Download Myc-Transformed Epithelial Cells Down

[CANCER RESEARCH 64, 3126 –3136, May 1, 2004]
Myc-Transformed Epithelial Cells Down-Regulate Clusterin, Which Inhibits Their
Growth in Vitro and Carcinogenesis in Vivo
Andrei Thomas-Tikhonenko,1 Isabelle Viard-Leveugle,3,4 Michael Dews,1 Philippe Wehrli,3 Cinzia Sevignani,1
Duonan Yu,1 Stacey Ricci,2 Wafik el-Deiry,2 Bruce Aronow,5 Gürkan Kaya,3 Jean-Hilaire Saurat,3 and
Lars E. French3
Departments of 1Pathobiology and 2Medicine, University of Pennsylvania, Philadelphia, Pennsylvania; 3Louis-Jeantet Skin Cancer Lab, Department of Dermatology, Geneva
University Medical School, Geneva, Switzerland; 4IVL BioService, Saint-Barthélémy, Le Gua, France; and 5Division of Developmental Biology, Children’s Hospital Research
Foundation Cincinnati, Ohio
ABSTRACT
Effective treatment of malignant carcinomas requires identification of
proteins regulating epithelial cell proliferation. To this end, we compared
gene expression profiles in murine colonocytes and their c-Myc-transformed counterparts, which possess enhanced proliferative potential. A
surprisingly short list of deregulated genes included the cDNA for clusterin, an extracellular glycoprotein without a firmly established function.
We had previously demonstrated that in organs such as skin, clusterin
expression is restricted to differentiating but not proliferating cell layers,
suggesting a possible negative role in cell division. Indeed, its transient
overexpression in Myc-transduced colonocytes decreased cell accumulation. Furthermore, clusterin was down-regulated in rapidly dividing
human keratinocytes infected with a Myc-encoding adenovirus. Its knockdown via antisense RNA in neoplastic epidermoid cells enhanced proliferation. Finally, recombinant human clusterin suppressed, in a
dose-dependent manner, DNA replication in keratinocytes and other cells
of epithelial origin. Thus, clusterin appears to be an inhibitor of epithelial
cell proliferation in vitro. To determine whether it also affects neoplastic
growth in vivo, we compared wild-type and clusterin-null mice with
respect to their sensitivity to 7, 12-dimethylbenz(a)anthracene /12-Otetradecanoylphorbol-13-acetate (DMBA/TPA)-induced skin carcinogenesis. We observed that the mean number of papillomas/mouse was higher
in clusterin-null animals. Moreover, these papillomas did not regress as
readily as in wild-type mice and persisted beyond week 35. The rate of
progression toward squamous cell carcinoma was not altered, although
those developing in clusterin-null mice were on average better differentiated. These data suggest that clusterin not only suppresses epithelial cell
proliferation in vitro but also interferes with the promotion stage of skin
carcinogenesis.
INTRODUCTION
c-Myc is an oncogene that is overexpressed in many human tumors
ranging from B-cell lymphoma to colon carcinoma. However, despite
aggressive research, the molecular mechanisms leading to neoplastic
transformation are incompletely understood. Myc is a member of the
Myc/Max/Mad network of transcription regulators (1). It interacts
with Max, binds as a heterodimer to the E-box element (2), and
activates expression of genes containing this sequence (3, 4). Gene
activation by Myc/Max is thought to occur primarily via chromatin
remodeling (5–7). Besides activating gene expression, Myc is also
known to inhibit transcription from promoters containing the initiator
element (8), at least in part via recruitment of the Miz-1 corepressor
Received 7/2/03; revised 2/10/03; accepted 2/23/04.
Grant support: National Science Foundation, Geneva and Swiss Cancer Leagues, and
Ernst & Lucie Schmidheiny and Stanley Thomas Johnson Foundations (L. French),
and National Cancer Institute Grant CA 071881 and National Institute of Diabetes and
Digestive and Kidney Diseases Grant DK 050306 (A. Thomas-Tikhonenko).
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
Note: A. Thomas-Tikhonenko and I. Viard-Leveugle contributed equally to this work.
Requests for reprints: Andrei Thomas-Tikhonenko, University of Pennsylvania, 3800
Spruce Street, M/C 6051, Philadelphia, PA 19104-6051 or Lars French, Louis-Jeantet
Skin Cancer Lab 5.222, Geneva University Medical Center, 1, rue Michel Servet, 1211
Genève 4, Switzerland.
(9). The identities of Myc-target genes might provide crucial clues as
to its normal function and the role in cancer.
Myc affects expression of many proteins whose functions range
from cell metabolism to ribosome biogenesis (10, 11). However, the
majority of putative Myc target genes pertain to cell proliferation.
Among them are ornithine decarboxylase, the enzyme involved in
DNA biosynthesis (12), cyclin A (13), and cdc25A, a phosphatase
required to activate cyclin-dependent kinases (14). More recently,
cyclin-dependent kinase 4 itself was shown to be up-regulated by Myc
(15), and members of the Myc family were reported to activate Id2, an
inhibitor of the retinoblastoma tumor/cell cycle suppressor (16). Myc
also activates the telomerase gene (17), presumably extending the life
span of the host cell. Furthermore, several Myc-repressed genes play
roles in cell cycle control: cyclin D1 (18); assorted cyclin-dependent
kinase inhibitors (19 –22); gadd45 (23); and gas (24). Consistent with
these observations, activation of Myc forces quiescent fibroblasts to
reenter cell cycle (25). Moreover, rodent fibroblasts with targeted
disruption of Myc are severely deficient in cell proliferation (26).
Consequently, in mice [but curiously not in Drosophila (27)], decreased expression of Myc results in hypoplasia (28). A consensus has
thus emerged that Myc functions in a cell-autonomous manner via
tipping the balance between intracellular pro- and antimitogenic
signals in favor of the former.
However, recent research has led to the augmentation of this
paradigm as some Myc targets encode extracellular proteins that could
potentially affect neighboring cells in a paracrine manner. For instance, we have previously demonstrated that Myc down-regulates
thrombospondin-1, a large secreted glycoprotein (29, 30). Thrombospondin-1 and thrombospondin-2 negatively affect proliferation of
epithelial (31) and endothelial cells (32, 33), suggesting that its
down-regulation (e.g., via Myc overexpression) could benefit the
tumor in two ways: by increasing proliferation of neoplastic cells and
also by stimulating the recruitment of vascular endothelium (34).
Indeed, activation of Myc results in the acquisition of the angiogenic
phenotype (35–38).
We were interested in determining whether down-regulation of
secreted glycoproteins with antiproliferative activities is a common
theme underlying the transforming function of Myc. In addition, the
vast majority of gene regulation studies have thus far been performed
on Myc-overexpressing fibroblasts or B-lymphoid cells (39).6 Only of
late have epithelial cell systems started being used, with some interesting results. For example, in a recent study (40), Myc was found to
down-regulate thrombospondin-1 in rat kidney epithelial RK3E cells.
To identify more targets for Myc in epithelial cells, we have established a new experimental system: p53-null murine colonocytes overexpressing Myc and thus undergoing neoplastic transformation. Microarray analysis of gene expression profiles has revealed that in
addition to thrombospondin-1, Myc overexpression results in downregulation of clusterin, a heterodimeric glycoprotein of 80 kDa with a
6
Internet address: http://www.myccancergene.org.
3126
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2004 American Association for Cancer
Research.
Myc-TRANSFORMED CELLS DOWN-REGULATE CLUSTERIN
[3H]Thymidine Incorporation and Cell Accumulation Assays. Epithelial cells were seeded in 96-well plates at a density of 104 cells/well, with three
replicates/sample. After 48 h, cells were fed with complete medium containing
250 nM 4-OHT (for MycER-expressing cells), clusterin (for primary human
cells), or vehicle alone. Twenty-four to 30 h later, 1 ␮Ci of [3H]thymidine (2
Ci/mmol; New England Nuclear, Boston, MA) was added, and cells were
cultured for an additional 12–18 h. At the end of incubation, the medium was
aspirated, and cells were washed twice with 10% trichloroacetic acid and
solubilized with 0.2 M NaOH for 30 min at room temperature. The incorporated radioactive thymidine was quantified by liquid scintillation counting. To
assess cell accumulation, viable cells were quantified using the WST-1 reagent
(Roche Diagnostics, Indianapolis, IN). The reagent was added to the final
concentration of 10% and incubated with cells for 2– 4 h. Absorbance was then
measured at 450/690 nm using a plate reader.
