Download Analysis of two alleles of the urease gene from potato

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Plant morphology wikipedia , lookup

Glossary of plant morphology wikipedia , lookup

Sustainable landscaping wikipedia , lookup

Plant disease resistance wikipedia , lookup

Transcript
Journal of Experimental Botany, Vol. 56, No. 409, pp. 91–99, January 2005
doi:10.1093/jxb/eri014 Advance Access publication 8 November, 2004
This paper is available online free of all access charges (see http://jxb.oupjournals.org/open_access.html for further details)
RESEARCH PAPER
Analysis of two alleles of the urease gene from potato:
polymorphisms, expression, and extensive alternative
splicing of the corresponding mRNA
Claus-Peter Witte*, Sarah Tiller, Edwige Isidore, Howard V. Davies and Mark A. Taylor†
Scottish Crop Research Institute, Unit of Plant Biochemistry, Invergowrie, Dundee DD2 5DA, UK
Received 12 May 2004; Accepted 20 August 2004
Abstract
Introduction
Globally, urea is the most widely used nitrogen fertilizer
and is made accessible to plants via the urease reaction.
However, sequence information for the plant enzyme is
scarce. A cDNA encoding urease from soybean (Glycine
max) has been cloned and sequence information has
been obtained for two alleles (11 and 19 kbp, respectively) of the potato (Solanum tuberosum, cv. Désirée)
urease gene and the corresponding cDNAs. It was found
that urease is encoded by a single copy gene in several
solanaceous species, and maps to chromosome V in
potato. By contrast, the presence of two urease genes
was reported for soybean. Comparative analysis of
11 kbp overlapping allelic DNA allowed the quantification
of single nucleotide polymorphisms and revealed the
presence of a truncated Ty1-copia retrotransposon in
one of the alleles. Both alleles contained a copy of
a terminal-repeat retrotransposon in miniature (TRIM).
25–50% of urease pre-mRNAs from both alleles were
alternatively spliced in a variety of different ways. The
retrotransposons had no effect on splicing. While urease is expressed in all tissues tested, its mRNA and
protein are of low abundance. The TATA-less urease
promoter appears to drive low-level housekeeping transcription. An in silico analysis showed that eukaryotic
urease protein sequences are very similar to sequences
from prokaryotic enzymes, conserving all residues of
known functional importance. It is therefore likely that
all known ureases are structurally similar, employing
the same catalytic mechanism.
Urease catalyses the hydrolysis of urea, yielding ammonia
and carbonic acid. The enzyme is ubiquitous in plants
(Frankenberger and Tabatabai, 1982; Hogan et al., 1983;
Witte and Medina-Escobar, 2001) and is also found in
bacteria, eukaryotic micro-organisms, and some invertebrates (Mobley and Hausinger, 1989). For plants, the urease
reaction is essential to make urea-nitrogen accessible and
urease deficiency can lead to urea accumulation in plant
tissues (Shimada and Ando, 1980; Eskew et al., 1983).
Urease is an enzyme of great agronomic importance, since
most nitrogen fertilizer used worldwide is applied as urea
(FAO, 1998).
At the physiological level, urease has been studied in
soybean (Polacco and Holland, 1993). Soybean contains
a ubiquitous urease, expressed in all tissues, and an
embryo-specific urease, accumulating to activity-levels
1000-times greater than those of ubiquitous urease. Two
distinct genes encode these ureases (Torisky et al., 1994).
The active site architecture of urease has been elucidated
in Klebsiella aerogenes. Several histidines and an aspartate
are ligands for two active site nickel ions (essential for
activity; Dixon et al., 1975; Witte et al., 2002a) that, in
addition, are bridged by a carboxyl group covalently
attached to the terminal amino group of a lysine residue
(Jabri et al., 1995). The incorporation of nickel into the
active site of urease is aided by several urease accessory
proteins in bacteria and plants (Freyermuth et al., 2000;
Witte et al., 2001a; Bacanamwo et al., 2002).
The seed enzyme from Canavalia ensiformis (jackbean)
has long been the only eukaryotic urease for which full-length
coding sequence information was available. The genomic
sequences of three fungal enzymes (Schizosaccharomyces
Key words: Adenylate kinase, alternative splicing, SNP, TRIM,
Ty1-copia, urease.
* Present address: Max-Planck-Institute for Plant Breeding Research, Department of Plant Microbe Interactions, Carl-von-Linné-Weg 10, D-50829 Cologne,
Germany.
y
To whom correspondence should be addressed. Fax: +44 (0)1382 562426. E-mail: [email protected]
Journal of Experimental Botany, Vol. 56, No. 409, ª Society for Experimental Biology 2004; all rights reserved
92 Witte et al.
pombe, Cryptococcus neoformans, Coccidioides immitis) and
of a second plant enzyme (from Arabidopsis thaliana) have
now been published. Very recently, the coding sequences
for the ubiquitous and the seed-specific ureases of soybean
(Glycine max) have been added to the database (Goldraij
et al., 2003).
Ureases have been cloned from two further plant species:
a cDNA from Glycine max (soybean) and two alleles of the
urease gene from Solanum tuberosum (potato). In potato, as
well as in several other solanaceous species, urease is
shown to be a single copy gene. The two alleles of the
potato urease gene were analysed for polymorphisms, and
extensive alternative splicing of the corresponding mRNAs
in leaf and root tissues was discovered. It was demonstrated
that urease is expressed ubiquitously in the potato plant and
an in silico analysis of urease sequences highlights the
similarity of prokaryotic and eukaryotic enzymes.
