selection Mass selection Mass selection Clonal selection 1) I and II 2) III and IV 80. Match the following with respect to Hybridisation List – I A) Selfing in Parent B) Emasculation C) Bagging D) Selfing in F1 plants Variety developed IR-8 Pusa Moti Dodahatti Local Kufri Safed *3) II and III 4) I and IV List – II I) To select the desirable hybrids II) To avoid self pollination III) To develop homozygosity IV) Artificial cross pollination V) To avoid unwanted cross pollination 1) A III B II C I D V 2) 3) *4) III II III II III II V IV V IV I I 81. [A]: Agar Agar is used in making semisolid media [R]: It provides required carbohydrates to the explant in tissue culture. 1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A *3) A is true but R is false 4) A is false but R is true 82. One of the following is first to induce test tube fertilization in Plants. 1) M.O. P. Iyengar *2) P.C.Maheswari 3) Birbal Sahni 4) Nawaschin 83. Match the following List – I List – II Gametophyte parasitic on I) Fire Moss A) sporophyte of another species A gametophyte possesses B) gametophyte of another species as II) Pyricularia symbiont Sporophyte of a species parasitic III) Chlorella C) on sporophyte of another species www.sakshieducation.com A B C D 1) II V IV I *2) II IV V I 3) III IV V II www.sakshieducation.com Sporophyte of a species parasitic D) on the gametophyte of the same IV) Anthoceros species V) Orobanche 84. Modified aerial adventitious roots are seen in 4) II III I V I. Asparagus II. Tinospora III. Jussiaea IV. Striga 1) I and II 2) II and III 3) III and IV 4) I and IV 85. Functional modified roots eventually become functionless in 1) Taeniophyllum 2) Avicennia 3) Vanda *4) Santalum 86. Choose the correct statement *1) Phylloclades have modified leaves 2) In Asparagus assimilatory branches arise in the axil of spines 3) A sucker has adventitious roots at every node 4) Offsets are horizontally growing axillary branches seen only in hydrophytes 87. Arrange the following plants in sequence of their modified stems showing positive geotropism to negative geotropism. I. Amorphophallus II. Helianthus tuberosus III. Lippia nodiflora IV. Chrysanthemum 1) III, II, IV, I 2) II, III, I, IV *3) II, III, IV, I 4) III, IV, I, II *3) Acacia 4) Coriandrum 88. Primary rachis lacks leaflets in 1) Tamarindus 2) Moringa 89. Arrange the following plants with gradual increase in the number of leaflets per leaf. I. Clematis II. Hardwickia III. Pisum IV. Aegle *1) II, IV, I, III 2) II, I, IV, III 3) I, II, III, IV 4) II, III, I, IV 90. Opening of flowers is neither centripetal nor centrifugal in 1) Coriandrum 2) Chrysanthemum 3) Jasminum *4) Ficus 91. Study the following table and choose the correct combination Plant Leaf character Inflorescence character I) Yucca Spinous leaf Compound cyme II) Gynandropsis Pentafoliate compound Simple corymb leaf III) Coriandrum Decompound leaf Involucreated IV) Acalypha Leaf mosaic Simple spike 1) I and II *2) II and III 3) III and IV 4) II and IV 92. [A]: Self pollination is absent in Vanda [R]: Orchidaceae plants are self incompatible 1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A 3) A is true but R is false *4) A is false but R is true 93. Choose the plants in which 5 margins of their perianth lobes of a cycle are overlapped in their aestivation. I. Calyx of Hibiscus II. Corolla of Datura III. Corolla of Crotalaria IV. Calyx of Catheranthus 1) I, II 2) III, IV 3) I, III *4) II, IV 3) Brassica 4) Cucurbita 94. Unilocular ovary with axile placentation is seen in *1) Capsicum 2) Dianthus www.sakshieducation.com www.sakshieducation.com 95. If complete megaspore mother cell transforms into an embryosac, the ratio between the number of meiotic and mitotic spindles is 1) 3:7 2) 4:3 *3) 3:4 4) 2:7 96. Mesocotyl is 1) Region of tigellum where cotyledon is inserted *2) Region of tigellum between insertion of cotyledon and point of origin of coleoptyle 3) Region of tigellum between the point of origin of coleoptyle and coleorhiza 4) Region between plumule and cotyledonary node 97. Flowers