Microarray and Real-Time Reverse Transcription-PCR Analyses.
RNAs from LMycSN and LXSN (control) colonocytes were isolated using the
TRI reagent (Sigma). These RNAs were converted into Cy3- and Cy5-labeled
cDNAs and hybridized with the Murine Genome Array U74Av2 (Affymetrix,
Santa Clara, CA) per manufacturer’s recommendations. Data were analyzed
using GeneSpring software (Silicon Genetics, Redwood City, CA). Additional
microarray experiments were performed using ATLAS nylon array (Clontech,
Palo Alto, CA). To confirm differences in gene expression, real-time reverse
transcription-PCR reactions were performed using dual-labeled Taqman
probes and an ABI Prizm 7700 machine (Applied Biosystems, Foster City,
CA). Both the clusterin and the gapdh probes were labeled with 5⬘-fluorescein
phosphoramidite/5⬘tetrachloro fluorescein phosphoramidite (FAM/TET) at the
5⬘-end and 6-carboxytetramethylrhodamine (TAMRA) at the 3⬘ end. Their
nucleotide compositions were as follows: agcagcctgcccttcctctggatt (clusterin)
and tcccactcttccaccttcgatgcc (gapdh). Amplification primers had the following
composition: gacccctagagaactccac (clusterin sense), gaatcagttcttcccgag (clusterin antisense), gctacactgaggaccaggttgtct (gapdh sense), and accaggaaatgagcttgacaaaga (gapdh antisense). Before PCR amplification, RNAs were converted
into cDNA using SuperScript One-Step RT-PCR System (Invitrogen).
Western Blotting. For clusterin expression analysis, either cell lysates or
conditioned media were used. To prepare lysates, cells were harvested by
scraping and solubilized in lysis buffer [50 mM HEPES (pH 7.5), 150 mM
NaCl, 1.5 mM MgCl2, 1 mM EGTA, 10% glycerol, 1% Triton X-100, 0.1 mM
phenylmethylsulfonyl fluoride, and 1% protease inhibitor mixture (Sigma)].
Protein content was determined using the Bio-Rad DC protein assay kit
(Bio-Rad, Hercules, CA). Lysates (40 ␮g/lane) were resolved on 4 –15%
PAGE, transferred to nitrocellulose (Schleicher & Schuell, Keene, NH), and
probed with an anti-clusterin antibody (C-18; Santa Cruz Biotechnology, Santa
Cruz, CA or A241; Quidel, San Diego, CA) diluted according to manufacturers’ recommendations. Conditioned media were loaded on PAGE neat.
Appropriate secondary antibodies were used in horseradish peroxidaseconjugated forms. Antibody binding was detected using the enhanced
chemiluminescence system (Amersham Biosciences, Piscataway, NJ). When
indicated, an antibody reactive with murine actin was used to control for equal
loading.
Transient Up-Regulation of Clusterin Expression. The mouse clusterin
cDNA (64) was subcloned into the MigR1 retroviral vector (65). Empty
MigR1 vector was used as a negative control. p53-null MycER colonocytes
were grown to 90% confluence in 24-well plates and transfected with approMATERIALS AND METHODS
priate plasmids using Lipofectamine 2000 (Invitrogen) according to the manNeoplastic Transformation of p53-Null Colonocytes by Myc. Primary ufacturer’s instructions. Conditioned medium was collected 24 h later for
murine colonocytes were cultured as described previously (62). They were Western analysis. At the same time cell accumulation was assessed using the
transfected with either LXSN or pBabePuro retroviral DNAs encoding human WST-1 reagent (see above).
c-Myc or its 4-hydroxytamoxifen (4-OHT)-dependent version (MycER), reStable Down-Regulation of Clusterin Expression via Antisense RNA.
spectively. Transfections were performed using the Lipofectamine Plus reagent The clusterin antisense construct was obtained by subcloning the 597-nt
(Invitrogen, Carlsbad, CA). G418- or puromycin-resistant cells were placed in XbaI/MluI fragment of the full-length human clusterin cDNA from pGEM-4
soft agar, which in case of MycER, was supplemented with 4-OHT (Sigma, St. ZLI (47) into the pCIneo vector in reverse orientation. The resultant construct
Louis, MO). Arising colonies were photographed 10 days later and subse- was transfected into A431 cells using calcium phosphate method, and individquently isolated, pooled, and expanded into mass cultures. For tumorigenicity ual clones with stable integration of the expression vector were obtained
assays, Myc- and Ki-Ras-overexpressing colonocytes were transplanted into following neomycin selection. The two antisense clones (AS2 and AS10) in
syngeneic C57BL6/J mice (The Jackson Laboratory, Bar Harbor, ME) either which clusterin expression was undetectable by Western were chosen for
s.c. or orthotopically into the cecal wall. Orthotopic transplantation was per- additional experiments. The empty pCIneo vector was similarly transfected,
formed as described by Fidler (63). Animals were sacrificed either 4 weeks and neomycin-resistant clones were pooled to produce the control culture.
later or when appearing moribund. Upon euthanasia, they were subjected to
Culturing of Human Epithelial Cells and Fibroblasts. HEKs (66) and
outer root sheath keratinocytes (67) were maintained in Epilife medium congross pathological examination.
3127
homology to thrombospondin-1 type 1 repeat but without a firmly
established function.
Clusterin is constitutively synthesized and secreted by a wide
variety of cell types in many species (41). Because of its discovery in
distinct settings, clusterin bears several names, including cytolysis
inhibitor, sulfated glycoprotein-2, testosterone-repressed prostate
message-2, SP-40,40, and apolipoprotein J. Clusterin has been tentatively implicated in several biological processes, including cell adhesion and cell-extracellular matrix interaction (42– 45), regulation of
the complement cascade (46 – 48), lipid transport (49 –51), cellular
protection, and tissue remodeling (42, 52). In this context, it has been
shown that clusterin gene expression is strongly up-regulated in
response to thermal and oxidative stress and protects cells from
apoptotic cell death caused by these phenomena (53, 54). Thus,
clusterin might function as a molecular chaperon (55). However, not
all forms of clusterin exhibit antiapoptotic properties. Recently, a
truncated 55 kDa form of clusterin induced by irradiation in vitro has
been found targeted to the nucleus where it appears to act as a death
signal (56 –58). Therefore, the exact biological function of clusterin
remains to be elucidated. One interesting possibility is that clusterin
could influence the choice between proliferation and differentiation.
Indeed, Diemer et al. (59) have shown that clusterin gene expression
correlates with in vitro differentiation of aortic smooth muscle cells.
In our group, we have shown that clusterin is widely expressed in
developing epithelia during murine embryogenesis. In addition, clusterin mRNA is selectively localized within differentiating layers of
tissues such as the developing skin, tooth, and duodenum, where
proliferating and differentiating compartments are readily distinguishable (60). For instance, the epidermis is comprised of the basal layer
of proliferating keratinocytes expressing keratins 5 and 14 and the
suprabasal layers of terminally differentiating postmitotic keratinocytes expressing keratins 1 and 10. It turned out that in the skin,
clusterin production is confined to suprabasal layers, and in the
developing hair follicles, it is localized to the inner root sheath where
cells undergo morphogenesis and differentiation (61). Thus, we hypothesized that clusterin synthesized by differentiating cells is involved in suppression of cell proliferation either directly (as a bona
fide autocrine or paracrine growth factor) or indirectly (via sequestration of other growth factors). To test this hypothesis, the effects of
its up- and down-regulation on cell accumulation were investigated. In
addition, we studied the effects of purified recombinant clusterin on
human epidermal keratinocytes (HEKs) in vitro as well as the effect
of clusterin germ-line inactivation on skin carcinogenesis. Our data
demonstrate that clusterin indeed negatively affects epithelial cell
growth in culture and attenuates neoplastic growth in vivo.
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2004 American Association for Cancer
Research.
Myc-TRANSFORMED CELLS DOWN-REGULATE CLUSTERIN
taining human keratinocyte growth supplement (Cascade Biologics, Portland,
OR). Renal proximal tubule epithelial cells (RPTEC) were obtained from
Clonetics and maintained in the RGM-defined medium (Clonetics, San Diego,
CA). A431 epidermoid carcinoma cells (68) were cultured in RPMI 1640
supplemented with 10% FCS as described previously (54). The 293 adenovirally transformed embryonic kidney cells (69) were cultured in DMEM supplemented with 10% FCS (Invitrogen). Primary human dermal fibroblasts were
cultured in the same medium.