Materials and methods
DNA and RNA isolations
Genomic DNA was obtained as previously described (Draper et al.,
1988). RNA was extracted from greenhouse-grown plants (soybean
leaves or potato cv. Désirée leaves) using the TRI reagent (Sigma)
following the manufacturer’s protocol. For analysis of differential
splicing, leaves (4th–5th node from the apical shoot tip) and roots
from young potato plants before the flowering stage were used.
Isolation of potato urease genomic clones
A lambda EMBL-3 SP6/T7 phage library of the potato genome (cv.
Désirée; Clontech, Palo Alto, CA) was screened twice following the
manufacturer’s protocol. For the first screen, probe DNA (320 bp) was
generated by RT-PCR (total leaf RNA, RT-step with Superscript II
from Gibco BRL, 41 8C annealing temperature, 40 cycles) with
degenerate primers: GGITTIAARITICAYGARGAYTGGG (forward) and TGRTGRCAIACCATIARCATRTC (reverse). This yielded
two clones, k1 and k2b, representing different alleles of the Désirée
urease gene, but which lacked the 59-end of the gene. Therefore,
a second screen was performed using a probe matching the 59-end of
the gene. This probe was generated as follows. In a first step,
a degenerate primer matching the 59-coding sequence of jackbean
and soybean urease ATGAARYTIWSICCIAGRGA (for) and two
reverse primers AGGGAATTACATTCTTTACACCACA (rev1)
CTGAATTGGTCTGTCACCTG (rev2) were used in nested RT-PCR
(total leaf RNA; RT-step using rev1 with Superscript from Gibco BRL;
20 cycles during the first PCR with 48 8C annealing temperature using
for and rev1; 25 cycles during nested PCR with 48 8C annealing
temperature using for and rev2. Based on the sequence of the obtained
PCR product, a third reverse primer CAGGAAGGAAAGAACCAT
(rev3) was designed to allow the amplification of a probe fragment not
overlapping with the previously isolated lambda phages (PCR with
primers for and rev3; 20 cycles, 48 8C annealing temperature). This
probe identified a single clone (k2a) which contained the 59 end of the
potato urease gene and overlapped with k1 and k2b.
Isolation of potato urease cDNA
Based on the genomic sequence, primers were designed to the 59 and
39 end of the coding sequence: CATATGAAGTTGGCTCCAAG
(59) and TAGGAATTCCTAAAAGAGGAAATAGTTCCTGGAG
(39). A reverse transcription step using primer 39 was carried out with
MMLV-reverse transcriptase from Gibco BRL (3 lg total RNA from
root or leaf as template) as described by the manufacturer. Subsequent
PCR was performed with forward and reverse primers for 32 cycles
(53 8C annealing temperature, 68 8C elongation temperature, Roche
HiFidelity Taq DNA Polymerase). Resulting amplicons (2.5 kbp) were
purified from an agarose gel and cloned into pGEM-T Easy (Promega).
10 clones from leaf and 12 clones from the roots were sequenced. The
coding sequence of potato urease was predicted from the genomic
sequence by alignment with the jackbean urease cDNA. This prediction was confirmed by aligning the potato cDNA sequences, which
also revealed the occurrence of alternative splicing.
Isolation of soybean urease cDNA
A degenerate primer was designed based on the published N-terminal
amino acid sequence of ubiquitous soybean urease (Torisky et al.,
1994): ATGAARYTIWSICCIAGRGA (for). Published partial sequence of ubiquitous soybean urease (accession number EMBL:
S69179) was used to design a primer to the 39-end: CTTAAAAGAGGAAGTAATTTCGAG. Total RNA from soybean leaf (1.2 lg) was
reverse transcribed with Superscript reverse transcriptase from Gibco
BRL. 30 cycles of PCR (50 8C annealing temperature) with both of the
above primers amplified a 2.5 kbp product which was sequenced.
RACE-PCR (see below) was used to obtain non-degenerate 59-end
sequence. A second RT-PCR experiment (conditions as before) using
primer ATTTCTGAATTCTCTGCTGC (which binds upstream of the
start codon) and the previously used reverse primer was conducted in
triplicate. Possible PCR errors were detected by comparing sequences
of three clones obtained from independent RT-PCR reactions.
RACE-PCR
59 RACE-PCR was conducted following the instructions of the Roche
59/39 RACE-PCR kit, using Superscript reverse transcriptase and
terminal transferase from Gibco BRL. For 59-RACE of soybean
urease, the following gene-specific primers were designed: TGACTAACTTAGTACCATCTCG (for reverse transcription and first PCR;
16 cycles, 54 8C annealing temperature) and GATGAGGAACAGYTGGAAGAACTTG (for nested PCR; 30 cycles, 60 8C annealing
temperature). For potato urease 59-RACE, the primers rev1, rev2, and
rev3 described previously were used. The reverse transcription step
was carried out with primer rev1, primer rev2 was used in a first PCR
(20 cycles; 55 8C annealing temperature), and primer rev3 in a nested
PCR (30 cycles; 61 8C annealing temperature).
Southern analysis
Southern analysis was carried out with DNA from several potato
cultivars: Désirée, Stirling, Gladstone, Lumpers, Teena; different
Solanum species (accession numbers in the Commonwealth Potato
Collection at the Scottish Crop Research Institute, Dundee, in
brackets): S. phureja (IVP 48), S. acaule ssp. aemulans (ACL
7016), S. brachycarpum (BCP 7027), S. chacoense ssp. chacoense
(CHC7143), S. papita (PTA 7079), S. ochranthum (OCR 7517); and
three further solanaceous species: Lycopersicon esculentum (cv.
