Download Tamarindus indica L. patterns of diversity from the genetic to the

Tropical Ecology 55(1): 19-32, 2014
© International Society for Tropical Ecology
www.tropecol.com
ISSN 0564-3295
Tamarindus indica L. patterns of diversity from the genetic to the
niche-species level in East Africa
P. NYADOI
1,2 *
2
2
2
3
3
, P. OKORI , J.B.L. OKULLO , J. OBUA , S FLUCH , K. BURG & R. JAMNADASS
1
Conservation Consult and Research Company Uganda Limited, P.O. Box 7412
Kampala, Uganda
2
Makerere University, P.O.BOX 7062 Kampala, Uganda
3
4
Austrian Institute of Technology Department of Environment and Health (formally the
Austrian Research Centers GmbH–ARC, Department of Genetics and Bioresources),
A-2444 Seibersdorf, Austria
World Agroforestry Centre (ICRAF), United Nations Avenue, Gigiri P.O. Box 30677-00100
GPO, Nairobi, Kenya
Abstract: For economically important, increasingly threatened species like tamarind is in
East Africa, proper knowledge and maintenance of diversity existing within their populations
and communities is key to attaining sustainability. The objective of our study was to generate
knowledge on patterns of diversity from genetic to niche-species level for tamarind in East
Africa. We hypothesized that patterns of diversity at these three levels would be similar, given
possible cross-acting homogeneous spatial- temporal evolutionary factors in East Africa. Results
obtained from a spatial-temporal homogeneous study of diversity in tamarind from genetic,
morphological to niche-tree species levels were synthesized for patterns. A unidirectional
pattern across the three levels emerged and we envisage that maintaining this diversity model
will help long-term conservation of tamarind and its niche-tree species in East Africa. However,
further investigations to establish causative factors for the observed unidirectional diversity
pattern will be necessary to elucidate the required management strategies.
Resumen: Para especies de importancia económica y cada vez más amenazadas, como lo es
el tamarindo en África Oriental, el conocimiento adecuado y el mantenimiento de la diversidad
que existe en sus poblaciones y comunidades son clave para alcanzar su sostenibilidad. El
objetivo de nuestro estudio fue generar conocimiento sobre los patrones de diversidad desde el
nivel genético hasta el de especie-nicho para el tamarindo en África Oriental. Hipotetizamos que
los patrones de diversidad en los tres niveles considerados sería similar, en virtud de posibles
factores evolutivos espacio-temporales homogéneos y de efectos cruzados en África Oriental. Los
resultados obtenidos a partir de un estudio homogéneo espacio-temporal de la diversidad en el
tamarindo, abarcando los niveles genético, morfológico y el de especie-nicho de los árboles
fueron sintetizados en la búsqueda de patrones. Emergió un patrón unidireccional a través de
los tres niveles y nosotros proponemos que el mantenimiento de este modelo de diversidad
contribuirá a la conservación a largo plazo del tamarindo y de las especies-nicho de árboles en
África Oriental. Sin embargo, hacen falta nuevas investigaciones para establecer los factores
causales del patrón unidireccional de diversidad observado que permitan elucidar las
estrategias de manejo requeridas.
Resumo: Para as espécies economicamente importantes, cada vez mais ameaçadas como é o
*Corresponding
Author; e-mail: [email protected], [email protected], [email protected]
4
20
TAMARINDUS INDICA DIVERSITY MODELS
tamarindo na África oriental, o conhecimento adequado e a manutenção da diversidade
existente nas suas populações e comunidades é essencial para atingir a sustentabilidade. O
objetivo do nosso estudo foi o de gerar conhecimento sobre os padrões de diversidadeindo do
nível genética ao de nicho das espécies para o tamarindo na África Oriental. Trabalhámos com a
hipótese de que os padrões de diversidade destes três níveis seria semelhante, dadaas possíveis
acções cruzadas homogéneas dos factores evolutivos no espaço e tempo na África Oriental. Os
resultados obtidos a partir de um estudo espacial-temporal homogéneo da diversidade no
tamarindo,indo da genética, à morfologia e ao níveldo nicho de espécies arbóreas, foram
sintetizados por padrões. Emergiuum padrão unidireccional entre os três níveis e prevemos que
a manutenção deste modelo de diversidade ajudará, a longo prazo, a conservação do tamarindo e
do seu nicho de espécies de árvores na África Oriental. No entanto, outras investigações para
estabelecer os factores causais para o padrão unidireccionalde diversidade observadoserão
necessárias para elucidar as estratégias de gestão requeridas.
Key words: Conservation, diversity models, East Africa, Tamarindus indica.
Introduction
Species diversity dynamics are a result of
historical, ecological and evolutionary factors and
these vary spatially and temporally (Barantes &
Sandoval 2009). For example, correlations in
diversity pattern from genetic to niche-species
levels have been reported where such factors are
homogeneous (Booth & Grime 2003; Lowe et al.
2005; Ma 2006; Vellend & Geber 2005). Understanding patterns of diversity based on different
diversity indices and the causes of observed diversity patterns at different ecological scales help
provide knowledge on the needs and strategies for
species conservation (Barantes & Sandavol 2009).
Unfortunately, few diversity models have been
derived based on spatio-temporally homogenous
studies, which would help yield knowledge
applicable in day-to-day management of diversity
for long-term conservation of species. Many of the
existing diversity models are mainly drawn from
reviews of studies conducted in different regions
and times (Frankham et al. 2002; Lowe et al. 2005;
Reed & Frankham 2001; Vellend & Geber 2005).
The few recent investigations on diversity
models based on spatio-temporally homogeneous
studies reported correlations in diversity from
genetic to community/species level in an experimental setting (Booth & Grime 2003) and in
morphological and genetic diversity in Adansonia
digitata (Assogbadjo et al. 2006). More spatiotemporally homogenous studies of diversity patterns
for the species are necessary to help generate
knowledge, establish models being drawn from
reviews, and for immediate application in
identification of conservation strategies for species.