Overexpression of Myc in HEKs. A human c-Myc-expressing adenovirus
that also coexpresses green fluorescent protein (Ad-MYC-GFP) and an adenovirus expressing GFP alone were generated using reagents developed in the
laboratory of Dr. Bert Vogelstein (70). Viruses were purified by CsCl gradient,
and the effective titer was determined by the frequency of GFP-positive cells
after infection. Human foreskin keratinocytes were seeded at a density of
2 ⫻ 105 cells/well in Keratinocyte-SFM medium (Invitrogen). The following
day, cells were infected with adenovirus diluted in PBS for 90 min. Viral
supernatants were replaced with fresh medium, and whole cell extracts were
collected 24 and 48 h after infection in Laemmli sample buffer. Myc expression was confirmed using Western blotting.
Overexpression of Recombinant Human Clusterin in 293 Cells. For
clusterin overexpression, a 1430-bp SalI-fragment of the human clusterin gene
containing the entire coding sequence (with the exception of the ATG codon
and the signal peptide) was used. This fragment was inserted into the pCR3
vector (Invitrogen) encoding the hemagglutinin signal peptide as well as the
FLAG-tag and a histidine heptad. Then, the PvuI-linearized construct was
transfected into 293 cells using calcium phosphate transfection method, and
stable transfectants were selected in G418-containing media. Individual clones
were further analyzed using Northern and Western (with an anti-FLAG antibody) blotting. The clone expressing highest levels of recombinant protein was
selected as a source of clusterin.
Purification of Recombinant Human Clusterin. Large scale propagation
of 293 cells producing clusterin was performed at Apotech Corp. (Lausanne,
Switzerland). Cells were cultured for 7 days in DMEM/F12 medium containing 2% FCS. The supernatant was filtered and passed several times through a
column containing anti-FLAG-M2 affinity gel. Retained clusterin was then
eluted by 0.1 M citric acid (pH 2.5) and neutralized with 1 M Tris (pH 8.0).
Eluted fractions were concentrated using a Jumbosep membrane with a cutoff
size 30 kDa (Pall Corp., East Hills, NY). After several washes with endotoxinfree PBS, the protein concentration was determined using the BCA protein
assay kit (Pierce Biotechnology, Rockford, IL). In parallel, fractions were
obtained that had been depleted of clusterin by passing the preparation overnight at 4°C through a column containing 600 ␮l of anti-FLAG-M2 affinity gel
(Sigma). The depletion was confirmed by Western blotting of aliquots collected prior to (2 ␮l) and after (20 ␮l) passing through the column.
Keratinocyte Clonogenic Assay. A total of 5 ⫻ 103 HEKs was plated in
35-mm Petri dishes. Next day, cells were fed with control medium or medium
containing 50 ␮g/ml recombinant clusterin. After culturing for additional 96 h,
cells were washed with PBS, fixed with 4% paraformaldehyde for 30 min at
room temperature, washed again, and stained with crystal blue in 0.1% borate
buffer for 5 min. The numbers of macroscopic colonies was recorded and
correlated with the presence or absence of clusterin.
Chemical Skin Carcinogenesis. Clusterin gene knockout (Clu-null) mice
(64) were backcrossed to the FVB/N background for six generations because
this strain is sensitive to 7,12-dimethylbenz(a)anthracene/12-O-tetradecanoylphorbol-13-acetate (DMBA/TPA)-induced skin carcinogenesis (71). Fortyfive wild-type (wt) FVB/N mice and 42 Clu-null congenics were shaved on the
back 2 days before tumor initiation and subjected to single topical applications
of 25 ␮g of DMBA (Fluka, Buchs, Switzerland) in 200 ␮l of acetone. Tumor
promotion was carried out by weekly applications of 4 ␮g of TPA (Sigma) in
100 ␮l of acetone. This procedure was continued for 20 weeks. The appearance
of papillomas and carcinomas was assessed weekly. Any mice showing obvious invasive carcinomas were euthanized and excluded from additional statistical analysis. Tumor specimens were fixed in 4% phosphate-buffered formaldehyde, embedded in paraffin, cut into 5-␮m sections, and stained with
H&E. Three sections through different levels were evaluated in a blind fashion
and categorized as well, moderately, or poorly differentiated. In well-differentiated carcinomas, morphological characteristics of the epidermis and the
capacity to undergo keratinization were preserved. In poorly differentiated
carcinomas, there were significant morphological differences between mostly
atypical tumor cells and the normal epidermis. Moderately differentiated
carcinomas possessed intermediate characteristics. Differences between strains
were assessed using the nonparametrical Mann-Whitney U test for papillomas
and the ␹2 test for carcinomas.
RESULTS
Murine p53-Null Colonocytes Are Susceptible to Transformation by c-Myc. Experimental models to study neoplastic transformation of epithelial cells, colonocytes in particular, remain scarce. To
determine whether a previously established line of p53-null murine
colonocytes (62) could be transformed by the c-Myc proto-oncogene,
we have used retroviruses expressing Myc in either constitutively
active form or as a fusion with the estrogen receptor (MycER). The
latter is expressed continuously but requires for activity the presence
of the cognate ligand (4-OHT; Ref. 72). These two forms were
encoded by LMycSN (73) and BabePuroMycER (72) retroviruses,
respectively. LMycSN and BabePuroMycER, along with the corresponding empty vectors (LXSN and BabePuro), were transfected into
colonocytes, and transfectants were selected in an appropriate antibiotic (G418 or puromycin). In LMycSN cultures, there was ⬃5-fold
overexpression of the retrovirally encoded oncoprotein compared with
endogenous c-Myc (Fig. 1A, left). In MycER cultures, the fusion
oncoprotein was constitutively expressed, regardless of the presence
of absence of 4-OHT (Fig. 1A, right). Selected cells were also seeded
in soft agar as described in “Materials and Methods.” Only colonocytes expressing active Myc (LMycSN- or 4-OHT-treated MycERtransduced) formed large colonies (Fig. 1B and data not shown) that
could be discerned with a naked eye. Such colonies were removed
from soft agar, pooled, expanded into cultures, and used for additional
analyses.
To demonstrate that their transformed phenotype depended on
continuous presence of Myc, MycER-overexpressing cultures were
deprived of the hormone. Within two to three passages, they were
noted to revert to the normal epithelial phenotype, with characteristic
cobblestone-like morphology and pronounced contact inhibition of
growth resulting in relatively low cell density (Fig. 1C). They also
grew at much slower rates, as evidenced by total cell accumulation
(data not shown) and tritiated thymidine incorporation. The latter
assay was performed on randomly chosen single-cell clones with
verified expression of Myc. In all clones tested (e.g., 12, 13, 17, and
23), rates of thymidine incorporation were significantly higher in the
presence of 4-OHT (Fig. 1D).
To determine whether LMycSN-transduced colonocytes were tumorigenic, they were engrafted, either s.c. or orthotopically, into
syngeneic or Rag1-null mice. Tumorigenic colonocytes transformed
with the Ki-Ras oncogene (62) were used as a positive control.
Although Ki-Ras-overexpressing cells typically formed tumors within
3 weeks, no neoplasms were apparent in mice injected with Mycoverexpressing colonocytes, even after prolonged observation (6
weeks) and when large numbers of cells (107) were used (data not
shown). We thus concluded that only in vitro do Myc-overexpressing
cells exhibit traits of the neoplastic phenotype. Chief among them is
enhanced cell proliferation, both on solid supports and in semi-solid
media.
Thrombospondin-1 and Clusterin Are Down-Regulated in
Myc-Transformed Colonocytes. To relate Myc-induced enhanced
proliferation to changes in gene expression, we performed microarray
analysis comparing cDNAs in LXSN- versus LMycSN-colonocytes.
Corresponding RNAs were extracted, converted into Cy3- or Cy5labeled cDNAs, and hybridized to an Affymetrix U74Av2 mouse chip
representing ⬃12,000 genes. Additional microarray experiments were
performed, with similar results, using ATLAS nylon arrays. Despite
3128
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2004 American Association for Cancer
Research.
Myc-TRANSFORMED CELLS DOWN-REGULATE CLUSTERIN
Myc-down-regulated genes encoded proteins with extracellular localization (shaded rows in Table 2), including thrombospondin-1, which
we had identified as a Myc target previously (29, 30). These findings
supported the notion that an altered repertoire of extracellular proteins
might play an important role in stimulation of cell division by Myc. Of
these, clusterin was of particular interest to us because its function has
not been firmly established. On the other hand, a homology has been
noticed (41) between amino acids 77–98 in clusterin and cysteine-rich
Fig. 1. Transformed phenotype of c-Myc-overexpressing p53-null murine colonocytes.