Moneymaker), Nicotiana benthamiana, and Datura stramonium.
Approximately 30 lg of either EcoRI or HindIII-digested DNA was
loaded per lane. The blots were probed with a 215 bp fragment of
exon 18 of the potato urease gene, generated by PCR using the
reverse primer (39) described previously and a forward primer:
TGGATGCTGGAATAAAAG. Washes were performed at 65 8C
with 23 SSC (saline sodium citrate buffer), 0.1% SDS (sodium
dodecyl sulphate; twice for 5 min) and 0.13 SSC, 0.1% SDS (twice
for 15 min). The washed blots were exposed to film for 22 h.
Mapping of potato urease
A potato diploid F1 population (SH83-92-488 3 RH89-039-16;
Rouppe van der Voort et al., 1997) was used to determine the map
location of urease. Two primers AGGCTGCAAGTTCTAATTC and
Analysis of two alleles of the potato urease gene 93
GTGTATACAAAGTAAATCCCAAC were used to amplify a simple sequence repeat region in intron 17. Reaction conditions,
separation, and visualization of reaction products were as described
in Provan et al. (1996). Genetic linkage analysis was performed using
Joinmap version 2.0 software (Stam and van Oijen, 1995).
Protein extraction, electrophoresis, and in-gel urease
detection
Tissue from field-grown potato plants before the flowering stage were
used for protein extraction in 50 mM phosphate buffer (pH 7.5)
containing 1.5% PVPP, 50 mM NaCl, 1 mM EDTA, 10 mM DTT,
and 0.1 mM PMSF (tissue to buffer ratio=1:3). Extracts were
centrifuged at 20 000 g for 20 min at 4 8C and protein concentrations
of the supernatants were determined by a commercial Bradford assay
(Bio-Rad) using BSA as standard. Electrophoresis and in-gel staining
were performed as described by Witte and Medina-Escobar (2001).
75 lg protein were loaded per sample (except for the mother tuber,
because of low protein concentration: loading 13 lg).
Bioinformatic tools
Sequence alignments of ureases were generated with Clustal W
(Thompson et al., 1994) using default settings. The three urease
subunit sequences of Klebsiella aerogenes were fed in as a single
contiguous sequence. Shadings were generated using the public domain program BOXSHADE. Urease and adenylate kinase sequences
were identified by BLAST searches (Altschul et al., 1997). Single
nucleotide exchanges and Indels were identified by pairwise alignment of the genomic urease clones using the GAP program
(University of Wisconsin Genetics Computer Group). TRIM elements were discovered as described by Witte et al. (2001b).
Results
Cloning and structural analysis of the potato urease
gene
Three overlapping lambda clones (k1, k2a, k2b) containing
the urease gene sequence of Solanum tuberosum ssp.
tuberosum (cv. Désirée) were isolated from a lambda phage
genomic DNA library (Clontech; Fig. 1). Fragments k2a
and k2b were identical in the overlapping region and the
joined sequence (18 962 bp; accession number EMBL:
AJ276864; subsequently referred to as k2) contains one
allele of a full-length urease gene, comprizing 18 exons
(Fig. 1; exons 1–18). Three additional possible exons were
found upstream of the urease gene, coding for a peptide
with strong similarity to the C-terminal sequence of plant
adenylate kinases (Fig. 1; exons A–C).
The fragment k1 (11 066 bp, accession number EMBL:
AJ276865) overlaps completely with k2 (Fig. 1), but is not
identical to it. The most obvious difference is an insertion of
1755 bp in intron 6 of k2 absent in k1 (Fig. 1; insertion).
This insertion represents a retrotransposon, containing long
terminal repeats of 261 bp, but lacking internal coding
regions for mobility factors, indicating that this element is
not capable of autonomous transposition. Some fragmented
remnants of coding sequence for reverse transcriptase and
RNaseH allowed the element to be classified as Ty1-copia.
The Ty1-copia element is flanked by further repeats
belonging to a terminal-repeats retrotransposon in miniature (TRIM; Fig. 1). The TRIM is also present at the same
position in k1, but is not interrupted as in k2. The nonautonomous TRIM-type of retrotransposons were first
discovered in the potato urease gene, but were later found
to be widespread in genomes of monocot and dicot plant
species (Witte et al., 2001b).
Urease is a single copy gene in potato and related
species
Whether k1 and k2 are two alleles of the same gene or
represent different genes was tested by Southern Blot and
mapping analysis. Using a fragment of exon 18 as probe,
single hybridizing fragments were observed in Southern
blots generated with EcoRI and HindIII digested genomic
DNA of several cultivars of Solanum tuberosum and various other solanaceous species, including tomato, Datura
stramonium, and Physalis floridana (Fig. 2). The restriction
fragments expected for the potato cv. Desireé are marked
in the genomic map of the urease gene (Fig. 1). For
N. benthamiana a faint band could only be observed after
prolonged exposure (not shown). These data indicate that
these species possess a single copy gene for urease, whereas
two urease gene copies were reported in soybean (Torisky
Fig. 1. Schematic alignment of genomic urease clones from potato (drawn to scale). Exons are shown as dark shaded boxes. Adenylate kinase exons are
labelled with capital letters, urease exons are numbered (above the alignment). The Ty1-copia element is marked with a grey shaded box, the TRIM
element with an open box containing a diagonally crossing line. EcoRI and HindIII fragments seen on the Southern blots (Fig. 2) are marked, the
downstream restriction site for the HindIII fragment is unknown.
