Download A Comparison of Splenic B-Cell Effects of

TOXICOLOGICAL SCIENCES 99(1), 141–152 (2007)
doi:10.1093/toxsci/kfm137
Advance Access publication June 19, 2007
Acceleration of Autoimmunity by Organochlorine Pesticides:
A Comparison of Splenic B-Cell Effects of Chlordecone and
Estradiol in (NZBxNZW)F1 Mice
Fei Wang,*,1 Stephen M. Roberts,*,†,2 Edward J. Butfiloski,‡ Laurence Morel,§ and Eric S. Sobel‡
*Department of Pharmacology and Therapeutics, †Department of Physiological Sciences, ‡Department of Medicine,
and §Department of Pathology, Immunology and Laboratory Medicine, J. Hillis Miller Health Science Center,
University of Florida, Gainesville, Florida 32610
Received March 22, 2007; accepted May 17, 2007
The weakly estrogenic organochlorine pesticide chlordecone
can accelerate the development of systemic lupus erythematosus
(SLE) in ovariectomized (NZB x NZW)F1 mice, with a shortened
time to appearance of autoantibodies and disease similar to that
produced by treatment with the sex hormone 17b-estradiol (E2).
It is unclear whether chlordecone and E2 share the same
pathways in mediating this effect. The effects of chlordecone
and E2 treatment on splenic germinal center (GC) and marginal
zone B cells were examined. Both chlordecone and E2 activated
splenic B cells and enhanced GC reactions, as shown by
upregulated protein expression of GL7, CXCR5, and CXCR4.
Both treatments increased B-cell bcl-2 and shp-1 gene expression
and enhanced ICAM-1 and VCAM-1 protein levels in GC B cells.
Chlordecone reduced total B cell and GC B-cell apoptosis without
affecting proliferation, another feature shared by E2 treatment.
However, chlordecone treatment did not alter the composition of
splenic B-cell subsets in marked contrast to the decrease in
transitional B cells and increase in marginal zone B cells seen in
E2-treated mice. The differences in effects between chlordecone
and E2 indicate that chlordecone is not functioning simply as an
estrogen mimic with respect to effects on the immune system.
Similarities in the effects of chlordecone and E2 on specific immune functions, such as diminished apoptosis in GC B cells, may
provide valuable clues regarding key events in the acceleration of
autoimmunity by E2, chlordecone, and other agents.
Key Words: autoimmunity; estrogen; chlordecone; spleen;
splenocytes; systemic lupus erythematosus.
Systemic lupus erythematosus (SLE) occurs predominantly
in women, with the greatest risk of disease occurring during
childbearing years (Lahita, 1996). A variety of factors—
including genetic, environmental, and viral influences—are
postulated to contribute to the development of SLE (D’Cruz,
1
Present address: Global Safety and the Environment, Merck & Co., Inc.,
Whitehouse Station, NJ 08889.
2
To whom correspondence should be addressed at Center for Environmental
and Human Toxicology, Box 110885, University of Florida, Gainesville, FL
32611. Fax: (352) 392-4707. E-mail: [email protected].
2000), but the factors contributing specifically to increased risk
in women are unclear. There is evidence to suggest that sex
hormones have an important role in gender bias in SLE. This
evidence includes studies in murine SLE models that show an
effect of endogenous estrogen status on the rate of progression
and severity of disease. For example, in female (NZB x NZW)F1
mice, ovariectomy delays development of elevated autoantibody titers and immune complex glomerulonephritis, while
estradiol (E2) treatment restores the time course of autoimmunity to that seen in ovary-intact animals (Sobel et al., 2005). In
(NZB x NZW)F1 males, the time to development of SLE is
longer than for females but can be decreased by either castration or administration of estrogen (Roubinian et al., 1978).
Estrogen treatment has also been demonstrated to increase the
rate of onset of disease and mortality in lupus-prone MRL lpr/
lpr mice (Carlsten et al., 1990, 1992).
Although far from conclusive, a number of clinical studies
also suggest a role for sex hormones in SLE. The onset of SLE
typically occurs after menarche and the disease subsides after
menopause (Barrett et al., 1986; Sandborg, 2002). Increased
SLE flares associated with pregnancy have been reported (Petri
et al., 1991; Urowitz et al., 1993), perhaps due to protracted
increases in estrogen. A recently completed clinical trial of
combined estrogen and progesterone hormone replacement
therapy (HRT) in menopausal SLE patients (the Safety of Estrogen in Lupus Erythematosus National Assessment) found
that patients receiving HRT had significantly more lupus flares
than patients given placebo (Buyon et al., 2005). The dose of
estrogen and clinical status of the patient are important, as more
recent study by the same group suggests that for stable, mild to
moderate SLE, low doses of exogenous estrogen as given in
oral contraceptives are reasonably safe (Petri et al., 2005).
The effects of estrogen on the immune system are complex,
and a variety of mechanisms have been postulated through
which estrogen might trigger or exacerbate autoimmunity.
Examples include overexpression of autoantigens through estrogen-induced enhancement of transcriptional processes, hyperresponsivity to autoantigens by estrogen-enhanced Th2 cytokine
Ó The Author 2007. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved.
For Permissions, please email: [email protected]
142
WANG ET AL.
production, and estrogen suppression of apoptosis of autoreactive
T and B cells (for recent reviews, see Grimaldi et al., 2005; Lang,
2004; Sekigawa et al., 2004). Evidence suggests that estrogen
effects in the spleen may be particularly important. Treatment of
BALB/c mice transgenic for a rearranged IgG antibody specific
for double-stranded DNA (R4A-IgG2b BALB/c) with
implanted, sustained-release E2 pellets resulted in the appearance of IgG2b anti-DNA antibody titers. No increase in antiDNA antibody titers was observed in mice treated with control
pellets, indicating that autoreactive B cells exposed to estrogen
in vivo were able to escape apoptosis and undergo activation
(Bynoe et al., 2000). Subsequent experiments found that E2
treatment diminished B-cell receptor–mediated apoptosis in
transitional B-cell populations (Grimaldi et al., 2002) and that
most of the activated autoreactive B cells were from the splenic
marginal zone (Grimaldi et al., 2001). Other studies have also
suggested the importance of the marginal zone in producing
autoreactive B cells leading to SLE in (NZB x NZW)F1 mice
(Wither et al., 2000).
The germinal center (GC) of the spleen is another important
site for deletion of autoreactive B cells. It appears that there is
clonal deletion of GC autoreactive B cells (Han et al., 1995;
Shokat and Goodnow, 1995) and that upregulation of Bcl-2
leads to increased autoreactive B-cell survival (Kuo et al., 1999).
E2 treatment has been shown to increase Bcl-2 expression in GC
cells (Bynoe et al., 2000), suggesting that this too may be an
important site of action of estrogen in the spleen with respect to
increasing autoreactive B cells.
We have recently shown that treatment of female
(NZB x NZW)F1 mice with chlordecone, an organochlorine
pesticide with estrogenic effects (Hodges et al., 2000; Okubo
et al., 2004), accelerated the rate of development of SLE (Sobel
et al., 2005). Because doses of chlordecone in humans resulting
from environmental exposure have not been measured, it is
difficult to determine how chlordecone doses producing more
rapid onset of autoimmunity in mice compare with human
exposures. However, comparison of chlordecone doses producing various adverse effects in mice indicate that autoimmune effects are among the most sensitive, i.e., they occur at
doses of chlordecone at or below those required to produce
other forms of toxicity. A similar but weaker effect on SLE was
produced by E2 treatment at a dose rate of 0.028 mg/kg/day
(Sobel et al., 2005), leading to speculation that chlordecone
affects autoimmunity through its estrogenicity. However, doses
of chlordecone capable of significantly decreasing time to onset
of SLE produced little or no estrogenic response in the classical
uterine hypertrophy assay. Consequently, it is unclear whether
chlordecone is sufficiently potent as an estrogenic agent to be
a functional estrogen mimic at doses relevant to autoimmunity.
If it is not, this would suggest that chlordecone possesses
a different mode of action with respect to its effect to accelerate
development of SLE.
To address this question, a series of experiments were conducted in which the effects of chlordecone on the immune sys-
tem were compared with E2 in ovariectomized (NZB x NZW)F1
mice. Morphological, phenotypic, and functional end points
related to the spleen and splenic B cells were the focus of these
experiments given the importance of the spleen as a target for
estrogen effects leading to autoimmunity. The principal objective of the study was to determine whether chlordecone, at
doses affecting autoimmunity, produced estrogen-like effects
on the spleen and splenic B-cell populations.
MATERIALS AND METHODS
Mice. Female (NZB x NZW)F1 mice (6–8 weeks old) were purchased
from The Jackson Laboratories (Bar Harbor, ME). Mice were housed in
a climate-controlled, specific pathogen-free barrier facility. Mice were kept in
polycarbonate cages on corncob bedding with free access to food and water
throughout the study. All procedures were approved by the Institutional Animal
Care and Use Committee of the University of Florida.
Test materials and treatments. Chlordecone from Crescent Chemical
(Islandia, NY) was formulated into 60-day sustained-release pellets by
Innovative Research of America (Sarasota, FL). Each chlordecone pellet
contained either 1 or 5 mg chlordecone. Pellets containing 0.05 mg 17b
estradiol (E2) or matrix only (as controls) from Innovative Research of America
were used in the study for comparison purposes.
At the beginning of the experiments, each mouse was surgically ovariectomized and allowed to recover for 2 weeks. Then a pellet containing
chlordecone, E2, or matrix only was implanted sc above the shoulders under
light methoxyflurane anesthesia. Mice tolerated the ovariectomy and pellet
implantation procedures without complications. Mice were euthanized 5–6
weeks after pellet implantation, and tissues were harvested for study. This
duration of exposure was chosen to enhance the ability to distinguish primary
from secondary effects. That is, mice were euthanized before the development
of overt autoimmune pathology so that events leading up to, rather than
resulting from, clinical lupus could be evaluated.
RNA and cDNA preparation. Splenic B cells were enriched from
splenocytes of chlordecone-, E2- and control pellet–treated mice by negative
selection with a mouse B cell isolation kit, (Miltenyi Biotec, Auburn, CA)
according to the manufacturer’s directions. RNA from purified B cells was
extracted by TRIZOL reagent (Invitrogen, Carlsbad, CA), and the concentration of RNA was measured by spectrophotometry. RNA (1 lg) was then treated
with DNase I (Invitrogen) to remove genomic DNA and reverse transcribed
to cDNA using Superscript II First-Strand Synthesis System (Invitrogen) for
RT-PCR according to the manufacturer’s guidance.
Real-time PCR. Gene expression was determined by real-time PCR using
SYBR green (Applied Biosystems, Foster City, CA). Primers were designed
as follows: Bcl-2 forward AGTACCTGAACCGGCATCTG, reverse
CAGGTATGCACCCAGAGTGA; Shp-1 forward CGAAAACGTGCATAGCAAGA, reverse GACGATGCCCAGATCACTT; b-actin forward CGGCCTAGCTCTGAGACAAT, reverse GTCACCATCCTTTTGCCAGTT. Briefly,
one microliter of cDNA from the preparation as described above was added
to a reaction mixture containing 3mM MgCl2, 1mM deoxynucleoside
triphosphate mixture, 0.025 U of Amplitaq Gold, SYBR Green dye (Applied
Biosystems), optimized concentrations of specific forward and reverse primers,
and diethylpyrocarbonate-treated water in a final volume of 25 ll.
Amplification conditions were as follows: 95°C (10 min), followed by 45
cycles of 94°C (15 s), 60°C (25 s), 72°C (25 s), with a final extension at 72°C
for 8 min. Transcripts were quantified using the comparative (2^{DDC_{t}})
method.
Spleen morphology. Splenic tissue was fixed in neutral buffered 10%
formalin for at least 24 h, trimmed, processed, embedded in paraffin, sectioned
at 4–6 lm, and stained with hematoxylin and eosin. Splenic morphology was
SPLENIC EFFECTS OF CHLORDECONE AND ESTROGEN
examined by light microscopy. The principal difference in morphology among
treatment groups was in density and distribution of cells within the
periarteriolar sheaths. Slides were examined in blinded fashion by a pathologist
and scored using the following criteria: minimal changes, 0; mild to
occasionally moderate, 1; moderate overall, 2; moderate and rarely extensive,
3; extensive overall with rare GCs, 4; and extensive overall with discrete, large
GCs, 5.
Flow cytometry. Flow cytometry was performed with a CyAn ADP
Analyzer (Dako Ft. Collins, CO). Single-cell suspensions from spleen were
stained with mixtures of antibodies to the following surface markers: B220,
IgM, CD19, CD21, CD24, CD44, CD69, CXCR4, CXCR5, ICAM-1, VCAM1, MHC Class II, B7.2, and GL7. Intracellular staining was performed as
described by Merino et al. (1994). Cells were incubated with rabbit anti-Bcl-2PE or rabbit IgG-PE as isotype control. All antibodies were purchased from BD
Biosciences Pharmingen (San Jose, California, USA).
Flow cytometry data analysis was accomplished with FCS Express V3
software (De Novo Software, Ontario, CA). In some cases, the expression of
some molecules did not appear as two distinctive populations. In these cases,
the median level of expression was normalized to the control mice, and the
percentages of cells that showed a higher value compared with this median for
different treatments were displayed.
Apoptosis assay. B cells were enriched from splenocytes of chlordecone-,
E2- and control pellet–treated mice by negative selection with a mouse B-cell
isolation kit (Miltenyi Biotec) according to the manufacturer’s directions.
Purified B cells (1 3 106/ml) were cultured in duplicate in complete RPMI
1640 medium, with or without 1 lg/ml lipopolysaccharide (LPS), at 37°C and
5% CO2 for 24 h. Cells were stained for surface markers, and apoptosis was
assessed by flow cytometry with the Annexin V-PE and 7-AAD apoptosis
detection kit I (BD Biosciences Pharmingen) according to the manufacturer’s
instructions. GC B-cell apoptosis was determined by Annexin V-PE staining on
freshly prepared GL7þ B cells.
Proliferation assay. Purified splenic B cells at (2 3 105 per well) were
cultured for 72 h in complete RPMI 1640 medium at 37°C and 5% CO2, with or
without added LPS stimulation (1 lg/ml). B-cell proliferation was assessed by
testing [3H]TdR incorporation (ICN Biomedicals, Costa Mesa, CA) over the
last 18 h of culture. Proliferation index was measured as the ratio of stimulated
to unstimulated thymidine incorporation.
Statistical analysis. Statistical analyses were mainly conducted using the
software GraphPad Prism, version 4.00 (GraphPad, San Diego, CA).
Comparisons of spleen morphology scores were made using the nonparametric
Kruskal-Wallis test. For flow cytometric results that were normalized to the
control group data, the control group data were excluded in the ANOVA as the
control group would have artificially low heterogeneity. Differences in
treatment means were identified using Gabriel’s comparison intervals method
(Gabriel, 1978). If the control group mean was outside the Gabriel comparison
interval for any treatment, the treatment mean was considered to be
significantly different from the control mean. Significance for all other data
was determined using Dunnett’s procedure for the one-way ANOVA. All p <
0.05 were considered to be statistically significant.
RESULTS
Spleen morphology was examined after 6 weeks of treatment
with either E2 or chlordecone. No significant lesions were
found in red pulp from mice treated with E2 sustained–release
pellets (0.05 mg per 60-day release pellet; approximate dose of
0.024 mg/kg/day), chlordecone (5 mg per 60-day release pellet;
approximate dose 2.4 mg/kg/day), or matrix-only (control)
pellets (Figs. 1A–C). The density of mixed cells in splenic
cords was moderate, including minimal red cells. Extramedul-
143
lary hematopoesis ranged from minimal to mild. Some
differences in white pulp were observed among the treatment
groups. Control mice (Fig. 1A) showed less dense cuffs of
periarteriolar lymphocytes and no GCs compared with mice
treated with either chlordecone or E2 (Figs. 1B and 1C).
Diffuse periarterial lymphatic sheaths were moderate to
extensive in mice treated with either E2 or chlordecone but
minimal in the white pulp of control mice. Scoring of the
distribution of the periarterial lymphatic sheaths from 0 to 5
(minimal to extensive; see ‘‘Materials and Methods’’ section
for details) showed the increases in chlordecone and E2-treated
mice to be statistically significant (Fig. 1D). In general, control
mice had minimally or mildly populated lymphatic nodules
devoid of GCs. Chlordecone- and E2-treated mice had
moderately to extensively populated lymphatic nodules. Some
chlordecone-treated mice had no GCs or discrete marginal
zones while others had rare small GCs with discrete marginal
zones. Mice treated with E2 were more likely to have GCs with
discrete marginal zones.
To study the effects of chlordecone on B lymphocytes,
seven-color flow cytometry was performed on splenocytes.
Chlordecone exposure increased the level of activation markers
CD44 and CD69, which was similar to observations in the
E2-treated group (Fig. 2A). MHC Class II and the costimulation marker B7.2 were also increased by both treatments (Fig.
2A). In the case of MHC Class II expression, treatment groups
were normalized as the ratio of the geometric mean of the
treated mouse to that of the control mouse from that
day’s group. E2, but not chlordecone treatment, significantly
increased the CD138þB220 mature splenic plasma cell
population (Fig. 2B), while neither treatment affected
CD138þB220þ immature plasma cells (data not shown).
Since the GCs play an important role in the maturation of
humoral immune response resulting in the production of highaffinity, class-switched B cells, including autoreactive B cells,
we looked more closely at GC B cells. There was a dosedependent increase in the percent of CD19þ splenic B cells
expressing GL7, a marker of GC B cells, in response to
chlordecone (Fig. 3A). Along with the increase in GL7þ B
cells, there was also a corresponding increase in expression of
CXCR4hi and CXCR5hi B cells (Fig. 3B). These two
chemokine receptors are important in the organization of
GCs and the tracking of cells within them (Allen et al., 2004).
When gated on GL7þ GC B cells, CXCR4 and CXCR5
expression levels were also increased in the chlordecone-treated
group (data not shown). Enhanced GC reactions were also seen in
the E2-treated group (Figs. 3A and 3B).
In order to characterize further the behavior of B lymphocytes and the GC B-cell subset after chlordecone exposure, isolated B cells were tested for proliferation and apoptosis under
different conditions. The expanded GC B-cell population could
have derived from decreased basal apoptosis. Under both
‘‘stimulated’’ and ‘‘unstimulated’’ conditions, isolated splenic
B cells from both chlordecone- and E2-treated mice after 24 h
144
WANG ET AL.
FIG. 1. Splenic morphology after treatment with E2 or chlordecone. Mice were euthanized 6 weeks after implantation of pellets containing chlordecone (5
mg), E2 (0.05 mg), or matrix only (controls). Spleens were fixed, sectioned, and stained with hematoxylin and eosin for light microscopic examination. (A) Splenic
section from control mouse. (B) Splenic section from chlordecone-treated mouse. (C) Splenic section from E2-treated mouse. (D) Scores for cell density and
distribution within the periarterial lymphatic sheaths (0 to 5; see ‘‘Materials and Methods’’ section for details). Scores for individual animals are plotted.
Comparisons among groups were made using the Kruskal-Wallis test. Scores for both chlordecone and E2-treated animals were significantly greater than controls
but not significantly different from each other ( p > 0.05).
of culture underwent apoptosis at reduced rates compared to
control-treated mice (Fig. 4A). This decreased rate of apoptosis
was also seen in freshly stained GL7þ GC B cells, both in the
chlordecone and E2 groups (Fig. 4B). In contrast, there were no
consistent changes in B-cell proliferation as measured by the
ratio of stimulated to unstimulated thymidine incorporation
(Fig. 4C).
The expressions of Bcl-2, ICAM-1, and VCAM-1 are known
to be related to the apoptosis of GC B cells (Bynoe et al., 2000;
Grimaldi et al., 2002; Koopman et al., 1994), and Shp-1
overexpression can favor the survival of autoreactive B cells
(Grimaldi et al., 2002). Protein expression of Bcl-2, ICAM-1,
and VCAM-1 in B cells was measured by flow cytometry, and
gene expression of bcl-2 and shp-1 was tested by quantitative
real-time PCR. E2 treatment has been shown to upregulate Bcl-2
expression on splenic B cells of R4A-IgG2b BALB/c transgenic
mice, but this has not been reported for nontransgenic mice.
E2 increased expression of Bcl-2 in splenic B cells of ovariectomized (NZB x NZW)F1 mice, a feature shared by chlordecone exposure (Fig. 5A). Chlordecone treatment increased both
ICAM-1 and VCAM-1 expression level on total CD19þ B cells
as well as GC B cells (Fig. 5B); both were similar to the effects
of E2 treatment. At the gene level, chlordecone treatment
significantly enhanced bcl-2 (Fig. 6A) and shp-1 (Fig. 6B)
expression, an effect that did not reach statistical significance in
the E2 treatment group.
As it has been reported that E2 exposure can expand the
marginal zone B-cell population in R4A-IgG2b BALB/c
transgenic mice (Grimaldi et al., 2001), we examined the
impact of sustained exposure to chlordecone or E2 in vivo on
the distribution of splenic B-cell subsets in young, ovariectomized (NZB x NZW)F1 mice. Flow cytometric analysis revealed
SPLENIC EFFECTS OF CHLORDECONE AND ESTROGEN
145
FIG. 2. Activation of splenic B cells by chlordecone and E2. Splenocytes from chlordecone-, E2-, and placebo-treated mice were analyzed by flow cytometry
using antibodies that recognize CD19, B220, CD69, CD44, B7.2, MHC Class II, and CD138. B cells were identified as the CD19þB220þ population. The
expression of all the molecules except MHC Class II was based on the percentage of the positive population, as described in ‘‘Materials and Methods’’ section. The
expression of MHC Class II was based on the median fluorescence intensity and was normalized to the control group. (A) Chlordecone and E2 effects on CD69,
CD44, B7.2, and MHC Class II expression. (B) Chlordecone and E2 effects on the percentage of plasma cell population. Mature and immature plasma cells were
defined as B220CD138þ and B220þCD138þ, respectively. Any treatment that caused significant increase compared with the control group was marked with
a star symbol. For experiments where data were normalized to control values, Treatment groups with no statistically significant differences were marked with the
same letter (either a or b), while groups with significant difference were marked with different letters.
146
WANG ET AL.
FIG. 3. Chlordecone and E2 effects on splenic GCs. (A) Representative dot plots of GC marker GL7 expression on B cells in chlordecone-, E2-, and placebotreated mice, and the overall result of GL7 expression in different groups. (B) Chemokine receptors CXCR4 and CXCR5 expression in B cells in different
treatments.
a significant decrease in percentage of B220þ/CD24þ immature B cells and an increased percentage of B220þ/CD24mature B cells in E2-treated mice (Fig. 7A), which was similar
to the results seen in transgenic mice. The reduction of
immature B cells by E2 was due to a decrease in the percentage
of CD21/CD24þ transitional type 1 (T1) B cells, which
represent the most immature splenic B-cell population and give
rise to transitional type 2 (T2) B cells. The CD21þ/CD24þ
transitional T2 population, which differentiates into the mature
splenic B-cell populations, was only slightly reduced in
E2-treated mice. Chlordecone treatment had no appreciable
influence on the distribution of these populations. The
SPLENIC EFFECTS OF CHLORDECONE AND ESTROGEN
147
FIG. 4. Analysis of chlordecone and E2 effects in B-cell apoptosis and proliferation. Purified B cells were cultured for 24 h under different conditions, and
apoptosis was determined by Annexin V and 7-AAD staining. GC B-cell apoptosis was determined by Annexin V in freshly prepared splenocytes gated on GL7þ
B cells. B-cell proliferation was measured by [3H]TdR incorporation and calculated using a proliferation index method. (A) Decreased B-cell apoptosis under
‘‘unstimulated’’ or 1 lg/ml LPS–stimulated conditions. (B) Reduced GC B-cell apoptosis. (C). Unaffected B-cell proliferation by either chlordecone or E2
treatment. See the legend to Figure 2 for an explanation of the symbols.
increasing percentage of mature B cells seen in the spleens of
mice treated with E2 was derived from a significant increase in
CD21þCD24 marginal zone B cells as there was no statistically significant increase in the percentage of CD21/
CD24 follicular B cells (Fig. 7B). In contrast, chlordecone
treatment had no effect on the percentage of marginal zone or
follicular B cells.
DISCUSSION
There is increasing evidence that environmental factors play
important roles in the regulation of the immune system (Hess,
2002; van Loveren et al., 2001). We have previously shown
that organochlorine pesticides can accelerate autoimmunity in
both ovariectomized and ovary-intact female (NZB x NZW)F1
mice, with changes in the time course and magnitude of disease
similar to that seen with treatment with the sex hormone E2
(Sobel et al., 2005, 2006). In the present studies, we investigated whether the chlordecone and E2 likely affected the
same pathways, basing our studies on known effects of E2 on
the immune system. Both chlordecone and E2 activated splenic
B cells and in particular, enhanced GC B-cell reactions as
shown by upregulated protein expression of GL7, CXCR5, and
CXCR4. Although GC cells account for only a small
percentage of the total spleen cell population, it is an important
area where negative selection for autoreactive B cells occurs
(Pulendran et al., 1995; Shokat and Goodnow, 1995).
The fate of B cells in the GC is associated with some important molecules. Chemokine receptors CXCR4 and CXCR5
are important for the organization of the GC. It has been
reported that CXCR4 is critical in localizing centroblasts to the
dark zone, while CXCR5 helps direct cells to the light zone
(Allen et al., 2004). Enhanced CXCR4 and CXCR5 expression
148
WANG ET AL.
FIG. 5. Analysis of chlordecone and E2 regulation of Bcl-2, ICAM-1, and VCAM-1 protein expression in B cells. Levels of these molecules in B cells were
determined by flow cytometry. As these molecules are expressed at some level by virtually all B cells, analysis was conducted by median expression levels, as
described in ‘‘Materials and Methods’’ section. (A) Representative histogram of Bcl-2 expression on B cells from chlordecone- (heavy line), E2-, (heavy line) and
control pellet-treated (light line) mice, and the overall result of Bcl-2 expression in different groups. (B) ICAM-1 and VCAM-1 expression in total B cells and
GL7þ GC B cells. See the legend to Figure 2 for an explanation of the symbols.
SPLENIC EFFECTS OF CHLORDECONE AND ESTROGEN
FIG. 6. Analysis of chlordecone and E2 regulation of Bcl-2 and Shp-1
gene expression in isolated B cells. B cells were enriched from splenocytes of
chlordecone-, E2-, and control pellet–treated mice by negative selection. bcl-2 (A)
and shp-1 (B) gene expression was determined by using quantitative real-time
PCR.
on GC B cells by chlordecone and E2 treatment might facilitate
the trafficking of autoreactive cells to the GC. Previous reports
showed that the adhesion molecules ICAM-1 and VCAM-1
can mediate the attachment of GC B cells to the follicular
dendritic cells via the integrins LFA-1 and VLA-4. This
association of B cells and follicular dendritic cells is thought to
be important for driving affinity maturation (Hedman et al.,
1992; Koopman et al., 1994). The enhanced expression of cell
adhesion molecules ICAM-1 and VCAM by chlordecone and
E2 treatments might transfer a stronger signal from follicular
dendritic cells to the B cells, which postpones the apoptosis of
autoreactive B cells. It is also possible that E2 or chlordecone
have direct effects on B-cell survival. In fact, reduced B-cell
apoptosis was seen in both unstimulated conditions and fol-
149
lowing LPS stimulation. Moreover, reduced GC B-cell apoptosis was also observed in freshly isolated B cells. However,
when B cells were stimulated with anti-IgM, no significant
change was observed (data not shown). One possible explanation for these observations is that the resistance to apoptosis
is not a feature of B-cell receptor–mediated signaling.
However, this seems unlikely, as it has been previously shown
that E2 decreased B cell receptor-mediated apoptosis as
measured by caspase-3 expression (Grimaldi et al., 2002). A
more likely possibility is that these culture conditions resulted
in a high degree of variability that prevented statistical
significance from being achieved.
We also found Bcl-2 expression was increased in B cells.
Enhanced Bcl-2 expression is believed to be responsible for
reduced apoptosis and increased survival of autoreactive cells
(Kuo et al., 1999). Although both treatments increased Bcl-2
protein levels as measured by flow cytometry, E2 treatment
showed the stronger effect. However, chlordecone treatment
(5 mg pellet) caused a larger increase in bcl-2 mRNA levels, as
measured by real-time PCR, suggesting that E2 and chlordecone may have differing effects post-transcriptionally. Shp-1,
a protein tyrosine kinase, is an important molecule in the
inhibitory receptor signaling pathway (Plas and Thomas,
1998). E2 has been reported to increase Shp-1 in the BALB/c
transgenic mouse model, and elevated Shp-1 has been
speculated to increase the threshold of B-cell signaling and
impair mechanisms of tolerance in autoreactive B cells
(Grimaldi et al., 2002). In agreement with the reported results
on transgenic BALB/c mice, exogenous E2 exposure increased
shp-1 B-cell gene expression in ovariectomized but otherwise
unmanipulated (NZB x NZW)F1 mice, a feature shared with
chlordecone. Taken together, our results suggest that chlordecone and E2 might help autoreactive B cells escape negative
selection by influencing one or more checkpoints of the GC
reaction.
Important differences between the effects of chlordecone and
E2 were also seen. Exposure to chlordecone did not significantly increase the percent of mature splenic plasma cells,
which is in contrast to E2 treatment. Plasma cells in
(NZB x NZW)F1 mice are known to accumulate abnormally
in the spleen and to have decreased migration to the bone
marrow (Erickson et al., 2003). While it is possible that
chlordecone altered the balance of plasma cells in the spleen
and bone marrow, the chlordecone-treated group secreted less
autoantibodies compared with the E2 group after 6 weeks of
treatment (data not shown), arguing against this possibility.
However, our previous results showed similar IgG immune
complex deposition in the kidney (Sobel et al., 2005). It is
possible that chlordecone has altered the fine specificities of
autoantibody production, a possibility that cannot easily be
explored with the present model.
E2 treatment has also been reported to enhance marginal
zone B-cell populations significantly in a transgenic BALB/c
mouse model, and the autoreactive B cells displayed a marginal
150
WANG ET AL.
FIG. 7. Analysis of chlordecone and E2 effects on B-cell subsets. Splenic B-cell subsets were identified by using B220, CD19, CD21, and CD24 as markers.
(A) E2, but not chlordecone treatment, reduced immature CD24þ population and increased mature CD24 population. (B) The increased mature B cells in
E2-treated group was due to a significant increase in CD21þCD24 marginal zone B cells but not the CD21CD24 follicular B-cell population, while the
decrease in immature B-cell population came from a decrease in CD21CD24þ transitional type 1 B cells but not CD21þCD24þ transitional type 2 B-cell
population. These effects were not shared by chlordecone treatment.
SPLENIC EFFECTS OF CHLORDECONE AND ESTROGEN
zone phenotype (Grimaldi et al., 2001). We verified the finding
of enhanced marginal zone B-cell population by E2 treatment
in the (NZB x NZW)F1 mouse model. In contrast, chlordecone
did not change the percentage of this population, which might
suggest chlordecone effects on autoimmunity are not through
its effects on marginal zone B cells. However, it is still possible
that chlordecone changed the repertoire of marginal zone B
cells by increasing the relative number of B cells with
autoreactive specificities without affecting the overall percentage. Again, a transgenic ‘‘knock-in’’ model would be needed
to address this possibility.
In summary, the results of this study indicate that chlordecone
and E2 share common effects on splenic morphology and GC Bcell populations, including reduced rates of B-cell apoptosis.
This suggests that impaired deletion of autoreactive B cells in
the spleen may be an important contributor to the effects of both
compounds to accelerate development of autoimmunity in the
(NZB x NZW)F1 mouse. The effects of chlordecone and E2 on
the spleen were not identical, however. Differing effects were
seen on marginal B-cell populations. These differences indicate
that chlordecone is unlikely to be functioning simply as an
estrogen mimic with respect to the immune system and
possesses activity independent of its estrogenic properties. On
one hand, complexity in immune effects of chlordecone will
make it challenging to determine the mechanisms responsible
for its acceleration of autoimmunity. On the other hand, identification of similarities and differences between chlordecone
and E2 effects on various immune targets may provide the
opportunity to obtain valuable clues as to the key events leading
to endocrine and chemical-induced exacerbation of SLE. While
this study focused on chlordecone and E2 effects on splenic Bcell populations, effects on splenic T lymphocytes and on
macrophages could also be important determinants in autoimmune
effects. Studies of comparative effects of chlordecone and E2 on
these cell populations are currently being conducted and should
add considerably to the understanding of ways in which these two
compounds affect immune functions related to autoimmunity.
151
REFERENCES
Allen, C. D., Ansel, K. M., Low, C., Lesley, R., Tamamura, H., Fujii, N., and
Cyster, J. G. (2004). Germinal center dark and light zone organization is
mediated by CXCR4 and CXCR5. Nat. Immunol. 5, 943–952.
Barrett, C., Neylon, N., and Snaith, M. L. (1986). Oestrogen-induced systemic
lupus erythematosus. Br. J. Rheumatol. 25, 300–301.
Buyon, J. P., Petri, M. A., Kim, M. Y., Kalunian, K. C., Grossman, J.,
Hahn, B. H., Merrill, J. T., Sammaritano, L., Locksin, M., Alarcon, G. S.,
et al. (2005). The effect of combined estrogen and progesterone hormone
replacement therapy on disease activity in systemic lupus erythematosus:
a randomized trial. Ann. Int. Med. 142, 953–962.
Bynoe, M. S., Grimaldi, C. M., and Diamond, B. (2000). Estrogen up-regulates
Bcl-2 and blocks tolerance induction of naive B cells. Proc. Natl. Acad. Sci.
U.S.A. 97, 2703–2708.
Carlsten, H., Nilsson, N., Jonsson, R., Backman, K., Holmdahl, R., and
Tarkowski, A. (1992). Estrogen accelerates immune complex glomerulonephritis but ameliorates T cell-mediated vasculitis and sialadenitis in
autoimmune MRL lpr/lpr mice. Cell Immunol. 144, 190–202.
Carlsten, H., Tarkowski, A., Holmdahl, R., and Nilsson, L. A. (1990).
Oestrogen is a potent disease accelerator in SLE-prone MRL lpr/lpr mice.
Clin. Exp. Immunol. 80, 467–473.
D’Cruz, D. (2000). Autoimmune diseases associated with drugs, chemicals and
environmental factors. Toxicol. Lett. 112–113, 421–432.
Erickson, L. D., Lin, L. L., Duan, B., Morel, L., and Noelle, R. J. (2003).
A genetic lesion that arrests plasma cell homing to the bone marrow. Proc.
Natl. Acad. Sci. U.S.A. 100, 12905–12910.
Gabriel, K. R. (1978). A simple method of multiple comparisons of means.
J. Am. Stat. Assoc. 73, 364.
Grimaldi, C. M., Cleary, J., Dagtas, A. S., Moussai, D., and Diamond, B.
(2002). Estrogen alters thresholds for B cell apoptosis and activation. J. Clin.
Invest. 109, 1625–1633.
Grimaldi, C. M., Hill, L., Xu, X., Peeva, E., and Diamond, B. (2005).
Hormonal modulation of B cell development and repertoire selection. Mol.
Immunol. 42, 811–820.
Grimaldi, C. M., Michael, D. J., and Diamond, B. (2001). Cutting edge:
expansion and activation of a population of autoreactive marginal zone
B cells in a model of estrogen-induced lupus. J. Immunol. 167, 1886–1890.
Han, S., Zheng, B., Dal Porto, J., and Kelsoe, G. (1995). In situ studies of the
primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. IV. Affinitydependent, antigen-driven B cell apoptosis in germinal centers as a
mechanism for maintaining self-tolerance. J. Exp. Med. 182, 1635–1644.
SUPPLEMENTARY DATA
Hedman, H., and Lundgren, E. (1992). Regulation of LFA-1 avidity in human
B cells: requirements for dephosphorylation events for high avidity ICAM-1
binding. J. Immunol. 149, 2295–2299.
Supplementary data are available online at http://toxsci.
oxfordjournals.org/.
Hess, E. V. (2002). Environmental chemicals and autoimmune disease: cause
and effect. Toxicology 181–182, 65–70.
FUNDING
Hodges, L. C., Bergerson, J. S., Hunter, D. S., and Walker, C. L. (2000).
Estrogenic effects of organochlorine pesticides on uterine leiomyoma cells in
vitro. Toxicol. Sci. 54, 355–364.
Superfund Basic Research Program, National Institute for
Environmental Health Sciences (ES07375).
ACKNOWLEDGMENTS
The authors are indebted to Dr Mary Reinhart of the University of Florida
College of Veterinary Medicine for her valuable assistance in evaluating
splenic morphology.
Koopman, G., Keehnen, R. M., Lindhout, E., Newman, W., Shimizu, Y., van
Seventer, G. A., de Groot, C., and Pals, S. T. (1994). Adhesion through the
LFA-1 (CD11a/CD18)-ICAM-1 (CD54) and the VLA-4 (CD49d)-VCAM-1
(CD106) pathways prevents apoptosis of germinal center B cells.
J. Immunol. 152, 3760–3767.
Kuo, P., Bynoe, M., and Diamond, B. (1999). Crossreactive B cells are present
during a primary but not secondary response in BALB/c mice expressing
a bcl-2 transgene. Mol. Immunol. 36, 471–479.
Lahita, R. G. (1996). The connective tissue diseases and the overall influence of
gender. Int. J. Fertil. Menopausal. Stud. 41, 156–165.
152
WANG ET AL.
Lang, T. J. (2004). Estrogen as an immunomodulator. Clin. Immunol. 113,
224–230.
Sandborg, C. (2002). Expression of autoimmunity in the transition from childhood to adulthood: role of cytokines and gender. J. Adolesc. Health 30, 76–80.
Merino, R., Ding, L., Veis, D. J., Korsmeyer, S. J., and Nunez, G. (1994).
Developmental regulation of the Bcl-2 protein and susceptibility to cell death
in B lymphocytes. EMBO J. 13, 683–691.
Sekigawa, I., Naito, T., Hira, K., Mitsuishi, K., Ogasawara, H., Hashimoto, H.,
and Ogawa, H. (2004). Possible mechanisms of gender bias in SLE: a new
hypothesis involving a comparison of SLE with atopy. Lupus 13, 217–222.
Okubo, T., Yokoyama, Y., Kano, K., Soya, Y., and Kano, I. (2004). Estimation
of estrogenic and antiestrogenic activities of selected pesticides by MCF-7
cell proliferation assay. Arch. Environ. Contam. Toxicol. 46, 445–453.
Shokat, K. M., and Goodnow, C. C. (1995). Antigen-induced B-cell death and
elimination during germinal-centre immune responses. Nature 375, 334–338.
Petri, M., Howard, D., and Repke, J. (1991). Frequency of lupus flare in
pregnancy. The Hopkins Lupus Pregnancy Center experience. Arthritis
Rheum. 34, 1538–1545.
Petri, M., Kim, M. Y., Kalunian, K. C., Grossman, J., Hahn, B. H.,
Sammaritano, L. R., Lockshin, M., Merrill, J. T., Belmont, H. M.,
Askanase, A. D., et al. (2005). Combined oral contraceptives in women
with systemic lupus erythematosus. N. Engl. J. Med. 353, 2550–2558.
Plas, D. R., and Thomas, M. L. (1998). Negative regulation of antigen receptor
signaling in lymphocytes. J. Mol. Med. 76, 589–595.
Sobel, E. S., Gianini, J., Butfiloski, E. J., Croker, B. P., Schiffenbauer, J., and
Roberts, S. M. (2005). Acceleration of autoimmunity by organochlorine
pesticides in (NZBxNZW)F1 mice. Environ. Health Perspect. 113, 323–328.
Sobel, E. S., Wang, F., Butfiloski, E., Croker, B., and Roberts, S. M. (2006).
Comparison of chlordecone effects on autoimmunity in (NZBxNZW)F1 and
BALB/c mice. Toxicology 218, 81–89.
Urowitz, M. B., Gladman, D. D., Farewell, V. T., Stewart, J., and McDonald, J.
(1993). Lupus and pregnancy studies. Arthritis Rheum. 36, 1392–1397.
Pulendran, B., Kannourakis, G., Nouri, S., Smith, K. G., and Nossal, G. J.
(1995). Soluble antigen can cause enhanced apoptosis of germinal-centre B
cells. Nature 375, 331–334.
van Loveren, H., Vos, J. G., Germolec, D., Simeonova, P. P., Eijkemanns, G.,
and McMichael, A. J. (2001). Epidemiologic associations between occupational and environmental exposures and autoimmune disease: report of a
meeting to explore current evidence and identify research needs. Int. J. Hyg.
Environ. Health. 203, 483–495.
Roubinian, J. R., Talal, N., Greenspan, J. S., Goodman, J. R., and Siteri, P. K.
(1978). Effect of castration and sex hormone treatment on survival, antinucleic acid antibodies, and glomerulonephritis in NZBxNZW F1 mice.
J. Exp. Med. 147, 1568–1583.
Wither, J. E., Paterson, A. D., and Vukusic, B. (2000). Genetic dissection of
B cell traits in New Zealand black mice. The expanded population of B cells
expressing up-regulated costimulatory molecules shows linkage to Nba2.
Eur. J. Immunol. 30, 356–365.