A, detection of exogenous Myc proteins in retrovirally transfected colonocytes by Western
blotting. Parental cells were used as negative controls. Migration of c-Myc (left panel) and
the MycER fusion protein (right panel) is indicated by arrows. Murine ␤-actin was used
as a loading control. B, bright field microscopy of colonocyte cultures transfected with
either empty vector (LXSN) or Myc-encoding retrovirus (LMycSN) and seeded in soft
agar as described in “Materials and Methods.” C, bright field microscopy of colonocytes
expressing MycER protein and either treated continuously with 4-hydroxytamoxifen
(4-OHT) or subsequently switched to the normal medium (without 4-OHT). Photographed
cells were grown on uncoated Petri dishes and allowed to reach saturated density. D,
tritiated thymidine incorporation assay. The rate of thymidine incorporation was determined under two growth conditions: with and without 4-OHT. The ratio of the former to
the latter is plotted for each of the indicated cultures. MycER12, 13, 17, and 23 are
randomly chosen single-cell clones where expression of MycER has been verified using
Western blotting.
pronounced changes in cellular phenotypes conferred by Myc overexpression, only ⬃50 cDNAs (including expressed sequence tags)
were up- or down-regulated ⬎3-fold (Fig. 2A). Of these, only 14 upand 15 down-regulated cDNAs corresponded to characterized genes
(Table 2). Surprisingly, none of the up-regulated genes and only one
down-regulated gene [gadd45, a well know-target for Myc (23)], have
been implicated in cell cycle control. On the other hand, a third of
Fig. 2. Down-regulation of clusterin in Myc-overexpressing colonocytes. A, scatterplot
representing expression of individual cDNA in LXSN (x axis)- versus LMycSN (y
axis)-transfected colonocytes. The vast majority of dots aligned along the equal value line
(inner diagonal) and fell within the 3-fold change lines (outer diagonals), indicating
consistency in global gene expression. Dots corresponding to clusterin and thrombospondin-1 cDNAs are circled. B, real-time reverse transcription-PCR analyses of
clusterin mRNA levels in LXSN- and LMycSN-colonocytes. Amplification curves for
both clusterin and gapdh (internal control) are shown. In the two panels, LXSN and
LMycSN colonocytes are compared with respect to clusterin (⌬C0t⬇2.5) and gapdh (no
difference) mRNA expression. C, Western blotting performed on lysates from parental or
Myc (LMycSN)- or Ras (LRasSN)-overexpressing colonocytes using an anti-clusterin
antibody. MycER-overexpressing colonocytes were either pretreated with 4-hydroxytamoxifen (4-OHT) for 24 h or 96 h (⫹OHT) or left untreated (⫺OHT). In all experiments,
murine ␤-actin was used a loading control.
3129
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2004 American Association for Cancer
Research.
Myc-TRANSFORMED CELLS DOWN-REGULATE CLUSTERIN
Table 1 Genes differentially expressed in Myc-transformed versus parental colonocytes
AffyID
Activated by Myc
98465
99580
97128
100445
98843
160547
93994
161132
103226
93929
93883
102906
92917
104017
Repressed by Myc
161045
99126
101993
161294
95286
104598
93097
103430
97890
160469
94515
93705
160522
102298
101359
93122
Fold
change
Significance,
value
Interferon activated gene 204 (Ifi204)
UDP-glucuronosyltransferase 1 family, member 1 (Ugt1a1)
Interleukin 5 receptor, ␣ (Il5ra)
Small proline-rich protein 1B (Sprr1b)
Zinc finger protein of the cerebellum 2 (Zic2)
Thioredoxin interacting protein (Txnip)
Synaptonemal complex protein 3 (Sycp3)
Sciellin (Scel)
Mannose receptor, C type 1 (Mrc1)
Proliferin (Plf)
Proliferin 2 (Plf2)
T-cell specific GTPase (Tgtp)
Matrix metalloproteinase 7 (Mmp7)
Fatty acid-coenzyme A ligase, long chain 4 (Facl4)
21.8
14.0
10.6
8.8
8.6
6.4
5.4
4.8
4.3
4.1
4.0
3.8
3.2
3.1
0.000010
0.001082
0.000333
0.000013
0.000499
0.000021
0.000007
0.000014
0.000253
0.000000
0.000000
0.001991
0.000068
0.000021
Leucine rich repeat protein 1, neuronal (Lrrn1)
Inactive X specific transcripts (Xist)
Tenascin C (Tnc)
Clusterin (Clu)
Clusterin (Clu)
Dual specificity phosphatase 1 (Dusp1)
Arginase 1, liver (Arg1)
Drebrin 1 (Dbn1)
Serum/glucocorticoid regulated kinase (Sgk)
Thrombospondin 1 (Thbs1)
Sulfide quinone reductase-like (yeast) (Sqrdl)
Cholinergic receptor, nicotinic, ␤ polypeptide 1 (muscle) (Chrnb1)
Growth arrest and DNA-damage-inducible 45␥ (Gadd45g)
Nerve growth factor, ␤ (Ngfb)
Laminin, ␤2 (Lamb2)
Acidic epididymal glycoprotein 1 (Aeg1)
29.2
17.5
5.0
4.8
4.5
4.2
4.2
4.0
3.8
3.7
3.6
3.5
3.2
3.2
3.2
3.0
0.999999
0.999987
0.999995
0.999999
0.999999
0.999999
0.999999
0.999999
0.999999
0.999999
0.999995
0.999996
0.999998
0.999999
0.999997
0.999999
Genes
thrombospondin type 1 repeats (TSRs; Ref. 74). Provocatively, TSRs
of thrombospondin-1 are thought to mediate its antineoplastic properties (75, 76).
To confirm that clusterin is indeed a target of Myc, we set up a
real-time reverse transcription-PCR assay that could reproducibly
detect even slight differences in expression levels of clusterin and
gapdh (internal standard). This was apparent in the pilot experiment
where serial 2-fold dilutions of cDNA were used (data not shown).
When cDNAs from LXSN- and LMycSN-colonocytes were tested,
⬃6-fold down-regulation by Myc was observed (⌬C0t⬇2.5; Fig. 2B,
bottom two panels), consistent with the microarray data. No differences in gapdh levels were observed. To demonstrate the corresponding difference in protein levels, we performed Western blotting on
lysates from LMycSN- and LXSN-transduced colonocytes. As evidenced by data in Fig. 2C, left panel, overexpression of Myc correlated with decreased clusterin levels. Importantly, no decrease in
clusterin levels was observed in cells transformed by Ki-Ras oncogene (Fig. 2C, parental versus LRasSN). Thus, deregulation of clusterin should be attributed to Myc, not merely to the transformed
phenotype of Myc-transduced colonocytes.
To determine whether the clusterin gene was a direct target of Myc,
we analyzed MycER colonocytes that had been stimulated with
4-OHT for 96 or 24 h. Down-regulation of clusterin was apparent after
96 h but not after 24 h or in control parental colonocytes (Fig. 1C,
three rightmost panels). This finding could be interpreted in two
ways. One possibility is that clusterin is an indirect target of Myc and
is repressed by intermediate Myc effectors. The other possibility is
that Myc directly interacts with the clusterin gene promoter, but its
down-regulation is contingent upon secondary changes conferred by
Myc overexpression. This second possibility is consistent with the
presence in the clusterin gene promoter (64) of a sequence
ACCA⫹1CCCGC bearing resemblance to the pyrimidine-rich consensus of the initiator element YYCA⫹1YYYYY, a putative Mycresponse element (77). Although the detection of possible Myc bind-
ing to this sequence was beyond the scope of this study, we were
interested in determining whether down-regulation of clusterin contributes to enhanced cell accumulation, the most salient feature of
Myc-transformed colonocytes.
Clusterin Levels Affect Accumulation of Neoplastic Colonocytes. As evidenced by thymidine incorporation assay (Fig. 1D),
activation of Myc forces cells to enter the S-phase in greater numbers.
To determine whether this results in increased cell accumulation and
to correlate this increased accumulation with clusterin levels, we
measured the number of viable MycER-transduced colonocytes with
and without 4-OHT. By the time clusterin was down-regulated (96 h;
Fig. 3A, Western blot in insert), 4-OHT-treated cultures contained
60% more viable cells. However, slight but reproducible differences
in cell numbers were apparent as early as 24 h after 4-OHT treatment,
i.e., before clusterin levels fell (compare Figs. 3A and 2C). Thus, it
seemed unlikely that clusterin alone accounts for Myc-dependent
increase in cell accumulation. Still, clusterin could be one of the cell
growth inhibitors (along with thrombospondin-1) that are downregulated by Myc and thus contribute to enhanced accumulation.