94 Witte et al.
1999). Thus, it is likely that urease is a single copy multiallelic gene in potato and probably also in several other
solanaceous species.
SNPs and Indels between the two allelic urease copies
Genomic subclones of the urease gene alleles were sequenced on both strands and most regions on each strand
was sequenced more than once. A detailed comparison of
the overlapping region between the two urease alleles
revealed the presence of 277 single nucleotide polymorphisms (SNPs; on average, 2.5 polymorphisms per 100 bp:
2.5%). For non-coding regions a SNP frequency of 2.8%
was found while in coding regions the frequency was 1.2%.
Within the non-coding regions 40 insertion/deletion
(Indel) events can be documented. Of these 70% are 1–4
bp in length, 20% are 5–10 bp, and 10% (four events) are
longer than 10 bp. Possible causes for most of the longest
Indels may be deduced from sequence features. As mentioned above, the insertion in intron 6 (k2) is due to
a retrotransposon; an Indel of 30 bp is found in an array of
30 bp repeats in intron 14 which is probably caused by
unequal cross-over; and an Indel of 34 bp in intron 17 is
present in a SSR region, which are known to undergo
expansion and contraction probably due to polymerase
slippage during replication (Schlötterer and Tautz, 1992).
The urease promoter and urease expression
Fig. 2. Autoradiography of two Southern blots containing EcoRIdigested (a) or HindIII-digested (b) DNA from different solanaceous
species, probed with a fragment of exon 18 of potato urease. The first five
lanes contain DNA from different potato cultivars, the next six lanes
contain DNA from wild-type Solanum species, the last three lanes contain
DNA from solanaceous species. See Materials and methods for species
accession numbers and experimental details.
et al., 1994). The presence of a second urease copy could
not be ruled out for Solanum papita, Solanum acaule, and
Solanum brachycarpum because two hybridizing bands
were observed when genomic DNA was digested with
HindIII (for S. acaule also with EcoRI; Fig. 2).
A simple sequence repeat (SSR) present in intron 17 of
the sequenced urease gene from Solanum tuberosum (cv.
Désirée) was used to map the gene on an ultra-high density
AFLP (amplified fragment length polymorphism) map
(Isidore et al., 2003). The gene mapped to a single location
on chromosome 5, near Gp188 and Stm1020 (Collins et al.,
The urease transcription start site was localized by 59-RACE
at ÿ60 (translation start site= +1). Although a canonical
TATA element and other typical promoter elements cannot
be found by manual inspection, computational promoter
prediction using a neural network (server at http://www.
fruitfly.org/seq_tools/promoter.html; Reese and Eeckman,
1995) locates a possible transcription start site at ÿ57,
indicating the presence of possible promoter elements. The
absence of a canonical TATA box has been reported for
other genes (Dynan, 1986; Ibrahim et al., 2001).
Steady-state levels of urease mRNA were found to be
undetectable by northern blot analysis using 30 lg of total
RNA from a variety of organs (not shown), suggesting
either a low level of transcription or instability of urease
mRNA. In western blots using a polyclonal antibody
against jackbean seed urease, the potato enzyme could be
detected in all organs investigated, but only close to the
detection limit (not shown). In-gel urease activity staining
showed that urease activity is ubiquitously present in the
potato plant (Fig. 3) which is consistent with results
obtained from activity measurements in different tissues
(Witte et al., 2002b). Thus, the urease promoter appears to
drive low-level housekeeping expression of the urease
gene. However, urease activity levels seem more than
sufficient for the plant’s needs since urea applied to the
leaves is hydrolysed more rapidly than the resulting
ammonium can be assimilated (Witte et al., 2002b).
Analysis of two alleles of the potato urease gene 95
Fig. 3. In-gel urease activity stain for different potato organ extracts. Sink
leaves are leaves from the second node under the apical shoot tip, source
leaves are leaves directly above the ground. Purified jackbean urease
(8 mU; Boehringer) was loaded as positive control (last lane). Secondary
bands stem from different aggregation states of urease (Fishbein, 1969).
Comparative analysis of ureases from different
eukaryotes
Coding sequences of both allelic urease forms from potato
and of ubiquitous urease from soybean were compared to
all other eukaryotic urease sequences available (two plant
and three fungal sequences) and also to 36 full-length
bacterial sequences. An alignment focusing on the plant
sequences compared with the sequence from Schizosaccharomyces pombe and Klebsiella aerogenes is shown
in Fig. 4. In most bacteria, urease is encoded by three genes
(ureA, ureB, and ureC). Eukaryotic urease genes contain
regions of similarity collinear to all three bacterial genes,
bridged by short linking regions not present in bacteria
(ureA-bridge-ureB-bridge-ureC). The degree of sequence
conservation among ureases of different origin is high. For
example, ureA, ureB, and ureC from K. aerogenes are 54%,
50%, and 61% identical at the protein level to the corresponding sequences of potato urease (k2), while urease from
A. thaliana and potato (k2) are 75% identical. The cDNA
sequence of the ubiquitous soybean urease that was recently
deposited in the database (accession number EMBL:
AY230156) is identical to the sequence obtained in this
study except for one silent nucleotide exchange.
Detailed biochemical studies have been carried out on
urease from Klebsiella aerogenes. All residues biochemically shown, or structurally inferred, to be important for
optimal enzyme performance in K. aerogenes are conserved
in eukaryotic sequences (Fig. 4; amino acid labelling according to K. aerogenes urease). This includes the residues
that co-ordinate nickel in the active site of K. aerogenes
urease (Hisa134, Hisa136, Hisa246, Hisa272, and Aspa360) and
the lysine residue carrying the carboxyl group which bridges
the two active site nickel ions (Ka217; Park and Hausinger,
1993; Jabri et al., 1995). It also includes Hisa219, thought to
aid in the polarization of the urea carbonyl group, and
Hisa320, thought to act as a general acid during catalysis, as
well as Da221 and Ra336, implied in the modulation of Hisa320
orientation and acidity (Pearson et al., 2000). Finally, it
includes Cysa319, shown not to be essential for catalytic
activity but to facilitate catalysis at neutral and basic pH
values (Martin and Hausinger, 1992; Pearson et al., 1997).
Given the high degree of overall conservation and the
conservation of catalytically important residues among
prokaryotic ureases, and also between eukaryotic and prokaryotic enzymes, it seems likely that all ureases described
to date are structurally similar, employing the same catalytic
mechanism. The crystal structure of K. aerogenes urease is
consistent with this notion, since the bridging regions that
connect ureA, ureB, and ureC in eukaryotes could be
accommodated without significantly altering the structure
(Jabri et al., 1995).
Alternative splicing of potato urease
The insertion of retrotransposons into an intron of a gene
has the potential to alter pre-mRNA splicing patterns
(Marillonnet and Wessler, 1997). To investigate whether
the presence of the Ty1-copia and retrotransposon in intron
6 of the k2-urease allele hinders the generation of functional mRNA from this allele, urease-specific mRNA was
amplified by RT-PCR from leaf and root tissues, with
primers flanking the complete coding region. Ten clones
from leaf and 12 clones from root were sequenced to test
the integrity of the coding sequence (accession number
EMBL: AJ308543 and EMBL: AJ308544 for allelic forms
1 and 2, respectively). Surprisingly, urease-specific mRNA
was found to be differentially spliced at various locations
(Table 1; Fig. 5), but splicing of the retrotransposoncontaining intron was accurate in both alleles, indicating
that the transposon insertion does not influence splicing
efficiency of this intron. In the leaf, four of the 10
sequenced clones showed alternative splicing compared
with expected splicing, whereas in the root, alternative
splicing was found in two out of 12 clones, with one clone
being affected by two different events (Table 1). Retention
of intron 11 was the only alternative splicing event that
could be documented twice (once in the leaf and once in the
root), all other cases differed from each other, affected
introns 4, 5, 7, 9, 10, 11, 12, and 17 indicating widespread
changes in splice site choice throughout the gene (Table 1).
In several cases, a small shift in either the 39 or the 59 splice
site had occurred, but more extensive mRNA alterations
were also observed, including the skipping of exon 10, the
retention of intron 11, and the inclusion of 73 bp of intron 4
as an exon (Fig. 5). In all but one case (Table 1; line 1),
alternative splicing introduced stop codons, shortening the
open reading frame. Urease amplicons were size-selected
before cloning (see Materials and methods), thus putative
alternative splicing events that would greatly alter mRNA
size were not selected. It can therefore not be excluded that
such splicing events occur.
Discussion
Gene copy number
In contrast to the situation in soybean, urease is a single
copy gene in potato and several related solanaceous species
96 Witte et al.
Fig. 4. Alignment of ureases, generated with Clustal W using default parameters. S. tub., Solanum tuberosum (allele k2); sequence variations in k1 are
given above the alignment; G. max, Glycine max; C. ens., Canavalia ensiformis (Swissprot: p07374); A. tha., Arabidopsis thaliana (SpTrembl:
aaf07806); S. pom., Schizosaccharomyces pombe (SpTrembl: cab52575); K. aer., Klebsiella aerogenes (Swissprot: p18314; p18315; p18316 for
subunits A, B, and C, respectively). Arrows underneath the alignment show the approximate intron positions in ureases from S. tuberosum and
A. thaliana. The arrow points to the amino acid whose codon is at least partially part of the preceding exon. Residues shown to be important for urease
function in K. aerogenes are marked with black triangles, numbered with the amino acid position in the corresponding K. aerogenes subunit. Residues
tested, but not found to be important for function are marked with an asterisk.
Analysis of two alleles of the potato urease gene 97
(Fig. 2). The genome of A. thaliana also contains only one
copy of urease. A second copy of urease in soybean (and
related species) was probably the result of a gene duplication
event, allowing the development of an enzyme expressed
mainly in seed. While the ubiquitous urease enzyme, found
in all organs in soybean, is essential for the recycling of
metabolically derived urea (Stebbins et al., 1991), the
function of the seed-specific enzyme is less clear (Polacco
and Holland, 1993). In potato, urease activity was detected
in all organs investigated (Fig. 3; Witte et al., 2002b). The
potato urease gene is therefore likely to be the functional
equivalent to the ubiquitous urease gene of soybean.
SNPs and Indels
The comparison of 11 kbp of allelic DNA allowed the
frequency of SNPs and Indels to be assessed in this region
of the potato genome. The average frequency of 1 SNP
every 40 bp between the two urease alleles is comparatively
high. When 10 different loci from three Arabidopsis
ecotypes were compared, polymorphism was detected only
every 207–413 bp on average, although a greatly increased
frequency was observed at one hypervariable locus (Hauser
et al., 1998). An analysis of 39-untranslated regions of
20 loci in 30 maize lines revealed the presence of one SNP
Table 1. Alternative splicing of potato urease mRNA
Organ
Allele
Comments
Leaf
1
Leaf
1
Leaf
Leaf
Leaf
1
1
2
Root
1
Root
2
Root
2
39 splice site of intron 9: last 9 bp of intron 9
included in exon 10; a GG codon was chosen as
the 39-splice site
39 splice site of intron 17: first 4 bp of exon 18
spliced out with intron 17
exon 10 skipped
intron 11 retained
73 bp internal sequence of intron 4 included as an
exon (position: 6270–6342 in EMBL: aj276864)
(a) 39 splice site of intron 7: first 5 bp of exon 8
spliced out with intron 7
(b) intron 11 retained
59 splice site of intron 5: last 17 bp of exon 5
spliced out with intron 5
39 splice site of intron 12: first 5 bp of exon 13
spliced out with intron 12
every 70 bp and one Indel every 160 bp on average
(Rafalski et al., 2001). In the human genome, SNPs occur
once every 100–300 bp (SNP database at http://www.
ncbi.nlm.nih.gov/SNP/). To gain a more comprehensive
view of the general genetic variability in the potato genome,
the analysis of several loci would be required.
Given the high degree of polymorphism at the urease
locus it is surprizing that generally single bands were
observed in Southern blot analysis (for all autoploid
Solanum species, Fig. 2). Multiple bands were only observed for the allotetraploid species S. papita and S. acaule
and for the allohexaploid species S. brachycarpum. Alleles
k1 and k2 are the only allelic forms occurring in the
autotetraploid cultivars/species tested, or perhaps other
additional alleles are considerably less polymorphic.
Conservation of ureases
Ureases are highly conserved across eukaryotic and prokaryotic kingdoms (Fig. 4). This analysis has shown that all
the known important features characteristic of ureases in
bacteria were preserved in plants (eukaryotes). The catalytic mechanism employed by plant (eukaryotic) ureases is
therefore unlikely to vary significantly from what has been
found for bacteria. The organization of the urease genes in
bacterial operons is collinear with the regions of similarity
to these genes found in eukaryotic ureases. The presence of
merged ureA and ureB genes in the only distantly related
bacterial groups Helicobacter and Deinococcus suggest
that merging events creating one single reading frame (as
found in eukaryotes) seem likely to have happened more
than once during evolution.
Alternative splicing
Alternative splicing occurs through variable splice site
selection, which results in the production of different
mRNAs derived from the same gene and can give rise to
distinct proteins. In humans, over 60% of genes are
estimated to be alternatively spliced and show multiple
splicing patterns (Black, 2003). By contrast, around 5% of
Arabidopsis genes have been estimated to show alternative
Fig. 5. Schematic drawing of some alternatively spliced urease mRNAs drawn to scale. Exons are given as alternate dark and light shaded boxes.
Intronic sequence is marked by using white boxes. (a) Correctly spliced; (b) exon 10 skipped; (c) intron 11 retained; (d) part of intron 4 included as an
exon into the mRNA (fragment of genomic DNA showing intron 4 is given above the mRNA). Arrows mark stop codons.
98 Witte et al.
splicing of a type less complex than that described for
vertebrates and invertebrates (Brett et al., 2002). Nevertheless, an increasing number of alternative splicing events
have been described to have roles in plant metabolism and
development (Tantikanjana et al., 1993; Comelli et al.,
1999; Figueroa et al., 1999; Mano et al., 1999; Quesada
et al., 2003). Alternative splicing also leads to a truncated
coding sequence due to the activation of intron polyadenylation signals or by bringing translation stops in-frame.
In some cases these proteins retain activity whereas in
others, activity is lost. (Kyozuka et al., 1997; Nishihama
et al., 1997; MacKnight et al., 1997). More recently, the
presence of nonsense termination codons have been described to lead to mRNA degradation through nonsensemediated decay (Maquat, 2004). Such processes regulate
the levels of relevant mRNA available for translation and,
therefore, can regulate gene expression.
Urease mRNA in potato is subject to extensive alternative
splicing at different introns throughout the length of the
gene’s pre-mRNA. It is likely that the number of differentially spliced pre-mRNAs is greater than that described here
due to the limited number of clones sequenced. Recently, the
presence of urease-like sequences in jackbean was reported
(Pires-Alves et al., 2003) which may also be the result of
differential splicing events. In most cases, alternative splicing found in potato urease mRNAs led to the introduction of
stop codons giving rise to shortened ORFs that lack the
catalytic motifs. Thus, aberrant splicing probably results in
a reduction of urease protein, because a great proportion
(50% in leaf and 25% in root) of pre-mRNA was processed
incorrectly (Table 1). This inaccuracy (relaxed splicing) may
be tolerated as long as sufficient intact urease mRNA is
made. In leaves of potato, sufficient urease activity is present
as the substrate, urea, is barely detectable. Even when urea is
applied externally, urease is not rate-limiting for the assimilation of urea nitrogen (Witte et al., 2002b). Thus, despite the
low level of expression and the relaxed splicing of urease
pre-mRNA, urease activity appears to be abundant for the
plant’s needs. Selective pressure for improved expression or
more accurate splicing is probably low.
Relaxed splicing might not only affect urease, but also
other gene transcripts. While in some instances a functional
role for an alternatively spliced transcript may emerge, in
the majority of cases the resulting mRNA is likely to
encode non-functional or at best equally functional proteins. The current literature on alternative splicing in plants
is consistent with this notion. In cases where pre-mRNA
processing is limiting for protein expression, splicing is
probably very accurate due to selective pressure for strong
splice signals. Conversely, a greater extent of relaxed
splicing is likely to occur when protein amounts are more
than sufficient or are limited by other factors. A certain
tolerance/inaccuracy in splicing might be one element in
the toolkit of evolution to aid the emergence of new
functions from old genes.
Acknowledgements
We thank the Ministry of Agriculture, Fisheries, and Food (now the
Department of Environment, Food, and Rural Affairs), the European
Commission TMR programme and the Scottish Executive Environment and Rural Affairs Department for financial support. We thank
R Waugh and CG Simpson for critical reading of the manuscript.
References
Altschul SF, Madden TL, Schaffer AA, Zhang Z, Miller W,
Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs. Nucleic Acids
Research 25, 3389–3402.
Bacanamwo M, Witte CP, Lubbers MW, Polacco JC. 2002.
Activation of the urease of Schizosaccharomyces pombe by the
UreF accessory protein from soybean. Molecular Genetics and
Genomics 268, 525–534.
Black DL. 2003. Mechanisms of alternative pre-messenger RNA
splicing. Annual Review of Biochemistry 72, 291–336.
Brett D, Pospisil H, Valcarel J, Reich J, Bork P. 2002. Alternative
splicing and genome complexity. Nature Genetics 30, 29–30.
Collins A, Milbourne D, Ramsay L, Meyer R, Chatot-Balandras
C, Oberhagemann P, De Jong W, Gebhardt C, Bonnel E,
Waugh R. 1999. QLT for field resistance to late blight in potato are
strongly correlated with maturity and vigour. Molecular Breeding
5, 387–398.
Comelli P, König J, Werr W. 1999. Alternative splicing of
two leading exons partitions promoter activity between the coding
regions of the maize homeobox gene Zmhox1a and Trap
(transposon-associated protein). Plant Molecular Biology 41,
615–625.
Dixon NE, Gazzola C, Blakeley RL, Zerner B. 1975. Jack bean
urease (EC 3.5.1.5). A metalloenzyme. A simple biological role for
nickel? Journal of the American Chemical Society 97, 4131–4133.
Draper J, Scott RJ, Armitage P, Walden R. 1988. Plant genetic
transformation and gene expression: a laboratory manual. London,
UK: Blackwell Scientific Publications.
Dynan W. 1986. Promoters for housekeeping genes. Trends in
Genetics 2, 196–197.
Eskew DL, Welch RM, Cary EE. 1983. Nickel: an essential
micronutrient for legumes and possibly all higher plants. Science
222, 621–623.
FAO. 1998. Database collection of the Food and Agriculture Organization of the United Nations (FAO). Internet: http://apps.fao.org/
Figueroa P, Gómez I, Holuigue L, Araya A, Jordana X. 1999.
Transfer of rps14 from the mitochondrion to the nucleus in maize
implied integration within a gene encoding the iron–sulphur
subunit of succinate dehydrogenase and expression by alternative
splicing. The Plant Journal 18, 601–609.
Fishbein WN. 1969. The structural basis for the catalytic complexity
of urease: interacting and interconvertible molecular species (with
a note on isozyme classes). Annals of the New York Academy of
Science 147, 857–881.
Frankenberger WT, Tabatabai MA. 1982. Amidase and urease
activities in plants. Plant and Soil 64, 153–166.
Freyermuth SK, Bacanamwo M, Polcacco JC. 2000. The soybean
Eu3 gene encodes an Ni-binding protein necessary for urease
activity. The Plant Journal 21, 53–60.
Goldraij A, Beamer LJ, Polacco JC. 2003. Intrallelic complementation at the ubiquitous urease coding locus of soybean. Plant
Physiology 132, 1801–1810.
Hauser MT, Adhami F, Dorner M, Fuchs E, Glossl J. 1998.
Generation of co-dominant PCR-based markers by duplex
Analysis of two alleles of the potato urease gene 99
analysis on high resolution gels. The Plant Journal 16,
117–125.
Hogan ME, Swift IE, Done J. 1983. Urease assay and ammonia
release from leaf tissues. Phytochemistry 22, 663–667.
Ibrahim AFM, Watters JA, Brown JWS. 2001. Differential
expression of potato U1A spliceosomal protein genes: a rapid
method for expression profiling of multigene families. Plant
Molecular Biology 45, 449–460.
Isidore E, van Os H, Andrzejewski S, et al. 2003. Toward
a marker-dense meiotic map of the potato genome: lessons from
linkage group I. Genetics 165, 2107–2116.
Jabri E, Carr MB, Hausinger RP, Karplus PA. 1995. The crystal
structure of urease from Klebsiella aerogenes. Science 268,
998–1004.
Kyozuka J, Harcourt R, Peacock WJ, Dennis ES. 1997. Eucalyptus has functional equivalents of the Arabidopsis AP1 gene.
Plant Molecular Biology 35, 573–584.
MacKnight R, Bancroft I, Page T, et al. 1997. FCA, a gene
controlling flowering time in Arabidopsis, encodes a protein
containing RNA-binding domains. Cell 89, 737–745.
Mano S, Hayashi M, Nishimura M. 1999. Light regulates alternative splicing of hydroxypyruvate reductase in pumpkin. The Plant
Journal 17, 309–320.
Maquat LE. 2004. Nonsense-mediated mRNA decay: a comparative
analysis of different species. Current Genomics 5, 175–190.
Marillonnet S, Wessler SR. 1997. Retrotransposon insertion into
the maize waxy gene results in tissue-specific RNA processing. The
Plant Cell 9, 967–978.
Martin PR, Hausinger RP. 1992. Site-directed mutagenesis of the
active site cysteine in Klebsiella aerogenes urease. Journal of
Biological Chemistry 267, 20024–20027.
Mobley HLT, Hausinger RP. 1989. Microbial ureases—significance,
regulation, and molecular characterization. Microbiology Reviews
53, 85–108.
Nishihama R, Banno H, Kawahara E, Irie K, Machida Y. 1997.
Possible involvement of differential splicing in regulation of the
activity of Arabidopsis ANP1 that is related to mitogen- activated
protein kinase kinase kinases (MAPKKKs). The Plant Journal 12,
39–48.
Park I-S, Hausinger RP. 1993. Site-directed mutagenesis of
Klebsiella aerogenes urease: identification of histidine residues
that appear to function in nickel ligation, substrate binding, and
catalysis. Protein Science 2, 1034–1041.
Pearson MA, Michel LO, Hausinger RP, Karplus PA. 1997.
Structures of Cys319 variants and acetohydroxamate-inhibited
Klebsiella aerogenes urease. Biochemistry 36, 8164–8172.
Pearson MA, Park I-S, Schaller RA, Michel LO, Karplus PA,
Hausinger RP. 2000. Kinetic and structural characterization of
urease active site variants. Biochemistry 39, 8575–8584.
Pires-Alves M, Grossi-de-Sa MF, Barcellos GBS, Carlini CR,
Moraes MG. 2003. Characterization and expression of a novel
member (JBURE-II) of the urease gene family from jackbean
(Canavalia ensiformis (L.) DC). Plant and Cell Physiology 44,
139–145.
Polacco JC, Holland MA. 1993. Roles of urease in plant cells.
International Review of Cytology 145, 65–103.
Provan J, Powell W, Waugh R. 1996. Microsatellite analysis of
relationships within cultivated potato (Solanum tuberosum). Theoretical and Applied Genetics 92, 1078–1084.
Quesada V, Macknight R, Dean C, Simpson GG. 2003. Autoregulation of FCA pre-mRNA processing controls Arabidopsis
flowering time. EMBO Journal 22, 3142–3152.
Rafalski A, Ching A, Bhattramakki D, Morgante M, Dolan M,
Register JC, Smith OS, Tingey S. 2001. SNP markers in maize:
discovery and applications. In: Plant and animal genome, IX. The
international conference on the status of plant and animal genome
research, 13–17 January 2001, San Diego, USA, W149.
Reese MG, Eeckman FH. 1995. Novel neural network algorithms
for improved eukaryotic promoter site recognition. The Seventh
International Genome Sequencing and Analysis Conference,
Hilton Head Island, South Carolina.
Rouppe van der Voort J, van Zandvoort P, van Eck H,
Folkertsma R, Hutten R, Draaistra J, Gommers F, Jacobsen
E, Helder J, Bakker J. 1997. Use of allele specificity of
comigrating AFLP markers to align genetic maps from different
potato genotypes. Molecular and General Genetics 255, 438–447.
Schlötterer C, Tautz D. 1992. Slippage synthesis of simple
sequence DNA. Nucleic Acids Research 20, 211–215.
Shimada N, Ando T. 1980. Role of nickel in plant nutrition. (2)
Effect of nickel on the assimilation of urea by plants. Japanese
Journal of Soil Science and Plant Nutrition 51, 493–496.
Stam P, van Oijen J. 1995. Joinmap 2.0: Software for calculation of
genetic linkage maps. CPRO-DLO, Wageningen.
Stebbins NE, Holland MA, Cianzio SR, Polacco JC. 1991. Genetic
tests of the roles of the embryonic ureases of soybean. Plant
Physiology 97, 1004–1010.
Tantikanjana T, Nasrallah ME, Stein JC, Chen CH, Nasrallah
JB. 1993. An alternative transcript of the S-locus glycoprotein
gene in a class-II pollen-recessive self-incompatibility haplotype of
Brassica oleracea encodes a membrane-anchored protein. The
Plant Cell 5, 657–666.
Thompson JD, Higgins DG, Gibson TJ. 1994. Clustal W: improving the sensitivity of progressive multiple sequence alignment
through sequence weighting, position-specific gap penalties and
weight matrix choice. Nucleic Acids Research 22, 4673–4680.
Torisky RS, Griffin JD, Yenofsky RL, Polacco JC. 1994. A singlegene (Eu4) encodes the tissue-ubiquitous urease of soybean.
Molecular and General Genetics 242, 404–414.
Witte C-P, Isidore E, Tiller SA, Davies HV, Taylor MA. 2001a.
Functional characterization of urease accessory protein G (ureG)
from potato. Plant Molecular Biology 45, 169–179.
Witte C-P, Le QH, Bureau T, Kumar A. 2001b. Terminal-repeat
retrotransposons in miniature (TRIM) are involved in restructuring
plant genomes. Proceedings of the National Academy of Sciences,
USA 98, 13778–13783.
Witte C-P, Medina-Escobar N. 2001. In-gel detection of urease
with nitroblue tetrazolium and quantification of the enzyme from
different crop plants using the indophenol reaction. Analytical
Biochemistry 290, 102–107.
Witte C-P, Tiller SA, Taylor MA, Davies HV. 2002a. Addition of
nickel to Murashige and Skoog medium in plant tissue culture
activates urease and may reduce metabolic stress. Plant Cell Tissue
and Organ Culture 68, 103–104.
Witte C-P, Tiller SA, Taylor MA, Davies HV. 2002b. Leaf urea
metabolism in potato. Urease activity profile and patterns of
recovery and distribution of 15N after foliar urea application in
wild-type and urease-antisense transgenics. Plant Physiology 128,
1129–1136.