of Kigelia are pollinated by 1) Bird 2) Insect *3) Mammal 4) Snail 98. Vienna code – 2006 was the outcome of 1) XVI International Botanical cogress *2) XVII International Botanical congress 3) XVIII International Botanical cogress 4) XIX International Botanical cogress 99. Match the following List – I A) Charak I) B) Susruta II) C) Linnaeus III) D) Theopharstus IV) V) List – II Classified plants on the basis of Habit Classifed Plant kingdom into 50 groups Classified plants on the basis of habitat Classifed plant kingdom into 87 orders Classified medicinal plants into 37 sections A B C D *1) II V IV I 2) II IV V I 3) III V IV II 4) V I IV II 100. Stellate epidermal hairs are seen in 1) Ruscus 2) Lycopersicon 3) Abrus *4) Gossypium 101. [A]: Alae have posterior margin outside and anterior margin inside [R]: Wing petals are overlapped by Vexillum 1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A 3) A is true but R is false *4) A is false but R is true 102. The following plant has both tricyclic and tetracyclic flowers 1) Datura *2) Smilax 3) Tephrosia 4) Thespesia *2) Middle lamellum 3) Primary wall 4) Secondary wall 3) Glyoxysome *4) Ribosome 103. Torus is a part of 1) Nuclear envelope 104. Lipidless cell organelle is 1) Mitochondrion 2) Peroxisome 105. [A]: mRNA is devoid of intramolecular hydrogen bonding. [R]: It does not form hydrogen bonds with other nucleic acids. 1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A *3) A is true but R is false 4) A is false but R is true 106. Collenchyma with intercellular spaces is seen in 1) Datura 2) Helianthus 3) Cucurbita *4) Leucas 107. Vessels with very high amount of Lignin show 1) Scalariform thickenings 2) Reticulate thickenings 3) Spiral thickenings *4) Pitted thicken www.sakshieducation.com www.sakshieducation.com 108. Coenocytes are 1) Cells of epitherm 2) Epithelial cells of secretory tissue *3) Latex cells 4) Cells of nectaries 109. A cross is made between F1 hybrid of Pisum sativum dihybrid cross and a plant with Yy rr genotype. Match the following genotypes or phenotypes of the offspring of the resultant cross with the respective probabilities. List – I List – II A B C D I V II I) 3/8 A) Yy rr 1) IV V III II) 1/8 B) Yellow wrinkled seeds 2) IV II I II III III) Zero *3) IV C) Green wrinkled seeds I II V IV) ¼ D) YY RR 4) III V) ½ 110. Study the following table and choose the correct combination Scientist Contribution 1 Contribution 2 I) Linnaeus Proposed the taxon Classification rules order II) Bauhin Binomial Description of 6000 nomenclature plants III) De Candolle Natural system of Symmetry of flower classification IV) H.G. Khorana Artificial synthesis Deciphering Genetic of gene code 1) All except I 2) All except II *3) All except III 4) All 111. A phanerogam whose roots are externally in symbiotic association with a bacterium and internally in symbiotic association with a fungus and maintains parasitic association with an angiosperm shows the following features. I. Diarch roots II. Dimorphic chloroplasts III. Motor cells IV. Spikelets 1) All 2) I and II *4) II, III, IV 3) II and IV 112. Match the following List – I List – II Inflorescence is involved A) in vegetative and sexual I) Stachys tubifera reproduction Stem and leaves are B) vegetatively propagated II) Globba structures Vegetatively propagating III) Artabotrys C) branch Peduncle modified into IV) Dioscorea D) Hook V) Scilla 113. Pinnately lobed simple leaves are present in A B C D 1) II V III I *2) II V I III 3) III IV V II 4) IV V I III I. Ipomoea batatus II. Ipomoea quamoclit III. Brassica IV. Argemone 1) All *2) II, III, IV 3) III, IV 4) II, III 114. If the inflorescence of clerodendron has 4 generations of branches, the total number of flowers in the inflorescence must be 1) 9 2) 15 *3) 31 4) 63 115. Floral leaves of the following plant show nether cohesion nor adhesion 1) Hibiscus *2) Magnolia 116. Match the following Plant character 3) Malvaviscus Type of Ovule www.sakshieducation.com 4) Martynia A B C D www.sakshieducation.com Plant with aereoles on I) Anatropous