To test whether this was indeed the case, we have generated a
murine clusterin-encoding retrovirus and transfected it into 4-OHTtreated MycER colonocytes with very low levels of endogenous
clusterin. We chose not to select for stable clusterin-overexpressing
clones because those would arise after in vitro selection and could be
enured to potential inhibitory effects of clusterin. Instead, 24 h after
transfection, we directly measured cell accumulation and correlated it
to clusterin levels. The efficiency of transient transfection was moderate, in the range of 15–20%, as judged by the number of GFPexpressing cells (data not shown). However, increased clusterin secretion was apparent when Western blotting was performed on culture
supernatants (Fig. 3B, top panel). Furthermore, because clusterin is a
secreted protein, its increased levels in conditioned media could
affect, in a paracrine fashion, all cells albeit modestly. Indeed, all
cultures transfected with the clusterin construct (Clu1 through 4)
3130
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2004 American Association for Cancer
Research.
Myc-TRANSFORMED CELLS DOWN-REGULATE CLUSTERIN
Fig. 3. Clusterin expression and colonocyte accumulation. A, growth curves of 4-hydroxytamoxifen-treated (⫹4-OHT) versus untreated (⫺4-OHT) MycER-expressing
colonocytes. Down-regulation of clusterin in conditioned media was confirmed using
Western blotting (insert). B, the effect of transient clusterin overexpression on cell
accumulation. Eight cultures of MycER-transduced colonocytes were independently transfected with either the empty vector (GFP1 through GFP4, first four lanes) or the murine
clusterin/green fluorescent protein (GFP)-encoding retrovirus (Clu1 through Clu4, last
four lanes). Clusterin levels in conditioned media were determined using Western blotting
(top panel). In the same cultures, the number of viable cells were determined using WST
assay (plotted in the bottom panel). Average cell accumulation was also plotted (insert)
and analyzed using unpaired Student t test. Observed differences were statistically
significant (P ⬍ 0.05).
contained fewer cells than their “vector only” (GFP1 through 4)
counterparts (graph in Fig. 3B). On average, transient overexpression
of clusterin resulted in ⬃12% decrease in cell accumulation (insert,
light gray versus dark gray bars, P ⫽ 0.033). This decrease could not
account for the full range of Myc effects but was consistent with
clusterin being one of the Myc-down-regulated inhibitors of colonocyte proliferation. We next asked whether this “inhibit the inhibitor”
strategy plays out in other types of epithelial cells, in particular in
keratinocytes that are available both as primary explants (HEKs) and
as epidermoid tumor cell lines.
Clusterin Inhibits Accumulation of Transformed Epidermal
Cells and Is Down-Regulated in Myc-Overexpressing Keratinocytes. To analyze the effect of clusterin on transformed keratinocytes,
we have chosen A431 human epidermoid carcinoma cells (68) where
levels of clusterin are relatively high and further increase in its levels
would be difficult to achieve. Thus, we generated an anti-sense RNA
construct (see “Materials and Methods”) and introduced it into A431
cells. The efficiency of clusterin expression inhibition was assessed
using Western blotting (Fig. 4A, insert). Clones with virtually undetectable clusterin levels were compared with empty vector-transfected
cells with respect to cell accumulation. Both clones with silenced
clusterin grew much faster than parental cells as evidenced by increased numbers of viable cells (Fig. 4A, graph).
We next asked whether clusterin would be subjected to downregulation by Myc in primary HEKs. In these cells, Myc is known to
induce hyperproliferation (78). We thus generated a recombinant
adenovirus coexpressing Myc and GFP and used it to infect HEK as
described in “Materials and Methods.” The efficiency of infection
approached 100%, as judged by visual examination of infected cultures under fluorescent light (Fig. 4B, right). When lysates were
prepared from these cultures and used for Western blotting, it became
apparent that clusterin levels in AdMycGFP-HEKs were several fold
lower that in control AdGFP-HEKs (Fig. 4C). The effect of clusterin
down-regulation on HEK proliferation could be studied using either
transient expression assays (see above) or purified recombinant protein. Because HEKs are rather refractory to conventional transfection
techniques, the second approach was chosen.
Recombinant Human Clusterin Inhibits Proliferation of Keratinocytes and Other Epithelial Cells. To study the role of clusterin
in HEK proliferation in vitro, we generated recombinant human
clusterin. We fused the clusterin coding sequence to the hemagglutinin signal peptide and both FLAG and histidine tags, as described in
“Materials and Methods.” The recombinant construct was introduced
into 293 embryonic kidney cells, and their supernatants were used for
clusterin purification. Under reducing conditions, the purified fraction
(Fig. 5A “Coomassie”) revealed the 40-kDa monomeric reduced,
75– 80-kDa heterodimeric nonreduced form, small quantities of BSA,
and also several high molecular weight species that were not reactive
with the anti-clusterin antibody (Fig. 5A, “Immunoblot”). The latter
were estimated to represent ⬍10% of the total preparation. The
reduced 40-kDa form of clusterin was predominant and comigrated in
PAGE with clusterin detected by an anti-clusterin antibody in human
serum (Fig. 5B).
To test whether clusterin inhibits keratinocyte proliferation, we
treated HEK cultures with recombinant clusterin and measured
[3H]thymidine incorporation, total cell accumulation (both after 48 h),
and clonal outgrowth (after 96 h) as described in “Materials and
Methods.” In the first two experiments, clusterin inhibited DNA
replication and cell accumulation in a dose-dependent manner and
also negatively affected clonal outgrowth when present at a concentration of 50 ␮g/ml (Fig. 5C, left, center, and right panels, respectively). No cell toxicity or apoptosis was apparent in treated cultures.
Importantly, inhibitory concentrations were physiologically relevant
because clusterin’s concentration in serum is in the 50 –200 ␮g/ml
range. To extend our observation to other epithelial cells, we also
treated with clusterin outer root sheath keratinocytes and renal proximal tubule epithelial cells. With both outer root sheath keratinocytes
and renal proximal tubule epithelial cells, the same inhibitory effect of
clusterin on thymidine incorporation was observed (Fig. 5D). Importantly, this effect was caused by clusterin itself because the depletion
of conditioned media on the affinity column efficiently removed
clusterin and at the same time abolished the inhibitory effect on
epithelial cell proliferation (Fig. 5E). In contrast, presence or absence
of clusterin didn’t affect proliferation of primary human dermal fibroblasts, even at high concentrations (50 ␮g/ml). To rule out that cell
accumulation is negatively affected by copurifying BSA, we incubated HEK in media containing defined concentrations of BSA or Clu.
In this experiment, BSA was found to slightly increase cell accumu-
3131
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2004 American Association for Cancer
Research.
Myc-TRANSFORMED CELLS DOWN-REGULATE CLUSTERIN
Fig. 4. Clusterin expression and accumulation of human keratinocytes. A, accumulation of neoplastic epidermoid A431 cells expressing
varying levels of clusterin. Empty vector-transfected cells (Vect) were
compared with two clones (AS2 and AS10) expressing antisense clusterin RNA (see “Materials and Methods”). Down-regulation of clusterin
was confirmed using Western blotting (insert). Recombinant human
clusterin (rClu) was used as a positive control. WT refers to parental
A431 cells. B, infection of human epidermal keratinocytes with a Myc/
GFP-encoding adenovirus (Ad-MYC-GFP, bottom panels). Top panels
refer to the empty vector-infected cells. The two left panels were obtained using bright field microscopy, the two right panels were obtained
using fluorescent microscopy [for green fluorescent protein (GFP) expression]. C, Western blotting performed on cells in B. For clusterin and
actin detection, undiluted lysates were used; for Myc detection, they
were diluted 1:50.
lation, whereas clusterin decreased it (Fig. 5F). Taken together, these
results suggested that clusterin is a bona fide inhibitor of epithelial cell
proliferation in vitro.
Clusterin Inhibits Mouse Skin Tumor Development and Persistence but Not Tumor Progression. To determine whether clusterin attenuates neoplastic growth in vivo, we performed a chemical
DMBA/TPA skin carcinogenesis assay in wt and clusterin-null mice
(64). In both groups tumors began to emerge after a similar latency
(7– 8 weeks), and their sizes and histological appearances did not vary
significantly (data not shown). However, at week 20, the mean number of papillomas/mouse was significantly higher in clusterin-null
mice than in wt mice (P ⫽ 0.02, Mann-Whitney U test; Fig. 6, A and
B). The same was true for the entire first 18-week period (P ⫽ 0.036).
During weeks 20 –35, mice began to develop invasive carcinomas and
had to be euthanized. Thus, comprehensive statistical analysis of
papilloma persistence was hindered by low number of animals. Still,
by week 35, the mean number of remaining papillomas in clusterinnull mice was strikingly higher than in their wt counterparts (3.3
versus 0.8 papillomas/mouse). These data demonstrate that, at early
stages of carcinogenesis, the production of clusterin attenuates the
development and persistence of benign tumors, probably via growth
suppression.
Both groups of mice were also monitored for the development of
invasive squamous cell carcinomas, which in the FVB/N background
occurs in ⬃60% of mice (71). All squamous cell carcinomas were
categorized as well-, moderately, or poorly differentiated, as described
in “Materials and Methods.” There were no statistically significant
differences between clusterin-null and wt mice in the timing of
carcinoma development and the rate of malignant conversion (19 and
15%, respectively; data not shown). However, squamous cell carcinomas developing in clusterin-null mice appeared on average better
differentiated and less aggressive. Indeed, at 42 weeks, the percentage
of poorly or undifferentiated squamous cell carcinomas in clusterinnull animals was 20% (12 of 60), compared with over 50% (32 of 61)
in wt mice (Fig. 6, C and D; ␹2 test, P ⬍ 0.001). Therefore, once the
papilloma have developed, expression of clusterin favors the development of more poorly differentiated and more aggressive carcinoma
phenotypes. This observation is consistent with the idea that tumorattenuating properties of clusterin are realized early in tumor progression when cell proliferation is likely to be a limiting factor.
DISCUSSION
Carcinogenesis in humans is a multistep process involving initiation and promotion mechanisms. These mechanisms rely on the inactivation of one or more tumor suppressor genes and the activation of
certain proto-oncogenes, resulting in uncontrolled proliferation of
tumor cell precursors. This enhanced proliferation could be aided by
decreased synthesis of or decreased response to endogenous growth
inhibitors. The latter are exemplified by the members of the transforming growth factor (TGF)-␤ family such as TGF-␤1 and TGF-␤2.
These are secreted proteins that are constitutively synthesized by a
wide variety of cell types in many species and are potentially implicated in many biological processes, including cell proliferation and
3132
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2004 American Association for Cancer
Research.
Myc-TRANSFORMED CELLS DOWN-REGULATE CLUSTERIN
Fig. 5. Growth inhibitory properties of recombinant human clusterin (Clu) produced in 293 cells. A, Coomassie Blue staining (left lane) and Western blotting with an anti-Clu
antibody (right lane) of the Clu preparation. Both monomeric (⬃40 kDa) and heterodimeric (⬃80 kDa) forms are present under reducing conditions. In the left lane, copurifying BSA
is also detectable. B, Western blotting performed on 0.21 ␮g of the Clu preparation (r-hClu) electrophoresed under reducing conditions alongside a 0.2 ␮l-aliquot of normal human
serum (hSer). C, dose-dependent inhibition by Clu of the growth of human epithelial keratinocyte (HEK). [3H]Thymidine incorporation (left panel) and numbers of viable cells (middle
panel) were plotted against concentrations of Clu in growth medium. The right panel depicts the outgrowth of single cell clones of sparsely seeded HEK after 5 days either in the absence
(two duplicate plates in top row) or in the presence (two duplicate plates in bottom row) of r-hClu (50 ␮g/ml). D, the effect of Clu on proliferation of outer root sheath keratinocytes
(ORS) and renal proximal tubule epithelial cells (RPTECs). The experimental setup was as in C, left panel. E, proliferation of cells in Clu-containing media (50 ␮g/ml) before and
after depletion with an anti-FLAG antibody. The efficacy of depletion was assessed using Western blotting (top three panels; “⫹” and “⫺” refer to undepleted and depleted media,
respectively. [ 3]Thymidine incorporation was assessed in HEK, RPTEC, and primary human dermal fibroblasts (FBs). All experiments were performed in triplicates. Error bars refer
to SE’s of two to five independent experiments. F, accumulation of HEK in control medium (“Cont”) or media supplemented with BSA (50 ␮g/ml) or Clu (50 ␮g/ml).
differentiation (79). The interplay between Myc and TGF-␤ is now
recognized as an important regulator of cell proliferation (80). TGF-␤
is also regulated at the posttranslational level (81), and one of its key
activators is none other than thrombospondin-1, which releases
TGF-␤ from a latent complex (82, 83). The binding to TGF-␤ is
mediated by a distinct amino acid sequence flanked by two type 1
repeats (TSR) within thrombospondin-1 (reviewed in Ref. 84). Interestingly, TSR-homologous sequences are present in dozens of other-
3133
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2004 American Association for Cancer
Research.
Myc-TRANSFORMED CELLS DOWN-REGULATE CLUSTERIN
Fig. 6. Chemical carcinogenesis in clusterin-null versus wild-type (WT) mice. A, gross appearance of papilloma developing in clusterin-null knockout (KO) versus WT FVB/N mice
after exposure to 7,12-dimethylbenz(a)anthracene/12-O-tetradecanoylphorbol-13-acetate (see “Materials and Methods”). B, quantitative analysis of papilloma development in 42 WT
(E) and 45 KO (f) mice. For each strain, mean number of papillomas per animal was plotted against time. An apparent dip in the KO plot line is because multiple mice developed
carcinomas at weeks 23–25 and were therefore excluded from papilloma count. C, development of carcinomas in KO and WT mice. Poorly and well-differentiated carcinomas are
represented by f and 䡺, respectively. Total numbers of carcinomas (100%) were similar in both strains: 61 in WT and 60 in KO mice. D, representative carcinomas developing in
KO and WT mice (left and right panels, respectively; original magnification, ⫻20). A well-differentiated tumor in the left panel contains zones of keratinization and squamous cells
with moderately atypical nuclei. A poorly differentiated tumor in the right panel contains rectangular or spindle-shaped cells with significantly atypical nuclei and numerous mitoses.
wise unrelated proteins which comprise the TSR superfamily (74). On
the basis of the homology with thrombospondin-1, we suggested that
clusterin might belong to the same superfamily and share some of the
functions attributed to its members, for instance, inhibition of cell
proliferation. Furthermore, we have previously demonstrated that
clusterin mRNA expression is restricted to differentiating rather than
proliferating cells in several differentiated epithelia. On the basis of
these facts, we asked whether clusterin is a negative regulator of cell
proliferation in vitro and in vivo.
In this study, we present evidence that clusterin is down-regulated
in cultured epithelial cells that accelerate their growth rate in response
to c-Myc activation. Moreover, clusterin was found to directly inhibit
growth and accumulation of murine colonocytes, human keratinocytes, and other epithelial cells in vitro. Inhibition of cell proliferation
was somewhat cell type specific because purified recombinant clusterin has no effect on fibroblasts. Our results are in accordance with
published data that proliferation of human fibroblasts genetically
modified to overexpress clusterin is not inhibited (85), but exposure to
clusterin of human prostate cancer cell line LNCaP (86) as well as
SV40-immortalized prostate epithelial cells (87) resulted in slower
growth rates.
Given the negative role that clusterin plays in epithelial cell proliferation, it seemed likely that it attenuates neoplastic growth in vivo.
To address this possibility, we performed chemical skin carcinogenesis in wt and clusterin-null mice. In this system, topical application
of DMBA/TPA leads to the formation of benign papillomas. These
small neoplasms arise almost exclusively due to enhanced cell proliferation because invasive growth, angiogenesis, and metastasis are
not required for their development (88). We demonstrated here for the
first time that the lack of clusterin increases the susceptibility to
tumorigenesis after carcinogenic challenge. Indeed, the mean number
of benign papillomas/mouse is significantly increased in the absence
of clusterin. Interestingly, clusterin-null mice have not been noted to
develop any spontaneous tumors. Therefore, its absence is not sufficient to induce cell proliferation, but once a proliferative signal (e.g.,
DMBA/TPA) is provided, neoplastic growth is less constrained. Thus,
we consider clusterin to be not a tumor suppressor but a tumor
attenuator acting predominantly at early stages of neoplastic growth.
This idea could explain why clusterin expression has been reported
in a variety of neoplasms. Existing data indicate that clusterin is
abundantly produced in several types of human cancers such as breast
(89), renal clear cell (90), and prostate (91) carcinomas. However, it
has not been demonstrated that clusterin is produced in the same cells
that undergo proliferation. It is thus possible that clusterin is activated
to counteract oncogenic stimuli in non- or slowly proliferating tumor
compartments. Activation of growth inhibitors in tumor tissues has
been reported, p16 cyclin-dependent kinase-inhibitor being a prime
example (92). It would be interesting to determine, using laser microdissection, whether or not expression of clusterin correlates with
lower bromodeoxyuridine incorporation and lower mitotic indices.
When such a detailed analysis was performed followed by serial
analysis of gene expression, strong down-regulation of clusterin was
immediately apparent in highly malignant MD PR317 prostate adenocarcinoma cells (Tag Odds Normal:Cancer ⫽ 5.85, The Cancer
Genome Anatomy Project).7
Interestingly, during late stages of skin carcinogenesis, clusterin
expression seems to favor tumor progression because in clusterin-null
mice papillomas progress into more differentiated squamous cell
carcinomas than in wt mice. In addition, some previous studies have
shown that clusterin could favor the metastatic process (93). Thus,
clusterin might act in a biphasic fashion during skin carcinogenesis as
7
Internet address: http://cgap.nci.nih.gov.
3134
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2004 American Association for Cancer
Research.
Myc-TRANSFORMED CELLS DOWN-REGULATE CLUSTERIN
a tumor attenuator early on and as an enhancer of the malignant
phenotype in full-fledged tumors. Similar effects have already been
attributed to TGF-␤ during skin carcinogenesis (94) and thrombospondin-1 in breast and other carcinomas (95). This raises the
question whether inactivation of clusterin should be attempted or
avoided in cancer patients. Although the former approach is currently
being tested (96, 97), our data indicate that high levels of clusterin
might be protective against early stages of neoplastic growth. This
discrepancy will have to be resolved before additional clinical interventions are attempted.
ACKNOWLEDGMENTS
We thank Gertraud Radlgruber and Bernadette Mermillod (University of
Geneva) for technical assistance and for assistance with statistical analyses,
respectively. We thank Dr. Jeffrey Ilardi, Gautam Rajpal, and Monica Lee
(University of Pennsylvania) for their help with generation of murine clusterinexpressing retroviruses. We also thank Isaiah Fidler (M. D. Anderson Cancer
Center) for his help with learning the technique of orthotopic transplantation.
REFERENCES
1. Grandori C, Cowley SM, James LP, Eisenman RN. The Myc/Max/Mad network and
the transcriptional control of cell behavior. Ann Rev Cell Dev Biol 2000;16:653–99.
2. Blackwell TK, Kretzner L, Blackwood EM, Eisenman RN, Weintraub H. Sequencespecific DNA binding by the c-myc protein. Science (Wash. DC) 1990;250:1149 –51.
3. Kretzner L, Blackwood EM, Eisenman RN. Myc and Max proteins possess distinct
transcriptional activities. Nature (Lond.) 1992;359:426 –9.
4. Amati B, Dalton S, Brooks MW, Littlewood TD, Evan GI, Land H. Transcriptional
activation by the human c-Myc oncoprotein in yeast requires interaction with Max.
Nature (Lond.) 1992;359:423– 6.
5. McMahon SB, Van BA, Dugan KA, Copeland TD, Cole MD. The novel ATM-related
protein TRRAP is an essential cofactor for the c-Myc and E2F oncoproteins. Cell
1998;94:363–74.
6. McMahon SB, Wood MA, Cole MD. The essential cofactor TRRAP recruits the
histone acetyltransferase hGCN5 to c-Myc. Mol Cell Biol 2000;20:556 – 62.
7. Amati B, Frank SR, Donjerkovic D, Taubert S. Function of the c-Myc oncoprotein in
chromatin remodeling and transcription. Biochim Biophys Acta 2001;1471:
M135– 45.
8. Li L, Nerlov C, Prendergast GC, Ziff EB. c-Myc represses transcription in vivo by a
novel mechanism dependent on the initiator element and Myc box II. EMBO J
1994;13:4070 –9.
9. Staller P, Peukert K, Kiermaier A, et al. Repression of p15INK4b expression by Myc
through association with Miz-1. Nat Cell Biol 2001;3:392–9.
10. Oster SK, Ho CS, Soucie EL, Penn LZ. The myc oncogene: marvelously complex.
Adv Cancer Res 2002;84:81–154.
11. O’Connell BC, Cheung AF, Simkevich CP, et al. A large scale genetic analysis of
c-Myc-regulated gene expression patterns. J Biol Chem 2003;278:12563–73.
12. Bello-Fernandez C, Packham G, Cleveland JL. The ornithine decarboxylase gene is
a transcriptional target of c-Myc. Proc Natl Acad Sci USA 1993;90:7804 – 8.
13. Jansen-Durr P, Meichle A, Steiner P, et al. Differential modulation of cyclin gene
expression by MYC. Proc Natl Acad Sci USA 1993;90:3685–9.
14. Galaktionov K, Chen X, Beach D. cdc25 cell cycle phosphatase as a target of c-myc.
Nature (Lond.) 1996;382:511–7.
15. Hermeking H, Rago C, Schuhmacher M, et al. Identification of CDK4 as a target of
c-MYC. Proc Natl Acad Sci USA 2000;97:2229 –34.
16. Lasorella A, Noseda M, Beyna M, Iavarone A. Id2 is a retinoblastoma protein target
and mediates signalling by Myc oncoproteins. Nature (Lond.) 2000;407:592– 8.
17. Wang J, Xie LY, Allan S, Beach D, Hannon GJ. Myc activates telomerase. Genes Dev
1998;12:1769 –74.
18. Philipp A, Schneider A, Vasrik I, et al. Repression of cyclin D1: a novel function of
MYC. Mol Cell Biol 1994;14:4032– 43.
19. Mitchell KO, El-Deiry WS. Overexpression of c-Myc inhibits p21WAF1/CIP1 expression and induces S-phase entry in 12-O-tetradecanoylphorbol-13-acetate (TPA)sensitive human cancer cells. Cell Growth Differ 1999;10:223–30.
20. Claassen GF, Hann SR. A role for transcriptional repression of p21CIP1 by c-Myc in
overcoming transforming growth factor ␤-induced cell cycle arrest. Proc Natl Acad
Sci USA 2000;97:9498 –503.
21. Gartel AL, Ye X, Goufman E, et al. Myc represses the p21(WAF1/CIP1) promoter
and interacts with Sp1/Sp3. Proc Natl Acad Sci USA 2001;98:4510 –5.
22. Seoane J, Pouponnot C, Staller P, Schader M, Eilers M, Massague J. TGF-␤
influences Myc, Miz-1 and Smad to control the CDK inhibitor p15INK4b. Nat Cell
Biol 2001;3:400 – 8.
23. Marhin WW, Chen S, Facchini LM, Fornace AJ, Penn LZ. Myc represses the growth
arrest gene gadd45. Oncogene 1997;14:2825–34.
24. Lee TC, Li L, Philipson L, Ziff EB. Myc represses transcription of the growth arrest
gene gas1. Proc Natl Acad Sci USA 1997;94:12886 –91.
25. Eilers M, Picard D, Yamamoto KR, Bishop JM. Chimaeras of Myc oncoprotein and
steroid receptors cause hormone-dependent transformation of cells. Nature (Lond.)
1989;340:66 – 8.
26. Mateyak MK, Obaya AJ, Adachi S, Sedivy JM. Phenotypes of c-Myc-deficient rat
fibroblasts isolated by targeted homologous recombination. Cell Growth Differ 1997;
8:1039 – 48.
27. Johnston LA, Prober DA, Edgar BA, Eisenman RN, Gallant P. Drosophila myc
regulates cellular growth during development. Cell 1999;98:779 –90.
28. Trumpp A, Refaeli Y, Oskarsson T, et al. c-Myc regulates mammalian body size by
controlling cell number but not cell size. Nature (Lond.) 2001;414:768 –73.
29. Tikhonenko AT, Black DJ, Linial ML. Viral Myc oncoproteins in infected fibroblasts
down-modulate thrombospondin-1, a possible tumor suppressor gene. J Biol Chem
1996;271:30741–7.
30. Janz A, Sevignani C, Kenyon K, Ngo C, Thomas-Tikhonenko A. Activation of the
Myc oncoprotein leads to increased turnover of thrombospondin-1 mRNA. Nucleic
Acids Res 2000;28:2268 –75.
31. Guo N, Templeton NS, Al-Barazi H, et al. Thrombospondin-1 promotes alpha3beta1
integrin-mediated adhesion and neurite-like outgrowth and inhibits proliferation of
small cell lung carcinoma cells. Cancer Res 2000;60:457– 66.
32. Armstrong LC, Bjorkblom B, Hankenson KD, Siadak AW, Stiles CE, Bornstein P.
Thrombospondin 2 inhibits microvascular endothelial cell proliferation by a caspaseindependent mechanism. Mol Biol Cell 2002;13:1893–905.
33. Tomii Y, Kamochi J, Yamazaki H, et al. Human thrombospondin 2 inhibits proliferation of microvascular endothelial cells. Int J Oncol 2002;20:339 – 42.
34. Lawler J. Thrombospondin-1 as an endogenous inhibitor of angiogenesis and tumor
growth. J Cell Mol Med 2002;6:1–12.
35. Ngo C, Gee MS, Akhtar N, et al. An in vivo function for the transforming myc
protein: elicitation of the angiogenic phenotype. Cell Growth Differ 2000;11:201–10.
36. Watnick RS, Cheng YN, Rangarajan A, Ince TA, Weinberg RA. Ras modulates Myc
activity to repress thrombospondin-1 expression and increase tumor angiogenesis.
Cancer Cell 2003;3:219 –31.
37. Brandvold KA, Neiman P, Ruddell A. Angiogenesis is an early event in the generation of myc-induced lymphomas. Oncogene 2000;19:2780 –5.
38. Pelengaris S, Littlewood T, Khan M, Elia G, Evan GI. Reversible activation of c-Myc
in skin: induction of a complex neoplastic phenotype by a single oncogenic lesion.
Mol Cell 1999;3:565–77.
39. Zeller KI, Jegga AG, Aronow B, O’Donnell KA, Dang CV. An integrated database
of genes responsive to the Myc oncogenic transcription factor: identification of direct
genomic targets. Genome Biol 2003;4:R69.1–10.
40. Louro ID, Bailey EC, Li X, et al. Comparative gene expression profile analysis of GLI
and c-MYC in an epithelial model of malignant transformation. Cancer Res 2002;
62:5867–73.
41. Jenne DE, Tschopp J. Clusterin: the intriguing guises of a widely expressed glycoprotein. Trends Biochem Sci 1992;17:154 –9.
42. Rosenberg M, Silkensen J. Clusterin: physiologic and pathophysiologic considerations. Int J Biochem Cell Biol 1995;27:633– 45.
43. Blaschuk O, Burdzy K, Fritz IB. Purification and characterization of a cell-aggregating factor (clusterin), the major glycoprotein in ram rete testis fluid. J Biol Chem
1983;258:7714 –20.
44. Fritz IB, Burdzy K, Setchell B, Blaschuk O. Ram rete testis fluid contains a protein
(clusterin) which influences cell-cell interactions in vitro. Biol Reprod 1983;28:
1173– 88.
45. Tung PS, Burdzy K, Wong K, Fritz IB. Competition between cell-substratum interactions and cell-cell interactions. J Cell Physiol 1992;152:410 –21.
46. Choi NH, Mazda T, Tomita M. A serum protein SP40,40 modulates the formation of
membrane attack complex of complement on erythrocytes. Mol Immunol 1989;26:
835– 40.
47. Jenne DE, Tschopp J. Molecular structure and functional characterization of a novel
human cytolysis inhibitor (CLI) found in blood and seminal plasma. Identity to
sulfated glycoprotein 2 (SGP-2), a constituent of rat testis fluid. Proc Natl Acad Sci
USA 1989;86:7123–7.
48. Kirszbaum L, Sharpe JA, Murphy B, et al. Molecular cloning and characterization of
the novel, human complement-associated protein, SP-40,40: a link between the
complement and reproductive systems. EMBO J 1989;8:711– 8.
49. de Silva HV, Stuart WD, Duvic CR, et al. A 70-kDa apolipoprotein designated ApoJ
is a marker for subclasses of human plasma high density lipoproteins. J Biol Chem
1990;265:13240 –7.
50. James RW, Hochstrasser AC, Borghini I, Martin B, Pometta D, Hochstrasser D.
Characterization of a human high density lipoprotein-associated protein, NA1/NA2.
Identity with SP-40,40, an inhibitor of complement-mediated cytolysis. Arterioscler
Thromb 1991;11:645–52.
51. Jenne DE, Lowin B, Peitsch MC, Böttcher A, Schmitz G, Tschopp J. Clusterin
(complement lysis inhibitor) forms a high density lipoprotein complex with apolipoprotein A-I in human plasma. J Biol Chem 1991;266:11030 – 6.
52. French LE, Wohlwend A, Sappino AP, Tschopp J, Schifferli JA. Human clusterin
gene expression is confined to surviving cells during in vitro programmed cell death.
J Clin Investig 1994;93:877– 84.
53. Schwochau GB, Nath KA, Rosenberg ME. Clusterin protects against oxidative stress
in vitro through aggregative and nonaggregative properties. Kidney Int 1998;53:
1647–53.
54. Viard I, Wehrli P, Jornot L, et al. Clusterin gene expression mediates resistance to
apoptotic cell death induced by heat shock and oxidative stress. J Investig Dermatol
1999;112:290 – 6.
55. Wilson MR, Easterbrook-Smith SB. Clusterin is a secreted mammalian chaperone.
Trends Biochem Sci 2000;25:95– 8.
56. Yang CR, Leskov K, Hosley-Eberlein K, et al. Nuclear clusterin/XIP8, an X-rayinduced Ku70-binding protein that signals cell death. Proc Natl Acad Sci USA
2000;97:5907–12.
3135
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2004 American Association for Cancer
Research.
Myc-TRANSFORMED CELLS DOWN-REGULATE CLUSTERIN
57. Criswell T, Klokov D, Beman M, Lavik JP, Boothman DA. Repression of IRinducible clusterin expression by the p53 tumor suppressor protein. Cancer Biol Ther
2003;2:372– 80.
58. Leskov KS, Klokov DY, Li J, Kinsella TJ, Boothman DA. Synthesis and functional
analyses of nuclear clusterin, a cell death protein. J Biol Chem 2003;278:11590 – 600.
59. Diemer V, Hoyle M, Baglioni C, Millis A. Expression of porcine complement
inhibitor mRNA in cultured aortic smooth muscle cells: changes during differentiation in vitro. J Biol Chem 1992;267:5257– 64.
60. French LE, Chonn A, Ducrest D, et al. Murine clusterin: molecular cloning and
mRNA localization of a gene associated with epithelial differentiation processes
during embryogenesis. J Cell Biol 1993;122:1119 –30.
61. Seiberg M, Marthinuss J. Clusterin expression within skin correlates with hair growth.
Dev Dyn 1995;202:294 –301.
62. Sevignani C, Wlodarski P, Kirillova J, et al. Tumorigenic conversion of p53-deficient
colon epithelial cells by an activated Ki-ras gene. J Clin Investig 1998;101:1572– 80.
63. Fidler IJ. Orthotopic implantation of human colon carcinomas into nude mice provides a valuable model for the biology and therapy of metastasis. Cancer Metastasis
Rev 1991;10:229 – 43.
64. McLaughlin L, Mistry M, Zhu G, et al. Apolipoprotein J/Clusterin limits the severity
of murine autoimmune myocarditis. J Clin Investig 2000;106:1105–13.
65. Pear WS, Miller JP, Xu L, et al. Efficient and rapid induction of a chronic myelogenous leukemia-like myeloproliferative disease in mice receiving P210 bcr/abltransduced bone marrow. Blood 1998;92:3780 –92.
66. Limat A, Hunziker T, Boillat C, Bayreuther K, Noser F. Post-mitotic human dermal
fibroblasts efficiently support the growth of human follicular keratinocytes. J Investig
Dermatol 1989;92:758 – 62.
67. Limat A, Noser F. Serial cultivation of single keratinocytes from the outer root sheath
of human scalp hair follicles. J Investig Dermatol 1986;87:485– 8.
68. Giard DJ, Aaronson S, Todaro GJ, et al. In vitro cultivation of human tumors:
establishment of cell lines derived from a series of solid tumors. J Natl Cancer Inst
(Bethesda) 2003;51:1417–23.
69. Graham FL, Smiley J, Russell WC, Nairn R. Characteristics of a human cell line
transformed by DNA from human adenovirus type 5. J Gen Virol 1977;36:59 –74.
70. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, Vogelstein B. A simplified system
for generating recombinant adenoviruses. