Download Epithelial sodium channel (ENaC) subunit mRNA and protein

Clinical Science (2003) 104, 389–395 (Printed in Great Britain)
Epithelial sodium channel (ENaC) subunit
mRNA and protein expression in rats
with puromycin aminonucleoside-induced
nephrotic syndrome
A. AUDIGE; , Z. R. YU, B. M. FREY, D. E. UEHLINGER, F. J. FREY and B. VOGT
Division of Nephrology and Hypertension, Inselspital, University of Berne, Freiburgstrasse 3, 3010 Berne, Switzerland
A
B
S
T
R
A
C
T
In experimental nephrotic syndrome, urinary sodium excretion is decreased during the early
phase of the disease. The molecular mechanism(s) leading to salt retention has not been
completely elucidated. The rate-limiting constituent of collecting duct sodium transport is the
epithelial sodium channel (ENaC). We examined the abundance of ENaC subunit mRNAs and
proteins in puromycin aminonucleoside (PAN)-induced nephrotic syndrome. The time courses
of urinary sodium excretion, plasma aldosterone concentration and proteinuria were studied in
male Sprague–Dawley rats treated with a single dose of either PAN or vehicle. The relative
amounts of αENaC, βENaC and γENaC mRNAs were determined in kidneys from these rats by
real-time quantitative TaqMan PCR, and the amounts of proteins by Western blot. The kinetics
of urinary sodium excretion and the appearance of proteinuria were comparable with those
reported previously. Sodium retention occurred on days 2, 3 and 6 after PAN injection. A
significant up-regulation of αENaC and βENaC mRNA abundance on days 1 and 2 preceded
sodium retention on days 2 and 3. Conversely, down-regulation of αENaC, βENaC and γENaC
mRNA expression on day 3 occurred in the presence of high aldosterone concentrations, and was
followed by a return of sodium excretion to control values. The amounts of αENaC, βENaC and
γENaC proteins were not increased during PAN-induced sodium retention. In conclusion, ENaC
mRNA expression, especially αENaC, is increased in the very early phase of the experimental
model of PAN-induced nephrotic syndrome in rats, but appears to escape from the regulation by
aldosterone after day 3.
INTRODUCTION
Nephrotic syndrome is characterized by proteinuria,
hypoalbuminaemia and sodium retention with oedema
formation [1]. Traditionally, salt retention in nephrotic
syndrome has been explained by the hypovolaemia
concept. This setting implies increased renal sodium
reabsorption in response to the decreased oncotic press-
ure following proteinuria, fluid loss into the interstitium,
hypovolaemia, and subsequent hyperaldosteronism.
However, several observations argue against a primary
role of hypovolaemia and hyperaldosteronism. Plasma
volume is often normal or even increased in the nephrotic
patient, and hypervolaemia can be seen in some animal
models of the syndrome [2–4]. Furthermore, sodium
retention is observed prior to proteinuria during the
Key words : aldosterone, epithelial sodium channel, nephrotic syndrome, puromycin aminonucleoside, real-time PCR, Western
blot.
Abbreviations : CCD, cortical collecting duct ; C , threshold cycle ; ENaC, epithelial sodium channel ; GAPDH, glyceraldehyde-3T
phosphate dehydrogenase ; PAN, puromycin aminonucleoside ; RT, reverse transcription.
Correspondence : Dr Bruno Vogt (e-mail bruno.vogt!insel.ch).
# 2003 The Biochemical Society and the Medical Research Society
389
390
A. Audige! and others
initial stages of relapse in children [3]. In addition,
nephrotic syndrome can be induced in adrenalectomized
rats [5,6].
Alternatively, salt retention can be explained by an
intrarenal defect. In accordance with this hypothesis, the
kidney taken from a rat rendered nephrotic by exposure
to puromycin aminonucleoside (PAN) retains sodium
abnormally when perfused in isolation [7,8]. Micropuncture studies in a unilateral model of PAN-induced
nephrotic syndrome in rats have demonstrated that the
site of sodium retention is beyond the distal convoluted
tubule [9,10]. During the period of positive sodium
balance, Na+,K+-ATPase activity has been shown to be
enhanced in the cortical collecting duct (CCD) in several
experimental models of nephrotic syndrome [6,11–13].
The rate-limiting factor for trans-epithelial sodium
transport in the CCD is the activity of the amiloridesensitive epithelial sodium channel (ENaC). This channel
is expressed primarily at the apical membrane of cells
involved in the maintenance of extracellular fluid volume
and blood pressure, such as in the distal nephron, the
distal colon and the respiratory airways [14,15]. ENaCs
are heteromultimeric proteins formed by the association
of three homologous subunits, α, β and γ [16,17].
Regulation of ENaC activity can occur at different levels,
i.e. transcription, translation, translocation and degradation, as well as single-channel open probability and
conductance. ENaC subunits have been shown to be
transcriptionally up-regulated by aldosterone, a lowsodium diet or dexamethasone in the kidney, colon and
lung, in a tissue- and subunit-specific fashion [18].
Recently, in vitro microperfusion studies showed that
amiloride, a collecting duct diuretic that blocks ENaCs,
was able to restore sodium balance in CCDs from
nephrotic animals [9].
The aim of the present study was to establish whether
ENaC is transcriptionally regulated in nephrotic syndrome, and whether expression of ENaC subunit
mRNAs and\or protein expression correlates with the
profile of urinary sodium excretion. For this purpose,
the experimental model of PAN-induced nephrotic syndrome in the rat was used.
METHODS
Corp., Lausanne, Switzerland) at a dose of 150 mg\kg
body weight, diluted to 15 mg\ml in 0.9 % NaCl as
described previously [6,11,12,19]. Control rats received
only the solvent. Sodium, protein and creatinine levels
were measured in 24 h urine samples. Urinary sodium
and protein excretion was calculated as a function of
urinary creatinine excretion. On the experimental days,
animals were anaesthetized with sodium pentobarbital
(50 mg\kg body weight ; intraperitoneal), and the kidneys were removed, frozen immediately in liquid nitrogen and kept at k80 mC until further use. Tissues were
powdered with a mortar and pestle in a mixture of solid
CO and acetone before being used for RNA extraction.
#
Plasma aldosterone concentrations were determined
using a commercially available RIA (Diagnostic Products
Corp., Los Angeles, CA, U.S.A. ; Iodine-125 tracer,
Coat-A-Count). Approx. 0.2 ml of plasma was used for
one measurement.
RNA extraction
Kidneys were homogenized in RNA extraction buffer
(4 M guanidinium thiocyanate, 25 mM sodium citrate,
pH 7.0, 0.5 % sarcosyl and 0.1 M 2-mercaptoethanol
[20]) using a Polytron. Total RNA was extracted according to the method of Chomczynski and Sacchi [20]
with minor modifications. Briefly, the RNA pellet
resulting from the first precipitation was resuspended in
diethyl pyrocarbonate-treated water, and 0.1 vol. of 2 M
sodium acetate and 1 vol. of phenol, pH 4.0, were added
sequentially [20]. The suspension was vortexed and
centrifuged at 10 000 g for 20 min. The upper phase was
precipitated with propan-2-ol at k20 mC for 1 h.
Reverse transcription (RT)
RT was performed using 2 µg of total RNA in a final
volume of 20 µl. RNA was incubated with 500 ng of
oligo(dT) primer at 65 mC for 5 min, followed by incubation at room temperature for 15 min. Samples were
then incubated with 250 µM of each dNTP, 20 units of
RNase inhibitor and 25 units of avian myeloblastosis
virus reverse transcriptase (Roche, Rotkreuz, Switzerland) in 1ibuffer (50 mM Tris\HCl, 40 mM MgCl ,
#
30 mM KCl, 1 mM dithiothreitol, pH 8.5) at 42 mC for
1 h. For control reactions (RT−), enzymes were replaced
by diethyl pyrocarbonate-treated water.
Experimental animals
Male Sprague–Dawley rats (170–210 g body weight) were
housed in metabolic cages with free access to normal rat
chow diet and water. The animal work was undertaken
according to Swiss national legislation governing the use
of animals, and the committee on animal research at the
University of Berne approved the protocol. After an
adaptation period of 5 days so that the rats were in
sodium balance, PAN nephrotic syndrome was induced
by a single intraperitoneal injection of PAN (Alexis
# 2003 The Biochemical Society and the Medical Research Society
Real-time PCR
Primers (Microsynth, Balgach, Switzerland) and TaqMan
probes (Applied Biosystems, Rotkreuz, Switzerland)
unique for each rat isoform were designed (Table 1),
optimized and validated. Real-time quantitative TaqMan
PCR using an ABI Prism 7700 Sequence Detection
System and TaqMan Universal PCR Master Mix
(Applied Biosystems) was performed according to the
manufacturer’s protocol. Diluted RT samples (10 ng of
Epithelial sodium channel and nephrotic syndrome
Table 1 Primers and probes unique for each rat ENaC
isoform used in real-time quantitative TaqMan PCR
Gene
Primer/probe
Sequence
αENaC
Forward
Reverse
Probe
CAGGGTGATGGTGCATGGT
CCACGCCAGGCCTCAAG
TGAAGCCACCATCATCCATAAAGGCAG
βENaC
Forward
Reverse
Probe
CATAATCCTAGCCTGTCTGTTTGGA
CAGTTGCCATAATCAGGGTAGAAGA
CCCTGCAGTCATCGGAACTTCACACCT
γENaC
Forward
Reverse
Probe
TGCAAGCAATCCTGTAGCTTTAAG
GAAGCCTCAGACGGCCATT
AATGGACACTGACCACCAGCTTGGC
GAPDH
Forward
Reverse
Probe
CTGCCAAGTATGATGACATCAAGAA
AGCCCAGGATGCCCTTTAGT
TCGGCCGCCTGCTTCACCA
total RNA) were amplified in a final volume of 25 µl.
Primers were used at a concentration of 200 nM and
probes (FAM\TAMRA-labelled) at a concentration of
100 nM, except for γENaC, for which the probe concentration was 200 nM. Glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) was used as a housekeeping
gene and was amplified in separate reactions. RT+ reactions were performed in triplicate, and RT− (control)
reactions in duplicate. The thermal cycling conditions
were as follows : 50 mC for 2 min and 95 mC for 10 min,
followed by 40 cycles of 95 mC for 15 s and 60 mC for
1 min.
Relative quantification of gene expression
Relative quantification of ENaC expression was carried
out using the arithmetic formula method (Applied
Biosystems User Bulletin 2, 1997). The average threshold
cycle (CT) value for GAPDH was subtracted from the
average CT values for αENaC, βENaC and γENaC for
each RT sample to obtain the ∆CT values. The CT value
represents the PCR cycle at which a statistically significant increase in reporter fluorescence is first detected. For
each group of experimental animals, the average ∆CT
values for αENaC, βENaC and γENaC of the control
animals were determined and used as the calibrators. For
each nephrotic animal, the ∆∆CT values for αENaC,
βENaC and γENaC were calculated by subtracting the
respective calibrator from the individual ∆CT value. The
relative amounts of mRNA for αENaC, βENaC and
γENaC of the animals with nephrotic syndrome compared with the controls was calculated by using the
formula 2−∆∆CT.
prepared. Frozen powdered kidney tissue was homogenized in cold sucrose buffer using FastPROTEIN
GREEN tubes (Lysing Matrix D ; Q-Biogene, Alexis
Corp.) and a BIO 101 Savant FastPrep FP120 device (QBiogene) at a speed of 4.0 units for 20 s. The homogenized
tissue was centrifuged at 2100 g for 10 min at 4 mC. The
supernatant was kept on ice and the pellet, dissolved in
sucrose buffer, was centrifuged again at the same speed.
The second supernatant was pooled with the first
supernatant and the protein concentration was determined using a BCA Protein Assay Reagent Kit (Pierce).
From each sample, 30 µg of protein was incubated with
Laemmli buffer at 37 mC for 30 min and then loaded
immediately on to 10 % (v\v) polyacrylamide gels.
Proteins were transferred from the gels to PVDF membranes (Immobilon ; Millipore Corp., Bedford, MA,
U.S.A.). Blots were blocked with 5 % (w\v) non-fat milk
at room temperature for 90 min and incubated with the
appropriate affinity-purified polyclonal antibody overnight at 4 mC (see below). The secondary antibody
conjugated to horseradish peroxidase was a rabbit antichicken\turkey IgG for βENaC (Zymed, San Francisco,
CA, U.S.A.) protein and a swine anti-rabbit IgG (DAKO,
Glostrup, Denmark) for αENaC and γENaC. Antibody
binding was visualized by enhanced chemiluminescence
(ECL2 ; Amersham Pharmacia Biotech). Densitometry
of individual bands was performed using the Scion Image
software.
Affinity-purified rabbit antibody against αENaC was
a gift from Dr L. Dijkink (Universiteit Nijmegen, The
Netherlands), and rabbit antibody against γENaC was
from Dr Nicolette Farman (INSERM U478, Paris,
France). The antibody against βENaC was raised in
chickens using the peptide (amino acids 46–68) NH #
CNYDSLRLQPLDTMESDSEVEAI (Davids Biotechnology, Regensburg, Germany) [21].
Statistics
Statistical analyses were performed with SYSTAT 9.0 for
Windows (SPSS Inc., Chicago, IL, U.S.A.). Metabolic
data were compared using the two-sample t test. ENaC
expression data were compared using the two-sample t
test on the average ∆CT values of each animal. Signals for
RT− of
40 cycles were observed in 11 % of all RT−
reactions (results not shown). These signals constituted
on average 0.01 % of those of the respective RT+
reactions, and were therefore considered as negligible.
Results are presented as meanspS.D.
RESULTS
Western blots
Metabolic studies
Sucrose buffer containing 250 mM sucrose, 1 µg\ml
leupeptin (Sigma), 10 mM triethanolamine (Merck) and
0.1 mg\ml PMSF (Calbiochem), pH 7.6, was freshly
Urinary sodium excretion increased on day 1 in rats after
PAN injection (PAN, 29.4p0.75 mmol\mmol of creatinine ; control, 19.5p0.5 mmol\mmol ; P 0.001), and
# 2003 The Biochemical Society and the Medical Research Society
391
392
A. Audige! and others
Figure 2 Expression of ENaC subunit mRNAs in kidneys from
rats with PAN-induced nephrotic syndrome
Figure 1 Renal excretion of sodium and protein by rats with
PAN-induced nephrotic syndrome
The time courses of urinary sodium excretion (A) and proteinuria (B) after a single
intraperitoneal injection of PAN (
, >) or vehicle (, =) into male
Sprague–Dawley rats are shown. Results on day 0 correspond to the 24 h urine
sample collected the day before induction of nephrotic syndrome. Urinary sodium
excretion and proteinuria values are meanspS.D. from five groups of animals for
days 0 and 1, from four groups of animals for days 2 and 3, from two groups of
animals for days 4–6, and from one group of animals for days 7–12. Each group
consisted of six PAN-treated and six control rats. Significant differences between
PAN-treated and control rats : *P 0.001.
decreased on days 2 and 3 to levels that were lower than
control levels [day 2 : PAN, 10.2p0.5 mmol\mmol ; control, 16.5p0.4 mmol\mmol (P 0.01) ; day 3 : PAN,
8.3p0.6 mmol\mmol ; control, 13.8p0.7 mmol\mmol
(P 0.001)] (Figure 1A). Sodium excretion returned to
control levels on day 4, decreased again on day 5, and
reached the lowest level on day 6 (PAN, 7.5p1.3 mmol\
mmol ; control, 15.1p0.5 mmol\mmol ; P 0.001). This
retention period was followed by increased urinary
sodium excretion from days 9 to 11. Following injection
of PAN, proteinuria was first evident on day 4, reached
the highest level on day 8, and remained high until the
end of the experimental period (Figure 1B). The mean
daily urinary creatinine excretion was not different in
PAN-treated rats and controls (results not shown).
# 2003 The Biochemical Society and the Medical Research Society
For each time point, the relative amount of mRNAs for αENaC, βENaC and γENaC
in kidneys from six nephrotic animals (five on day 1) (
) compared with six
control animals () is given. Plots comprise results from two TaqMan PCR
experiments (four experiments for αENaC on day 1). Results are meanspS.D.
Significant differences between PAN-treated and control rats : *P 0.05,
**P 0.01, ***P 0.001.
Expression of ENaC mRNAs and plasma
aldosterone concentrations
Expression of αENaC and βENaC mRNAs in the
kidneys of rats exposed to PAN was markedly increased
relative to controls on day 1 (αENaC, 2.5-fold ; βENaC,
1.9-fold ; P 0.001) (Figure 2). Expression of αENaC
and βENaC mRNAs on day 2 was still significantly
higher than control levels (αENaC, 1.4-fold, P 0.01 ;
βENaC, 1.5-fold, P 0.05). On day 3, expression of all
three subunit mRNAs was decreased to very low levels
compared with controls (αENaC, decreased to 20 %,
P 0.01 ; βENaC, decreased to 40 %, P 0.05 ; γENaC,
decreased to 30 %, P 0.05). On days 6 and 12, alterations in ENaC subunit mRNA levels were less pronounced compared with the preceding time points.
Differences reached statistical significance for αENaC on
day 6 (reduction to 80 % ; P 0.05), as well as for αENaC
and γENaC on day 12 (reduction to 70 % ; P 0.05).
On days 1 and 2, the increased abundance of αENaC
and βENaC mRNAs in the kidneys of rats exposed to
PAN occurred in the presence of increased plasma
Epithelial sodium channel and nephrotic syndrome
decreased on day 3. Furthermore, on day 6 and 12,
aldosterone concentrations remained elevated, whereas
the levels of ENaC subunit mRNAs were either decreased or unchanged (Figures 2 and 3).
ENaC subunit protein expression
Figure 3 Plasma aldosterone concentrations in rats with
PAN-induced nephrotic syndrome
For each time point, the plasma aldosterone concentration was measured in six
nephrotic animals (4) and compared with that in six control animals (5).
Results for each day are from an independent group of animals. Plasma
aldosterone levels were increased in animals with PAN-induced nephrotic syndrome
when compared with control animals during the whole study period (day 1,
P 0.01 ; days 2, 3 and 6, P 0.002 ; day 12, P 0.0001).
The abundance of αENaC protein in proteinuric rats was
decreased on day 2 (P 0.01) and increased on day 6
(P 0.05) when compared with that in control animals
(Figure 4). Despite the presence of increased plasma
aldosterone concentrations (Figure 3), the abundance of
βENaC or γENaC protein was not significantly changed
throughout the study (Figure 4). When sodium excretion
reached its lowest level, on day 6 (Figure 1), the
abundance of αENaC protein was increased in PANtreated animals when compared with control animals
(P 0.05) ; similarly, the amounts of βENaC and
γENaC protein tended to be non-significantly increased
(Figure 4).
DISCUSSION
Figure 4 Expression of ENaC subunit proteins in kidneys
from rats with PAN-induced nephrotic syndrome (densitometry)
For each time point, the protein expression of αENaC, βENaC and γENaC in
kidneys from six nephrotic animals (five on day 1) (
) compared with that
in six control animals () is shown. Results are meanspS.D. Significant differences between PAN-treated and control rats : *P 0.05, **P 0.01.
aldosterone concentrations (Figure 3). However, despite
continued increased aldosterone concentrations, the expression of αENaC, βENaC and γENaC mRNAs was
PAN is a xenobiotic that induces a nephrotic syndrome
with proteinuria and sodium retention in rats [22]. The
time course and profile of urinary sodium excretion and
proteinuria following exposure to PAN have been
studied in detail [11]. In line with that study, sodium
retention occurred on days 2–3 and 5–7 in our PANtreated animals (Figure 1A), and proteinuria started on
day 5 (Figure 1B). The present investigation demonstrates
that, following PAN administration, (i) aldosterone
concentrations increase, (ii) mRNA levels of ENaC
subunits change, and (iii) these changes in mRNA levels
are not paralleled by the amount of ENaC subunit
protein expression.
The renal site of salt retention in experimental nephrotic syndrome has been determined by micropuncture
and clearance studies to be beyond the distal convoluted
tubule, most likely in the CCD [10,23]. Two proteins
constitute the main determinants of distal tubular sodium
transport : the Na+,K+-ATPase pump in the basolateral
membrane and the apically located ENaC. Na+,K+ATPase activity in the CCD correlates with urinary
sodium excretion in three experimental models of nephrotic syndrome in rats [11]. The activity of the pump is
regulated by several mechanisms, including an increase in
intracellular sodium concentration through activation of
the ENaC [24]. In in vitro microperfusion studies with
amiloride, a collecting duct diuretic that blocks the
ENaC, sodium balance could be restored in CCDs from
nephrotic animals [9].
In our present study, sodium excretion was decreased
on days 2 and 3, but returned to control values on days 4
and 8, in rats treated with PAN (Figure 1A). Whether the
increase in urinary sodium excretion on day 1, an
# 2003 The Biochemical Society and the Medical Research Society
393
394
A. Audige! and others
observation made by other investigators previously,
represents a non-specific toxic effect of the agent on
tubular sodium transport is unknown [11]. The stimulation of Na+,K+-ATPase activity in PAN-treated animals might explain renal sodium retention during the
early phase of this model of nephrotic syndrome
[6,11,12]. Aldosterone controls sodium reabsorption in
the CCD by acting on the basolateral cell surface expression of Na+,K+-ATPase and by regulating the apical cell
surface expression of ENaC [25–27]. In our nephrotic
rats, αENaC and βENaC mRNA expression was upregulated 1 and 2 days after PAN injection ; however,
mRNA expression of all three ENaC subunits was
strongly down-regulated on day 3, despite the presence
of very high plasma aldosterone levels (Figures 2 and 3).
The increased expression of αENaC and βENaC mRNAs
on days 1 and 2 occurred in the presence of high
aldosterone levels, and the pattern of this increase in the
three different ENaC subunit mRNAs is comparable
with the effect of aldosterone on αENaC, βENaC and
γENaC mRNA expression in A6 cells [28]. Conversely,
the decreased ENaC mRNA expression on day 3, an
effect compatible with the observed transitory enhancement of sodium excretion on day 4, also occurred in the
presence of high plasma aldosterone levels (Figures 2 and
3). The mechanism for this escape of ENaC mRNA
expression from regulation by aldosterone is unknown.
A speculative mechanism for the strong sodium retention
on day 3, despite markedly down-regulated ENaC
subunit mRNA levels, could be a diminished clearance of
ENaC from the cell membrane, leading to elevated ENaC
cell surface expression, mediated by Nedd4-2 or
N4WBP5A, novel Nedd4\Nedd4-2-interacting protein
[29–31]. It is conceivable that proteins that are abnormally filtered in proteinuric disease states activate such
signalling pathways.
Significant sodium retention occurred from day 5 to
day 7 in the presence of high plasma aldosterone
concentrations (Figures 1 and 3). During this period of
sodium retenion, ENaC mRNAs normalized and protein
levels of ENaC subunits remained unchanged (Figures 2
and 4). Although we did not measure relative mRNA
abundance in defined tubular segments, but only in
whole kidneys, it is tempting to speculate that this
regulation occurred in the CCD. ENaC mRNA expression was not accompanied by corresponding changes
in protein concentration. Thus it is not possible to
link the amount of ENaC protein with transcription.
A possible explanation could be increased trafficking
of ENaC subunits from intracellular stores to the
cell membrane [32]. In the present investigation, we measured the total amount of ENaC protein by Western blot.
It is conceivable that the intracellular localization of
ENaC subunits is altered in the PAN-induced disease
state, an effect that might have been missed by our
analyses.
# 2003 The Biochemical Society and the Medical Research Society
From day 8 to day 12, increased sodium loss despite
high plasma aldosterone levels was observed in the PANtreated animals. The simplest explanation for this
increased sodium loss is a dysregulation of protein
synthesis and\or of functional incorporation of ENaC
into the plasma membrane. This would be in line with
the stable amounts of ENaC subunit proteins measured
during this study period (Figure 4).
An alternative mechanism for the stimulation of ENaC
in experimental nephrotic syndromes might involve
vasopressin. First, plasma vasopressin levels are elevated
during the early phase of PAN-induced nephrotic syndrome. Secondly, in a rat model of acute and chronic
elevation of circulating levels of vasopressin, increases in
the levels of αENaC, βENaC and γENaC subunits were
shown in the kidney by quantitative immunoblotting
[33–35]. However, the pattern of αENaC, βENaC and
γENaC subunits reported was different from our observations (Figure 2), in that all three subunits were increased
in the vasopressin model, with a 2-fold increase for
βENaC and 3-fold increase for γENaC measured at day
7 [35]. Furthermore, in A6 cells incubated with vasopressin, a selective elevation in the level of βENaC
mRNA was observed [36]. The different patterns of
αENaC, βENaC and γENaC subunit mRNAs observed
in the PAN-induced nephrotic syndrome in our animal
model suggests that other, as yet undefined, mechanisms
regulate ENaC expression in this disease. Interestingly,
PAN-induced nephrotic syndrome with renal sodium
retention appears to be independent of vasopressin
activity, as shown in Brattleboro rats, which genetically
lack vasopressin secretion [11].
In conclusion, our results show that levels of ENaC
subunit mRNAs, especially αENaC, are up-regulated
during the early phase of PAN-induced nephrotic syndrome. This stimulation of ENaC expression is associated
with sodium retention. ENaC mRNA levels appear to
escape from regulation by aldosterone after day 3. No
direct relationship between ENaC mRNA expression
and ENaC protein amount was observed, indicating that
additional mechanism(s) for the enhanced ENaC activity
have to be considered.
ACKNOWLEDGMENTS
This work was supported by two grants from the Swiss
National Foundation for Scientific Research (no. 3257205.99 and no. 31-061505.00). We thank Dr L. Dijkink
(Universiteit Nijmegen, The Netherlands) for providing
the anti-αENaC antibody, Dr Nicolette Farman
(INSERM U478, Paris, France) for the anti-γENaC
antibody, and Bernhard Dick, Claude Jenny and Elisabeth Calame for technical assistance in the metabolic
studies.
Epithelial sodium channel and nephrotic syndrome
18
REFERENCES
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
Cameron, J. S. (1987) The nephrotic syndrome and its
complications. Am. J. Kidney Dis. 10, 157–171
Geers, A. B., Koomans, H. A., Roos, J. C., Boer, P. and
Dorhout Mees, E. J. (1984) Functional relationships in the
nephrotic syndrome. Kidney Int. 26, 324–330
Vande Walle, J. G., Donckerwolcke, R. A., van Isselt,
J. W., Derkx, F. H., Joles, J. A. and Koomans, H. A.
(1995) Volume regulation in children with early relapse of
minimal-change nephrosis with or without hypovolaemic
symptoms. Lancet 346, 148–152
Perico, N., Delaini, F., Lupini, C. et al. (1989) Blunted
excretory response to atrial natriuretic peptide in
experimental nephrosis. Kidney Int. 36, 57–64
Kalant, N., Das Gupta, D., Despointes, R. and Giroud,
C. J. P. (1962) Mechanisms of edema in experimental
nephrosis. Am. J. Physiol. 201, 91–96
Vogt, B. and Favre, H. (1991) Na+,K+-ATPase activity
and hormones in single nephron segments from nephrotic
rats. Clin. Sci. 80, 599–604
Firth, J. D. and Ledingham, J. G. (1990) Effect of
natriuretic agents, vasoactive agents and of the inhibition
of metabolism on sodium handling in the isolated
perfused kidney of the nephrotic rat. Clin. Sci. 79,
559–574
Firth, J. D., Raine, A. E. and Ledingham, J. G. (1989)
Abnormal sodium handling occurs in the isolated
perfused kidney of the nephrotic rat. Clin. Sci. 76,
387–395
Deschenes, G., Wittner, M., Stefano, A., Jounier, S. and
Doucet, A. (2001) Collecting duct is a site of sodium
retention in PAN nephrosis : a rationale for amiloride
therapy. J. Am. Soc. Nephrol. 12, 598–601
Ichikawa, I., Rennke, H. G., Hoyer, J. R. et al. (1983)
Role for intrarenal mechanisms in the impaired salt
excretion of experimental nephrotic syndrome. J. Clin.
Invest. 71, 91–103
Deschenes, G. and Doucet, A. (2000) Collecting duct
Na+\K+-ATPase activity is correlated with urinary
sodium excretion in rat nephrotic syndromes. J. Am.
Soc. Nephrol. 11, 604–615
Feraille, E., Vogt, B., Rousselot, M. et al. (1993)
Mechanism of enhanced Na-K-ATPase activity in cortical
collecting duct from rats with nephrotic syndrome.
J. Clin. Invest. 91, 1295–1300
Zolty, E., Ibnou-Zekri, N., Izui, S., Feraille, E. and
Favre, H. (1999) Glomerulonephritis and sodium
retention : enhancement of Na+\K+-ATPase activity in
the collecting duct is shared by rats with puromycin
induced nephrotic syndrome and mice with spontaneous
lupus-like glomerulonephritis. Nephrol. Dial.
Transplant. 14, 2192–2195
Duc, C., Farman, N., Canessa, C. M., Bonvalet, J. P. and
Rossier, B. C. (1994) Cell-specific expression of epithelial
sodium channel alpha, beta, and gamma subunits in
aldosterone-responsive epithelia from the rat : localization
by in situ hybridization and immunocytochemistry.
J. Cell Biol. 127, 1907–1921
Renard, S., Voilley, N., Bassilana, F., Lazdunski, M. and
Barbry, P. (1995) Localization and regulation by steroids
of the alpha, beta and gamma subunits of the amiloridesensitive Na+ channel in colon, lung and kidney. Pflu$ gers
Arch. Eur. J. Physiol. 430, 299–307
Canessa, C. M., Horisberger, J. D. and Rossier, B. C.
(1993) Epithelial sodium channel related to proteins
involved in neurodegeneration. Nature (London) 361,
467–470
Canessa, C. M., Schild, L., Buell, G. et al. (1994)
Amiloride-sensitive epithelial Na+ channel is made of
three homologous subunits. Nature (London) 367,
463–467
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
Stokes, J. B. and Sigmund, R. D. (1998) Regulation of
rENaC mRNA by dietary NaCl and steroids : organ,
tissue, and steroid heterogeneity. Am. J. Physiol. 274,
C1699–C1707
Daniel, C., Ziswiler, R., Frey, B., Pfister, M. and Marti,
H. P. (2000) Proinflammatory effects in experimental
mesangial proliferative glomerulonephritis of the
immunosuppressive agent SDZ RAD, a rapamycin
derivative. Exp. Nephrol. 8, 52–62
Chomczynski, P. and Sacchi, N. (1987) Single-step
method of RNA isolation by acid guanidinium
thiocyanate-phenol-chloroform extraction.
Anal. Biochem. 162, 156–159
Masilamani, S., Kim, G. H., Mitchell, C., Wade, J. B. and
Knepper, M. A. (1999) Aldosterone-mediated regulation
of ENaC alpha, beta, and gamma subunit proteins in rat
kidney. J. Clin. Invest. 104, R19–R23
Frenk, S., Antonowicz, I., Craig, J. M. and Mercoff, J.
(1955) Experimental nephrotic syndrome induced in rats
by aminonucleoside : Renal lesions and body fluid
composition. Proc. Soc. Exp. Biol. Med. 89, 424–427
Bernard, D. B., Alexander, E. A., Couser, W. G. and
Levinsky, N. G. (1978) Renal sodium retention during
volume expansion in experimental nephrotic syndrome.
Kidney Int. 14, 478–485
Blot-Chabaud, M., Jaisser, F., Gingold, M., Bonvalet, J. P.
and Farman, N. (1988) Na+-K+-ATPase-dependent
sodium flux in cortical collecting tubule. Am. J. Physiol.
255, F605–F613
Summa, V., Mordasini, D., Roger, F. et al. (2001) Short
term effect of aldosterone on Na,K-ATPase cell surface
expression in kidney collecting duct cells. J. Biol. Chem
276, 47087–47093
Beron, J. and Verrey, F. (1994) Aldosterone induces early
activation and late accumulation of Na-K-ATPase at
surface of A6 cells. Am. J. Physiol. 266, C1278–C1290
Feraille, E. and Doucet, A. (2001) Sodium-potassiumadenosine triphosphatase-dependent sodium transport in
the kidney : hormonal control. Physiol. Rev. 81, 345–418
May, A., Puoti, A., Gaeggeler, H. P., Horisberger, J. D.
and Rossier, B. C. (1997) Early effect of aldosterone on
the rate of synthesis of the epithelial sodium channel
alpha subunit in A6 renal cells. J. Am. Soc. Nephrol. 8,
1813–1822
Debonneville, C., Flores, S. Y., Kamynina, E. et al. (2001)
Phosphorylation of Nedd4-2 by Sgk1 regulates epithelial
Na+ channel cell surface expression. EMBO J. 20,
7052–7059
Kamynina, E., Debonneville, C., Bens, M., Vandewalle,
A. and Staub, O. (2001) A novel mouse Nedd4 protein
suppresses the activity of the epithelial Naj channel.
FASEB J. 15, 204–214
Konstas, A. A., Shearwin-Whyatt, L. M., Fotia, A. B.
et al. (2002) Regulation of the epithelial sodium channel
by N4WBP5A, a novel Nedd4\Nedd4-2-interacting
protein. J. Biol. Chem. 277, 29406–29416
Horisberger, J. D. (1998) Amiloride-sensitive Na
channels. Curr. Opin. Cell Biol. 10, 443–449
Apostol, E., Ecelbarger, C. A., Terris, J., Bradford, A. D.,
Andrews, P. and Knepper, M. A. (1997) Reduced renal
medullary water channel expression in puromycin
aminonucleoside-induced nephrotic syndrome. J. Am.
Soc. Nephrol. 8, 15–24
Pyo, H. J., Summer, S. N., Niederberger, M., Kim, J. K.
and Schrier, R. W. (1995) Arginine vasopressin gene
expression in rats with puromycin-induced nephrotic
syndrome. Am. J. Kidney Dis. 25, 58–62
Ecelbarger, C. A., Kim, G. H., Terris, J. et al. (2000)
Vasopressin-mediated regulation of epithelial sodium
channel abundance in rat kidney. Am. J. Physiol. Renal
Physiol. 279, F46–F53
Weisz, O. A., Wang, J. M., Edinger, R. S. and Johnson,
J. P. (2000) Non-coordinate regulation of endogenous
epithelial sodium channel (ENaC) subunit expression at
the apical membrane of A6 cells in response to various
transporting conditions. J. Biol. Chem. 275, 39886–39893
Received 19 August 2002/20 December 2002; accepted 24 January 2003
# 2003 The Biochemical Society and the Medical Research Society
395