V A) 1) IV III II the modified stem Plant with tetradynamous II) Amphitropous I 2) IV III V B) androecium I V III) Campylotropous C) Plant with Anthodium *3) IV III Plant with heterophylly IV) Circinotropous I III IV D) 4) V and Homogamy V) Hemitropous 117. Nucleus of following cell of embryosac is suspended like the nucleus of Spirogyra cell by cytoplasmic threads 1) Synergid *2) Central cell 3) Egg cell 4) Antipodal 3) Datura 4) Nymphaea 118. Seeds are both perispermic and endospermic in *1) Piper 2) Capsella 119. Match the following List – I List – II Externally invisible true I) Caryopsis A) fruit Dry dehiscent fruit shows B) more resemblance with II) Cypsela dry schizocarpic fruit C) Fruit with persistent calyx III) Loculicidal capsule Fruit formed from flowers IV) Septicidal capsule D) of spikelet V) Pome A B C D V IV II III 2) IV V II I 3) V IV I II *4) V IV II I 1) 120. Study the following table and choose the correct combination Plant Character Family I) Sida cordifolia Pentalocular ovary Malvaceae II) Ulex Spinous leaflets Fabaceae III) Hyoscyamus niger Obliquely placed ovary Solanaceae IV) Lilium Polyembryony Liliaceae 1) III, IV 2) I, II *3) II, III 121. Study the following table and choose the correct combination I) Endoplasmic Reticulum II) Golgi Complex III) Peroxisomes Extensive unit membrane system Made of Dictyosomes Synthesises Phospholipids 4) I, IV Forms Golgi Forms Lysosomes Involved in Serine formation IV) Lysosome Has enzymes of 2nd class Formed from cisternae of Endoplasmic Reticulum *1) I and II 2) II and III 3) III and IV 4) II and IV 122. [A]: Nucleosome is not having H1 protein [R]: Chromatin has nucleic acids and basic proteins 1) Both A and R are true and R is the correct explanation of A *2) Both A and R are true but R is not the correct explanation of A 3) A is true but R is false 4) A is false but R is true 123. Each chromosome has contact with spindle fibres of only one pole during I. Diplotene II. Metaphase I III. Mitotic Metaphase IV. Mitotic Anaphase 1) I and II 2) II and III 3) II, III, IV *4) II and IV 124. Fruits grow in size due to the activity of 1) Apical meristem *2) Intercalary meristem 3) Lateral meristem meristem www.sakshieducation.com 4) Secondary www.sakshieducation.com 125. Sclereids commonly seen in the leaves of Dicots are I. Osteosclereids II. Brachy sclereids III. Malpighian cells IV. Astrosclereids. 1) I and II 2) III and IV *3) I and IV 4) II and III 126. Choose the correct statements I. Vessels are seen in all cryptogams and Phanerogams II. Sieve cells are anucleated living cells III. Protoplasm of one sieve tube element is extended into another sieve element through sieve pores. IV. Companian cells are not seen in Archegoniates. *1) Onle I is correct 2) II and III are correct 3) II, III, IV are correct 4) Only IV is correct. 127. Either externally or Internally xerophytic characters are not noticed in the following xerophyte. 1) Calotropis 2) Agave *3) Tribulus 4) Nerium 128. Choose the crosses of Pisum sativum varieties which do not form the plants with the genotypes as YYRR. I. Yy Rr X Yy Rr II. YY Rr X Yy rr III. YY rr X yy RR IV. Yy RR X YY Rr 1) I and II *2) II and III 3) III and IV 4) II and IV 129. During the following type of chromosomal mutations, one chromosome is subjected to deletion and another chromosome is addition. 1) Inversion 2) Reciprocation 130. Match the following List – I A) Digitalis B) Azolla C) Spirulina D) Jatropa I) II) III) IV) V) 131. Plnat ‘X’ has Quincuncial aestivation 3) Duplication *4) Translocation List – II A B C D I II Bio-diesel plant 1) IV V II I SCP organism *2) IV V Biofertiliser 3) V IV II III I Medicinal plant 4) IV V III Bioremediation in its calyx and tetralocular ovary in its gynoecium. Plant ‘Y’ has suppressed endosperm formation and dead multiple Rhizodermis. The modified roots in X and Y are respectively 1) Storage root, Parasitic root 2) Epiphytic roots, Respiratory roots *3) Storage root, Photosynthetic roots 4) Storage tap root, Root nodule 132. Modified stems and modified roots are seen in I. Oxalis II. Asparagus III. Amorphophallus IV. Ruscus 1) All except I 2) All except II 3) All except III *4) All except IV 133. [A]: Leaves with convergent venation are unlobed [R]: All unlobed leaves have convergent venation 1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A *3) A is true but R is false 4) A is false but R is true 134. Inflorescences with trimorphic flowers are seen in I. Colocasia II. Tridax III. Mangifera IV. Euphorbia 1) I, II 2) II, III 3) III, IV *4) I, III 135. Match the following List – I A) Dichlamydeous unisexual List – II I) Ficus www.sakshieducation.com 1) A V B IV C II D III www.sakshieducation.com flowers Monochlamydeous II) Vernonia B) bisexual flowers Dichlamydeous bisexual III) Poinsettia C) flowers Monochlamydeous IV) Amaranthus D) unisexual flowers V) Mangifera 136. If a Brassica microsporangium has meiocytes equal to the number 2) IV V III II *3) V IV II I 4) V IV III I of meiocytes of Pteris sporangium, the total number of male gametes produced by microspores of a Brassica flower is 1) 1152 *2) 2304 3) 576 4) 2204 137. Double fertilization was first discovered in plants with I. Monosporic embryosac embryosac IV. Trisporic embryosac 1) I, IV 2) II, III II. Bisporic embryosac III. Tetrasporic *3) only III 4) I, III 138. Series of Bentham and Hookers classification with superior ovary are I. Disciflorae II. Heteromerae III. Coronariae IV. Bicarpellatae *1) All 2) All except I 3) All except IV 4) All except II 139. Root has medicinal value in I. Withania II. Smilax III. Derris indica IV. Trigonella 1) III, IV *2) I, II 3) II, IV 4) I, III 140. Match the following List – I List – II Trimorphic unisexual I) Poinsettia A) flowers Trimorphic bisexual II) Ficus B) flowers Dimorphic bisexual III) Mangifera C) flowers Dimorphic unisexual IV) Lythrum D) flowers V) Oldenlandia 141. Study the following table and choose the correct combination Fruit Feature I I) Syconus Edible peduncle II) Sorosis Developed from racemose inflorescence III) Schizocarp Developed from multicarpellary ovary IV) Hesperidium Developed from multicarpellary ovary 1) I and II 2) II and III 3) III and IV 142. The resolving power of human eye is 1) 1 mm *2) 0.1 mm 3) 10 µ A B C D *1) II IV V I 2) II V IV I 3) IV V II III 4) IV I V II Feature II Several achenes Always fleshy Splits vertically Edible mesocarp *4) I and III 4) 0.5 mm 143. A DNA molecule has 150 hydrogen bonds. 14% of them are present in the 1st spiral, 16% in the 2nd spiral, 18% in the 3rd spiral, 20% in the 4th spiral, 14% in the 5th spiral and the remaining in the 6th spiral. The percentage of Adenine in the DNA molecule is 1) 25% 2) 30% 3) 20% 144. [A]: All dicots show secondary growth. [R]: Vascular bundles of Dicot stem are open type. www.sakshieducation.com 4) 15% www.sakshieducation.com 1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A 3) A is true but R is false *4) A is false but R is true 145. Tracheids containing special tissue is seen in 1) Pinus 2) Ficus 3) Eucalyptus *4) Pothos 146. [A]: Vascular bundles of roots are described as separate vascular bundles. [R]: Xylem and Phloem of root bundles are in different radii 1) Both A and R are true and R is the correct explanation of A *2) Both A and R are true but R is not the correct explanation of A 3) A is true but R is false 4) A is false but R is true 147. Photosynthetic secondary tissue is 1) Periderm *2) Phelloderm 3) Exodermis 4) Exothecium 148. [A]: Cuticle is absent in ceratophyllum [R]: Ceratophyllum is submerged hydrophyte *1) Both A and R are true and R is the correct explanation of A 2) Both A and R are true but R is not the correct explanation of A 3) A is true but R is false 4) A is false but R is true 149. Choose the genotypes that show Mendelian recombinations I. TT yy II. Tt YY III. Tt Yy IV. tt Yy 1) I and III 2) II and IV 3) I and III *4) I and IV 150. Trichoblasts are absent in I. Assimilatory roots II. Adventitious roots III. Haustorial roots IV. Ectomycorrhizae *1) I, III, IV 2) II, III, IV 3) I, II, IV 4) I, II, III www.sakshieducation.com