Such investigations are especially needed for
economically exploited species whose populations
and adaptations need strategic conservation to
enable sustainability (Fisher 1930; Ledig 1986;
Gebureka 1997; Lowe et al. 2004).
In East Africa, Tamarindus indica L. (hereafter, tamarind) is an economically important
species. However, the economic benefit from
tamarind to dependent communities is threatened
as the species’ natural populations face depletion
due to over-exploitation, habitat loss, and absence
of systematic conservation strategies (FAO 2004;
Jama et al. 2005; Nyadoi et al. 2011). Another
study has also shown that the East African population of tamarind is of conservation importance
globally as the center of genetic diversity (Nyadoi
2010; Nyadoi et al. 2010b). Thus, tamarind conservation in East Africa is critical regionally for livelihoods of the people dependent on it and also
globally for the preservation of important genetic
resources.
Knowledge of and maintenance of diversity
and diversity relationships from genetic to nichespecies level is generally the advanced ideal
conservation approach for species of economic
importance (Gebureka 1997; Ledig 1986; Margules
& Pressey 2000). For tamarind this approach could
not yet be adopted as existing knowledge on its
diversity and diversity relationships from genetic
to niche species level were scant. In East Africa,
and even globally, diversity studies done on
tamarind have been focused on one or two diver-
NYADOI et al.
Fig. 1. Map of East Africa showing sites from which tamarind were studied for diversity patterns.
21
22
TAMARINDUS INDICA DIVERSITY MODELS
sity levels and not on all the three levels of
diversity at once (El-Sidig et al. 2006; Nyadoi et al.
2011; Pushpakumara et al. 2007, for example).
Only recently, a study was done on diversity in
tamarind from genetic to niche species level
(Nyadoi 2010). However, synthesis and findings on
diversity models from the study have not yet been
published for wider applications. This paper
synthesizes and presents the knowledge generated
on tamarind diversity patterns from genetic to
niche-tree-species level from the results of the
2007 - 2008 East African population study, for
wider application for conservation management in
growing areas.
Materials and methods
This paper is based on synthesis of data
obtained on tamarind morphological (height,
crown sectional area, diameter at breast height),
genetic (mitochondria and chloroplast haplotypes)
and niche-tree-species diversity studies conducted
in East Africa (Uganda, Tanzania and Kenya) in
2007 (Nyadoi et al. 2009a, b, 2010a, b).
Study sites and sampling units within selected
study sites
Study sites/environments (Fig. 1) were selected
based on the diversity of factors affecting species
evolution (Hartl & Clark 1997; Jeffrey et al. 2004;
Margules & Pressey 2000; Young et al. 2000). We
included vegetation types (White 1983), climate
(temperature and rainfall zones), Western and
Eastern Rift Valley Zones (Fig. 1); within these,
tamarind was sampled from farms (on-farm), and
from woodlands and riverbanks.
Within a habitat, the first tamarind individual
was sampled randomly on encounter and subsequent individuals were sampled at systematic
intervals ≥ 500 m. From each sampled tamarind
the following data or materials were collected: leaves
for DNA characterisation, tree height, diameter at
breast height and crown radii measured using
standard methods. All other tree species found
within 18 m radius with the tamarind stem as the
centre were then enumerated. The geographic
position coordinates of the tamarind were recorded
using a global positioning system receiver (GPS).
Further, for tamarind trees from on-farm sites,
farmers were further interviewed to obtain data on
their establishment methods (i.e., whether tamarind
was planted or it grew naturally (wild)). Total
number of tamarind trees studied from each of the
three countries of East Africa is shown (Table 1).
In addition to tamarind and its niche-tree species
parameters recorded, soils were sampled using
standard methods from under the trees studied,
and the climatic conditions (rainfall and temperature) of the sites obtained for analysis.
Table 1. Number of tamarind trees and seeds
sampled from the diverse areas of East Africa, used
in the study.
Country in
East Africa
Uganda
Tanzania
Kenya
Total number
of tamarind
trees studied
Number of tamarind
trees sampled and
Latitudes
studied for diversity
(in degrees )
patterns from genetic
to niche-tree-species
levels
61
0-30º North
58
0-30º South
91
0-30º South
and
0-30º North
210
Specific study steps, data collection and
analysis
Step 1. DNA characterisation of sampled tamarind
leaves
DNA was isolated from all the leaves sampled,
using Quiagen protocol of 2006. The DNA was
subjected to polymerase chain reaction (PCR) with
over 30 different markers, of which, during the
screening stage, only five were able to amplify well
and reveal polymorphism in tamarind (see Appendix Table 1). Overall, the chloroplast genome
showed high level of uniformity with very few
unique haplotypes for tamarind and only the
mitochondria Cox 11 was able to reveal considerable diversity within the East Africa tamarind
populations (Nyadoi 2005). The diversity observed
in the chloroplast genome has been omitted in this
paper, due to the high level of homogeneity found.
Homogeneity in the chloroplast genome for
tamarind has been reported before (Pushpakumara et al. 2007). Polymorphism observed in the
Cox 11 region was thus used in the current paper.
The mitochondrial Cox 11 primers were subjected
to restriction digest with ALU 1 (New England
Biolabs) to obtain restriction fragment polymorphisms (RFLPs). The RFLPs were separated
using 8 % Polyachrylamide gel electrophoresis
NYADOI et al.
(PAGE) and, silver staining conducted to enable
visualisation and image documentation using the
UVP image system (ASAR, USA). Haplotypes were
identified from the RFLPs (Nyadoi et al. 2010b)
and
mapped
within
their
populations.
Furthermore, based on GPS recorded position
coordinates of the tamarind from which haplotypes
were obtained, the haplotypes were mapped within
their populations using ArcView GIS software
(ER1 2002).
Step 2. Morphological characterisation of sampled
tamarind
The choice of height, diameter at breast height
(DBH), and tree crown sectional area as morphological response variables was based on the economic importance of these traits to farmers in East
Africa. These response variables were chosen, also,
because these traits are in part influenced by genotypes and in part by environment. Environmental
factors (soil, temperature, altitude, rainfall and
vegetation types) known to influence these traits
were also captured in the study and their effects
on the morphological parameters were examined.
The reproductive traits such as flower size,
shape, colour, and fruit size, shape, and colour are
also known to differ among tamarind populations
(Pushpakumara et al. 2007) and are in fact
influenced by genotype and environment, much
like the height, crown sectional area and DBH
investigated in our study. Reproductive traits like
flower or fruit characteristics were, however, not
included in our study because our data collection
period was not in phase with the reproductive
phenology of tamarind.
For each of the tamarind characterised for
haplotypes diversity, the height and crown radii
(later used to determine tamarind crown sectional
area; CSA) were measured in metres, and DBH
was measured in centimetres. The height, crown
sectional area and DBH data were then subjected
to multivariate analysis of variance (MANOVA) in
relation to environment (vegetation types, soils,
temperature, rainfall, altitude) and haplotypes of
populations using SAS (Nyadoi 2010; Nyadoi et al.
2010a).
Step 3. On-farm tamarind establishment method
and niches
For all tamarind sampled on-farm and studied
in steps 1 and 2 above, farmer responses on their
establishment method (whether they were planted
or they grew naturally/wild) were used to generate
numbers of planted and wild tamarind on-farm.
The means of planted and wild tamarind on-farm
23
were then analysed for variance to determine
domestication level (Nyadoi et al. 2009a).
Step 4. Tamarind-niche-tree species diversity
For each of the tamarind sampled from all the
different habitats and included in study steps, 1, 2
and 3 above, tree species found in their niche, i.e.,
in an 18 m radius plot with tamarind at the centre
(niche definition in context of this study) were
recorded. Some woody non-tree species like bamboo
and agricultural crops like bananas in the niche
were also included. This was done to enable
identification of compatible spatial mixtures including tamarind, which can be promoted for conservation on-farm. Data on tree species presence/
absence from all plots from all habitats studied
were then analysed to generate Shannon diversity
indices (see Nyadoi et al. 2009b for details).
In this study, Shannon-Wiener species diversity index, denoted by H′, defined as a mathematical measure which provides information on
species richness, relative abundance, rarity or
commonness of different species in a community or
sample (Kent & Coker 2000; Shannon 1948) was
adopted. Shannon H′ is derived as:
s
H' = −
∑
j =1
p i ln p i
.................................................1
where, H′ is the diversity in a sample of S species,
S the number of species in the sample, Pi the
relative abundance of ith species or kinds of species
measured as = ni/N, where, N is the total number
of individuals of all species or kinds of species, ni is
the number of individuals of ith species and ln is
the natural logarithm. The value of H′ ranges from
0 meaning every species in the sample is the same
(no diversity) to 4.6 signifying high species richness and that different species in the sample or
community are equally abundant (Magurran 2004).
The other diversity index used in this study is
Shannon species evenness denoted HE, which
measures how equal the numbers of individuals of
different species are in a sample or community.
Shannon species evenness index HE is given by
HE=H′/Hmax= H′/lnS..................................................2
where, HE is Shannon species evenness index, H′ is
Shannon species diversity, ln, is the natural log
and S, the number of species in the sample or
community of the species. The values of HE range
from 0 (meaning complete unevenness) to 1 (meaning the different species occur in equal numbers).
To assess whether differences observed in the
24
TAMARINDUS INDICA DIVERSITY MODELS
Shannon diversity indices were statistically significant, they were analyzed using analysis of
variance (ANOVA). Paleontological Statistical
Package (Hammer & Harper 2005) was used for
the diversity analyses in this study. Paleontological Statistical Package (PAST) was additionally advantageous in that it is able to detect
species extinctions within and among niches.
In data management and analysis, each tree
species recorded in tamarind niche plots was
scored using binary approach; presence (1) and
absence (0) in all the 187 plots inventoried. Each
plot was grouped by its habitat type and country of
collection. A table of regional species list and their
respective frequencies among all plots per habitat
and per country were generated. The binary data
was loaded into PAST and the programme used to
generate Shannon-Wiener diversity indices; species
richness (S), relative abundance (Pi) and diversity
(H′, HE,) per habitat type per country. The
diversity indices were then comparatively analyzed for variance; (a) among the three different
habitats (on-farm, woodland and riverbank)
regionally and within a country and (b), among
similar habitats across the three different countries (Uganda, Kenya and Tanzania). In these
comparisons, generated P values were interpreted
to infer level of significance of the observed differences in diversity among the different habitats
regionally and within a country and, across the
three countries, similar habitats.
Synthesis of the results of study steps 1, 2, 3
and 4
The results obtained from study steps 1, 2, 3
and 4 above were then compared. The patterns of
variability and/or diversity obtained for the study
steps 1, 2 and 4 were examined for similarity/
divergence and in relation to study step 3, and
emerging patterns/models of diversity from all are
discussed in this paper.
Results
Patterns of tamarind diversity from genetic to
niche-tree-species in East Africa
Tamarind morphology varied among vegetation types. The Somali Masaai vegetation type in
Kenya had taller trees with larger DBH and wider
CSA than trees in Uganda, Tanzania, and
Zanzibar and Lamu Islands (Table 2). The patterns
in the variation of tamarind morphology were
similar to the variability of haplotypes in the
populations. That is, tamarind height and DBH
were greater within Kenyan habitats, where the
number of different haplotypes (4) was also more
compared to the Uganda and Tanzania habitats (2
and 3, respectively) (Table 2 and Fig. 2).
Diversity pattern for tree species in tamarind
niches (Table 3) was also similar to the diversity
pattern observed for tamarind morphology and
haplotypes. This was based on data from on-farm
plots (46 from Uganda, 47 from Kenya and 34 from
Tanzania), woodland plots (12 from Uganda, 13
from Tanzania and 22 from Kenya), and riverbank
plots (4 from Uganda, 9 from Tanzania and 14
from Kenya), i.e., 187 plots sampled in tamarind
niches East Africa wide. A total of 725 individuals
composed of 171 different species of 53 families
were found in tamarind niches (Table 3, also see
Nyadoi et al. 2009a,b for detailed results).
Analysis at the regional level revealed an
overall high species diversity (H′ = 4.07, Table 3)
but low species evenness (HE = 0.34) and lower
diversity of families (H′ = 3.37; HE = 0.55). At
habitat level regionally, 129 species were found in
tamarind niches on-farm (species diversity H′ =
3.86 and HE, 0.36), in woodlands there were 96
species (H′ = 3.94 and HE = 0.53) while the
riverbanks had 69 species with H′ = 3.69 and HE =
0.55.
Diversity analysis at country level revealed
that species richness (S) on-farm in Uganda was
45, in Kenya 69, and 58 in Tanzania (Table 3).
Ugandan woodlands had 30 species, Kenya had 51,
and Tanzania had 41, while Ugandan riverbanks
had 10 species, Kenya had 42, and Tanzania had
30 (Table 3).
Analysis of variance based on means of
Shannon diversity index, H′, between similar
habitats revealed significant differences (P = 0.003)
among countries (Kenya, Uganda and Tanzania)
on farm with (mean H′) HM =3.37, P = 0.002 for the
woodlands with HM = 3.31 and, P = 0.01 for the
riverbanks with HM = 3.85.
Analysis of variance based on means of
Shannon H′ diversity between different habitats
(on-farm, woodland, and riverbank) within countries
revealed significant differences; P = 0.01 for
Uganda with HM being 2.76, in Tanzania P =
0.001 with HM = 3.31 and in Kenya P = 0.001 with
HM = 3.46.
Analysis of on-farm tamarind establishment
methods revealed a higher level of planting in
Uganda (65.6 %) and Kenya (60 %) while in
Tanzania on-farm populations of tamarind are still
largely wild (77 %) (Fig. 3). However, at regional
NYADOI et al.
25
Table 2. Tamarind morphological variability in East Africa habitats. Values are mean (s.e.).
Tamarind habitats
Tamarind height
Tamarind
diameter at breast
height
Tamarind crown
sectional area
Sudanian (Uganda)
11.54 (1.35)
36.67 (34.9)xx
189.59 (29.82)
Guineo-Congolia (Uganda)
12.79 (1.59)
139.82 (41.18)
189.52 (35.18)
Lake Victoria regional (Uganda)
12.72 (1.88)
103.85 (48.67)
183.84 (41.58)
Somalia Maasai (Kenya)
Zanzibar Inhambane (Lamu
Kenya, Zanzibar, Tanzania)
Zambesia (Tanzania)
xxsignificantly
14.54
(1.12)xx
229.07
(28.87)xx
4.41 (1.48)xx
-10.59 (38.13)xx
11.39 (1.09)x
182.82(28.06)xx
199.56 (24.67)
61.77 (32.57)xx
161.99(23.97)
Number of
different
tamarind
mitochondria
haplotypes
recorded in
population
2
4
3
2
different values for tamarind morphology variation in habitats.
Table 3. Tamarind-niche-tree species diversity in on-farm, woodland, and riverbank habitats in East Africa.
Spatial scale of study
Species richness
( S)
Number of
individuals (i)
Shannon H′
diversity index
Shannon species
evenness HE
East Africa wide
Overall regional
171 (range 130-148)
On-farm regional
725 (725-725)
4.07 (3.81-4.08)
0.34 (0.33-0.41)
129 (92-108)
460 (460-460)
3.86 (3.55-3.85)
0.37 (0.36-0.46)
Woodlands regional
96 (65-79)
211(211-211)
3.94 (3.48-3.86)
0.54 (0.47-0.64)
Riverbanks regional
69 (44-56)
140 (140-140)
3.64 (3.14-3.59)
0.55 (0.48-0.68)
On-farm Uganda
45 (30-40)
146 (146-146)
3.02 (2.60-3.08)
0.46 (0.41-0.59)
On-farm Kenya
69 (47-58)
188 (188-188)
3.59 (3.18-3.56)
0.52 (0.48-0.64)
On-farm Tanzania
58 (38-48)
128 (128-128)
3.49 (3.01-3.46)
0.57 (0.49-0.70)
Country levels
Woodlands Uganda
30 (18-26)
58 (58-58)
3.04 (2.46-2.99)
0.69 (0.60-0.83)
Woodlands Kenya
51 (32-42)
93 (93-93)
3.47 (2.91-3.39)
0.63(0.54-0.75)
Woodland-Tanzania
41(27-35)
82 (82-82)
3.42 (2.91-3.33)
0.75 (0.64-0.84)
Riverbanks Uganda
10 (5-9)
12 (12-12)
2.21 (1.35-2.4)
0.91 (0.73-0.96)
Riverbanks Kenya
42 (26-35)
78 (78-78)
3.32 (2.77-3.24)
0.66 (0.57-0.79)
Riverbank Tanzania
30(17-25)
53 (53-53)
3.02 (2.41-2.96)
0.67 (0.59-0.83)
Regional Species families
57 (41-51)
171 (171-171)
3.67 (3.33-3.61)
0.69 (0.64-0.77)
Table note; Analysis of variance of Shannon diversity index H′ for tamarind-niche tree species across the three
countries for similar habitat revealed significant difference on farm (P = 0.00) with the mean index of diversity HM =
3.37, in the woodland (P = 0.00) with HM = 3.31 and for the riverbanks (P = 0.01) with HM = 2.85. Analysis of variance
of Shannon diversity index H for tamarind-niche tree species among the three different habitats (on-far, woodlands
and riverbanks) within countries also revealed significant difference; In Kenya (P = 0.001) with the mean index of
diversity HM being 3.46, in Tanzania (P = 0.001) with HM = 3.31 and in Uganda (P = 0.01) with the HM = 2.76.
In the table, HE is Shannon species evenness, a measure of how equal the numbers of individuals of different species
are in a sample or community and is derived as shown earlier (equation 2).
26
TAMARINDUS INDICA DIVERSITY MODELS
1,2,3,4
Somalia Masaai
>
p<0.05
1, 5
>
p<0.05
Guineo–Congolia, Sudanian Lake Victoria,
Zambesia
1, 2, 3
Zanzibar Inhambane
Fig. 2. Tamarind height, crown sectional area, diameter at breast height variations (R = 59.5 %) with
environment (vegetation types) and haplotypes (1, 2, 3, 4 and 5) in East Africa.
NYADOI et al.
Fig 3. Numbers of individual tamarind trees
recorded, classified by establishment methods, across
study sites in East Africa.
level in East Africa, differences in means of the
number of planted and wild tamarind on-farm is
not significant (Nyadoi et al. 2009a).
Discussion and conclusions
Our results reveal similarity in diversity
patterns from the population (genetic and morphological) to the community (niche-tree species) level
for tamarind, with higher diversity in areas where
farmer intervention by way of on-farm planting
was also high. Our study is, to the best of our
knowledge, the first spatial-temporal attempt to
elucidate diversity models from genetic to nichespecies level in tamarind. Interestingly, our findings corroborate diversity patterns reported based
on reviews of different non-spatio-temporal and inphase studies of species. Assogbadjo and colleagues
(Assogbadjo et al. 2006) for example, found correlations between genetic and morphological (height,
number of branches and thickness of capsules of
trees) diversity in Adansonia digitata. At community levels in an experimental setting, genetic
diversity has been reported to increase with
species diversity (Booth & Grime 2003).
In evolution it is common knowledge that
species diversity patterns are shaped among other
factors by, historical factors like dispersal events,
geographic isolation, extinction due to climatic and
geological events and, ecological factors such as
predation and competition (Barantes & Sandoval
2009; Rasingam & Parathasarathy 2009; Shukla
2009). Abundance and/or diversity per species are
also influenced by their life history e.g. reproductive rate, intra- and inter-species inter-
27
actions, parasitism and competition (Barantes &
Sandoval 2009; Goparaju & Jha 2010). Genetic
variation within- and among-populations are also
influenced by these same factors. Species lifehistory traits such as reproductive rate and competition, for example, influence their survival, and
consequently, their ability to contribute to genetic
variation (Hedley et al. 2009; Young et al. 2000).
At the global level, combined effects of environmental factors have been implicated in homogeneity of species diversity patterns (Kreft & Jetz
2007). Even among different geographic regions,
similarity in evolutionary factors influence species
diversity patterns (Vellend & Geber 2005). Even in
agricultural and forested landscapes, evidence has
shown that regional and localized species diversity
dynamics are a result of evolutionary factors acting
at such levels (Kaur et al. 2012; Ma 2006; Pant &
Samant 2012).
Drawing from the above reviews, the
unidirectional diversity pattern from genetic to
niche-tree-species levels observed in our tamarind
study could be attributed to cross acting-shared
historical events. In the past there could have been
similarity of dispersal, geographical isolation,
climatically and geologically driven extinction
events. These may have involved the ecology (predation, competition), and life-history strategies
(reproductive rate, intra- and inter-species
interactions) for tamarind within East Africa as a
region. Higher diversity observed in Kenyan
habitats than in Uganda and Tanzania may be the
result of higher level of human intervention aiding
survival and diversity of the species.
Taking tamarind alone, the level of on-farm
planting in Kenya was similar to that in Uganda
but at species diversity level Uganda is the least
diverse. This result portrays a culture/value of
conservation of trees among Kenyan communities
more than among Ugandans. Unlike Uganda, over
60 % of Kenya is dry lands with hasher climatic
conditions (Jaetzold & Schmidt 1983). Tree conservation could be an adaptation measure Kenyans
embraced for environmental micro-climate amelioration.
Whereas Uganda is generally a climatically
favourable country, for two decades now, deforestation and forest degradation have remained
problems (Amaniga Ruhanga & Manyindo 2010).
Deforestation and forest degradation a factor of
species depletion in many other regions (Kaur et
al. 2012; Pant & Samant 2012 for example) may be
the cause of diversity declines in Ugandan habitats
despite people planting and retaining on-farm,
28
TAMARINDUS INDICA DIVERSITY MODELS
trees of their interest (Nyadoi 2005). Increasing
monoculture of Tobacco promoted by British
American Tobacco Co. (BAT), other commercial
crops and needs for land use (Nyadoi 2010) are
among likely factors of deforestation and revealed
species loss in Ugandan habitats.
In conservation, the ideal goal is to maintain
existing spatial and temporal diversity within and
among species (Jeffrey et al. 2004; Margules &
Pressey 2000). Of conservation value, therefore,
our finding of convergent diversity patterns from
genetic to niche-species levels for tamarind imply
the need for maintenance of diversity at these
levels. Our results revealed a similarly higher
diversity in tamarind from genetic to niche levels
in Kenyan habitats where also, considerable onfarm planting of the species took place. This
suggests on-farm planting enhanced diversity
meaning that for the diversity sustainability,
farmers need to be engaged in design and implementation of tamarind and its niche-tree species
conservation strategies.
The data we analysed for diversity patterns
from genetic, morphological to niche-species levels
for tamarind were obtained from the same individuals and at the same time (i.e., the data were
spatially and temporally homogeneous). Unidirectional diversity patterns found, therefore,
provide new evidence supporting convergent diversity models postulated elsewhere (Booth & Grime
2003; Vellend & Gebber 2005). For tamarind our
model is a pioneer and will be valuable in
furthering investigations of diversity relationships
at different ecological levels.
It is clear from our results that, diversity in
tamarind and tamarind niche-tree species is
higher on-farms. This could be due to a number of
factors, perhaps in selection; farmers actively
promote diversity in their farming practices. Also,
our finding allude to tree species depletion taking
place in the wild (forests, riverbanks), need to
focus conservation efforts in farm lands and,
commencement of restoration measures in the
earlier habitats. Nevertheless, detailed study to
elucidate underpinning factors to observed higher
diversity of tamarind and niche-tree species onfarm is necessary to reveal more insight on
important conservation approaches.
Finally, for immediate applications we
recommend that the observed diversity pattern at
all the three levels be maintained or promoted in
conservation approaches for tamarind in East
Africa. Thus, efforts should be made to preserve
natural populations of tamarind in habitats and
the diversity (at niche-tree species, morphological
and genetic levels) within the populations. To come
up with appropriate management guidelines to
achieve this conservation approach, evolutionary
factors contributing to observed unidirectional
diversity pattern in tamarind need to be known.
Therefore, we recommend model studies to elucidate them.
Acknowledgements
Authors thank Third World Organisation of
Women in Sciences, International Foundation of
Science, Austrian Agency for Development Cooperation, and Austrian Institute for Technology
(formally Austrian Research Centres) for funding.
We thank Dr. Denis P. Garity, Prof. Tony Simons,
Prof. August B. Temu, Assoc. Prof. J. R. S.
Kaboggoza, and Dr. Wilson K. Kasolo for institutional support. We thank Ric Coe, Patricio Lopez,
Maria Berenyi, Andreas Homolka, Henry
Mulindwa, Karin Fohringer, and Agnes Burg for
technical research methodology support, and L.
Ben, Phoebe Owino, Charlie Charlie, and Agnes B.
Were for field assistance. We are very much
grateful to the anonymous reviewers of Tropical
Ecology and to Dr. Ankila J. Hiremath and
Professor J. S. Singh for the review inputs that
helped us improve this manuscript.
References
Amaniga Ruhanga, I. & J. Manyindo. 2010. Uganda’s
Environment and Natural Resources: Enhancing
Parliament’s Oversight. Norway.
Assogbadjo, E. A., T. Kyndt, B. Sinsin, G. Gheysen & P.
Van Damme. 2006. Patterns of genetic and morphometric diversity in Baobab (Adansonia digitata)
populations across different climatic zones of Benin
(West Africa). Annals of Botany 97: 819-830.
Barantes, G. & L. Sandoval. 2009. Conceptual and
statistical problems associated with the use of
diversity indices in ecology. International Journal of
Tropical Biology 57: 451-456.
Booth, E. R. & P. Grime. 2003. Effect of genetic
impoverishment on plant community diversity.
Journal of Ecology 91: 721-730.
Demesure, B., N. Sodzi & J. R. Petit. 1995. A set of
universal primers for amplification of polymorphic
non-coding regions of mitochondrial and chloroplast
DNA in plants. Molecular Ecology 4: 129-131.
Doyle, J. J., I. J. Davis., R. J. Soreng., D. Garvin & M. J.
Anderson. 1992. Chloroplast DNA inversions and
the origin of the grass family (Poaceae). Proceedings
NYADOI et al.
of the National Academy of Sciences, USA 89: 77227726.
Duminil, J., M-H. Pemonge, J. R. Petit. 2002. A set of 35
consensus primer pairs amplifying genes and
introns of plant mitochondrial DNA. Molecular
Ecology Notes 2: 428-430.
El-Siddig, M., P. H. Gunasena, A. B. Prasad, G. N. K.
Pushpakumara, R. V. K. Ramana, P. Viyayanand &
T. J. Williams. 2006. Fruits for the Future 1-Revised
edition-Tamarind (Tamarindus indica L). Monograph.
Environmental Systems Research Institute (ESRI). 2002.
Arc View Geographic Information Sytems 3.2a. 19922002. Environmental Systems Research Institute.
380 New York Street. 3 Redlands, California.
Fisher, R. A. 1930. The Genetic Theory of Natural
Selection. Clarendon Press, Oxford.
FAO. 2004. Forest Genetic Resources. No. 31. Rome, Italy.
Frankham, R. J., J. D. Ballou & D. A. Briscoe. 2002.
Introduction to Conservation Genetics. Cambridge
University Press.
Gebureka, T. 1997. Isozymes and DNA markers in gene
conservation of forest trees. Biodiversity and
Conservation 6: 1639-1654.
Goparaju, L. & C. S. Jha. 2010. Spatial dynamics of
species diversity in fragmented plant communities
of a Vindhyan dry tropical forest in India. Tropical
Ecology 51: 55-65.
Hammer & T. A. D. Harper. 2005. PAST: Palaeontological Statistics Software Package for Education
and Data Analysis, Version 1.37. Oslo, Norway.
Hartl, D. L. & A. G. Clark. 1997. Principles of Population Genetics. 3rd edn., Sinuaer Associates. Inc.
Sunderland, Massachusetts, USA.
Hedley, A., I. J. Hormaza & M. Herrero. 2009. Global
warming and sexual plant reproduction. Trends in
Plant Science 14: 30-36.
Jaetzold, R. & H. Schmidt. 1983. Farm Management
Handbook of Kenya, Vol. 11 Natural Conditions and
Farm Management Information - Vol. 11/C Eastern
Kenya. Ministry of Agriculture, Kenya.
Jama, B., Z. Oginasako & P. Simitu. 2005. Utilisation
and Commercialization of Dryland Indigenous Fruit
Tree Species to Improve Livelihoods in East and
Central Africa. ICRAF-ECA Working Paper No.7,
World Agroforestry Center.
Jeffrey, C. Su, D. M. Debinski, M. E. Jakubauskas & K.
Kindscher. 2004. Beyond species richness: community similarity as a Measure of cross–taxon
congruence for coarse-filter conservation. Conservation Biology 18: 167- 175.
Jung, Y. H., S. Y. Eun & C. J. Seung. 2004. Phylogenetic
analysis of plastid trnL-trnF sequences from
29
Arisaema species (Araceae) in Korea. Euphytica
138: 81- 88.
Kaur, R., S. P. Joshi & M. M. Srivashara. 2012. Natural
resource degradation in three sub-watersheds of
river Tons, Utarakhand, India. Tropical Ecology 53:
333-343.
Kent, M. & P. Coker. 2000. Vegetation Description and
Analysis. A Practical Approach. Belhaven Press,
London.
Kreft, H. & W. Jetz. 2007. Global patterns and determinants of vascular plant diversity. Proceedings of
the National Academy of Sciences 104: 5925-5930.
Ledig, F. T. 1986. Conservation strategies for forest gene
resources. Forest Ecology and Management 14: 7790.
Lowe, A. J., D. Boshier, M. Ward, C. F. E. Bacles & C.
Navarro. 2005. Genetic resources impacts of habitat
loss and degradation; reconciling empirical evidence
and predicted theory for neotropical trees. Heredity
95: 255-273.
Lowe, A., S. Harris & P. Ashton. 2004. Ecological
Genetics. Design, Analysis and Applications. Blackwell Publishing, USA.
Ma, M. 2006. Plant Species Diversity of Buffer Zones in
Agricultural Landscapes: in Search of Determinants
from the Local to Regional Scale. Ph. D. Thesis.
Helsinki University Printing House, Helsinki.
Magurran, A. E. 2004. Measuring Biological Diversity.
Blackwell Science, Malden, MA.
Margules, R. C. & L. R. Pressey. 2000. Systematic
conservation planning. Nature 405: 243-253.
Nishikawa, T., B. Salomon, T. Komatsuda, R. B. Von &
K. Kadowaki. 2002. Molecular phylogeny of the
genus Hordeum using three chloroplast DNA
sequences. Genome 45: 1157-1166.
Nyadoi, P. 2005. Population Structure and Socio-Economic Importance of Tamarindus indica in Tharaka
District, Eastern Kenya. M.Sc. Thesis. Makerere
University, Uganda.
Nyadoi, P., P. Okori, J. B. L. Okullo, J. Obua, K. Burg,
S. Fluch, Magogo Nasoro, Haji Saleh, H. Kipruto, A.
B. Temu & R. Jamnadass. 2009a. Establishment
methods and niche characterization reveal east
Africa tamarinds (Tamarindus indica L.) on farm
populations’ conservation strategies. Gene Conserve
8: 781-801.
Nyadoi, P., P. Okori, J. B. L. Okullo, J. Obua, K. Burg,
S. Fluch, Magogo, Nasoro, Haji Saleh., A. B. Temu
& R. Jamnadass. 2009b. Tamarinds (Tamarindus
indica L.) niche tree species diversity in East Africa.
International Journal of Biodiversity Conservation
1: 151-176.
Nyadoi, P. 2010. Tamarindus indica L. Genetic Struc-
30
TAMARINDUS INDICA DIVERSITY MODELS
ture and Niche Ecology. Ph.D. Thesis, Makerere
University, Uganda.
Nyadoi, P., P. Okori, J. B. L. Okullo, J. Obua, K. Burg,
S. Fluch, Magogo Nasoro, Haji Saleh, A. B. Temu &
R. Jamnadass. 2010a. Variability of East Africa
tamarind (Tamarindus indica L.) populations based
on morphological markers. Gene Conserve 9: 51-78.
Nyadoi, P., R. Jamnadass, P. Okori, J. B. L. Okullo, J.
Obua, Magogo Nassoro, Haji Saleh, D. K. N. G.
Pushpakumara, J. Roshetko, A. Kalinganire, A.
Muchugi, A. B. Temu, S. Fluch & K. Burg. 2010b.
Tamarindus indica tropical populations genetic
structure. Gene Conserve 9: 152-166.
Nyadoi, P., J. Obua, A. B. Temu & R. Jamnadass. 2011.
Population structure of tamarind (Tamarindus
indica L.) on farm and in wild habitats in semi
arid agroecologies in Kenya. Gene Conserve 10: 243269.
Pant, Shreekar & S. S. Samant. 2012. Diversity and
regeneration status of tree species in Khokhan
Wildlife Sanctuary, north-western Himalaya. Tropical Ecology 53 : 317-331.
Pushpakumara, D. K. N. G., H. P. M. Gunasena & V. P.
Singh (eds.). 2007. Underutilized Fruit Trees in Sri
Lanka. World Agroforestry Centre, New Delhi, India.
Rasingam, L. & N. Parathasarathy. 2009. Tree species
diversity and population structure across major
forest formations and disturbance categories in
Little Andaman Island, India. Tropical Ecology 50:
89-102.
Reed, D. H. & R. Frankham. 2001. How closely correlated are molecular and quantitative measures of
genetic variation? A meta-analysis. Evolution 55:
1095-1103.
Samuel, R., W. Pinsker & M. Kiehn 1997. Phylogeny of
some species of Cyrtandra (Cesneriaceae) inferred
from the atpB/rbcL cpDNA intergene region.
Botanica Acta 110: 503-510.
Shannon, C. E. 1948. A mathematical theory of communication. Bell Systems Technical Journal 27: 279423.
Shaw, J., B. E. Lickey, T. J. Beck, B. S. Farmer, W. Liu,
J. Miller, C. K. Siripun, T. C. Winder, E. E. Schilling
& L. R. Small. 2005. The tortoise and the hare II:
relative utility of 21 non coding chloroplast DNA
sequences for phylogenetic analysis. American Journal of Botany 92:142-166.
Shukla, P. R. 2009. Patterns of plant species diversity
across Terai landscape in North-Eastern Uttar
Pradesh, India. Tropical Ecology 50: 111-123.
Taberlet, P., L. Gielly, G. Pautou & J. Bouvet. 1991.
Universal primers for amplification of three noncoding regions of chloroplast DNA. Plant Molecular
Biology 17: 1105-1109.
Tsumura, Y., T. Kawahara, R. Wiekneswari & K.
Yoshimura. 1996. Molecular phylogeny of Dipterocarpaceae in Southeast Asia using RFLP of PCRamplified chloroplast genes. Theoretical and Applied
Genetics 93: 22-29.
Vellend, M. & M. Geber. 2005. Connections between
species diversity and genetic diversity. Ecology
Letters 8:767-781.
White, F. 1983. The Vegetation Map of Africa. UNESCO,
Paris.
Young, A., D. Boshier & T. Boyle (eds.). 2000. Forest
Conservation Genetics: Principles and Practice.
CSIRO Publishing, Collingwood, Australia.
(Received on 11.03.2011 and accepted after revisions, on 27.08.2012)
NYADOI et al.
31
Appendix Table 1. Primers tested for and or used in tamarind genetic diversity studies.
Primer
Foreword /reverse sequences
tRNAleu
(Intron 1 F)
5'-CGAAATCGGTAGACGCTACG-3'
tRNAleu
(Intron1 R)
5'-GGGGATAGAGGGACTTCAAC-3'
MatkF
MatKR
trnL F
TrnF
CCB 203 F
5'-ASGTTCTACGGACCGATGCC-3'
CCB 203 R
5'-CACGGGGAGGGAGCRGGCGA-3'
CR
5'-CACGGGTCGCCCTCGTTCCG-3'
RC
5'-GTGTGGAGGATATAGGTTGT-3'
CB
5'-GCATTACGATCTGCAGCTCA-3'
BC
5'-GGGCTCGATTAGTTTCTGC-3'
NA41
5'-CAGTGGGTTGGTCTGGTATG-3'
NA14
5'-TCATATGGGCTACTGAGGAG-3'
NA42
5'-TGTTTCCCGAAGCGACACTT-3'
NA24
5'-GGAACACTTTGGGGTGAACA-3'
ORF 25F
5'-AAGACCRCCAAGCYYTCTCG-3'
ORF25R
5'-TTGCTGCTATTCTATCTATT-3'
AS
5'-ACTTCTGGTTCCGGCGAACGA-3'
SA
5'-AACCACTCGGCCATCTCTCCT-3'
CD
5'-CCAGTTCAAATCTGGGTGTC-3'
DC
5'-GGGATTGTAGTTCAATTGGT-3'
MatK F
5'-AACCCGGAACTAGTCGGATG-3'
trnK
5'-TCAATGGTAGAGTACTCGGC-3'
trnlR
trnLFA
trnEDoyle 10
GTCCTATCCATTAGACAATGG
TrnTM 11
CTACCACTGAGTTAAAAGGG
TrnHF
Source
PCR success with tamarind in this
study
Taberlet et al. Amplified in some and failed in other
1991
individuals, Polymorphic with Hinf1 but
poor resolution
Not used in final study
Nishikawa et
al. 2002
Amplified in some and failed in other
individuals Not used in study
Nishikawa et
al. 2002
Amplification failure Not used in study
Duminil et al.
2002
Amplified in some and failed in other
individuals Not used in study
Demesure et
al. 1995
Amplified in some and failed in others
Not used in study
Demesure et
al. 1995
Amplified in some and failed in other
individuals Not used in study
Demesure et
al. 1995
Amplification failure Not used in study
Demesure et
al. 1995
Amplified in some and not in other
individuals Not used in study
Dumunil et al. Amplification failure Not used in study
2002
Demesure et
al. 1995
Amplification failure Not used in study
Demesure et
al. 1995
Amplification failure Not used in study
Nishikawa et
al. 2002
Amplification failure Not used in study
Jung et al.
2004
Amplification failure Not used in study
Doyle et al.
1992
Amplified in some and failed in others
Not used in study
Tsumura et al. Amplification failure Not used in study
1996
PSB A3 (8)
atBSam 17
Samuel et al.
1997
atBsam 20
rbcl F
Amplification failure Not used in study
Amplified in some and failed in others
Not used in study
rbcl R
ORF 62 P
CTTGCTTTCCAATTGGCTGT
trnf-M
CATAACCTTGAGGTCACGGG
Amplification failure Not used in study
Demesure et
al. 1995
Contd...
32
TAMARINDUS INDICA DIVERSITY MODELS
Appendix Table 1. Continued.
Primer
Foreword /reverse sequences
trnG 2(III)
GTTTAGTGGTAAAAGTGTGATTCG
TrnG 1 R
CCGCATCGTTAGCTTGGAAGGC
rpl2f (2)
ACCGATATGCCCTTAGGCACGGC
TrnH-M
GTGAATCCACCAYGCGCGGG
PSB A5 (7)
TACGTTCRTGCATAACTTCC
PSBA3 (8)
CTAGCACTGAAAACCGTCTT
NAD9 F
GGTCATCTCAATTGGGYTCAG
NAD 9 R
TATAGTTGGGAGACTTTACC
Cox 11 F
5'-TAGRAACAGCTTCTACGACG-3'
Cox 11 R
5'-GRGTTTACTATGGTCAGTGC-3'
rps 14
Cob
DT
5'-ACCAATTGAACTACAATCCC-3'
TD
5'-CTACCACTGAGTTAAAAGGG-3'
rbcl samuel
GAAGTAGTAGGATTGATTCTC
Source
Shaw et al.
2005
PCR success with tamarind in this
study
Amplified across populations Used in
study
Amplified across populations Was used
in study
Tsumura et al. Amplified across populations was used
in study
1995
Amplified across populations Was used
in study
Duminil et al.
2002
Amplified across populations was used
in study
Demesure et
al. 1995
Amplified in some and failed in others
Not used in study
Demesure et
al. 1995
Amplification failure Not used in study
Samuel et al.
1997
Amplification failure Mot used in study
Duminil et al.
1995
Amplification failure Not used in study
Rbcl Samuel R CCCTACAACTCATGAATTAAG
Atp9 F
5'-CCAAGTGAGATGTCCAAGAT-3'
Atp 9 R
5'-CTTCGGTTAGAGCAAAGCC-3'
NA12
Amplified in some and failed in others
Not used for study
NA21
MatKF
Amplified in some and failed in others
Not used for study
trnlKR
ITS F
Amplifies in all
Not used in study
ITS R
FT
Amplification failure Not used in study
TF
Rpoc F
Amplification failure Not used in study
Rpoc R
Rps 4 F
5'-CSTTTCYGCTCCGAAGAG-3'
Rps 4 R
5'-TCTCCGAAGATTGAGG-3'
Amplification failure Not used in study
IGR F
Amplification failure Not used in study
IGR R
18S F
Amplified in all Used to test DNA
quality for PCR
18S R
atB Samuel F
GAAGTAGTAGGATTGATTCTC
Rbcl Samuel R CCCTACAACTCATGAATTAAG
Samuel et al.
1997
Amplification failed Not used in study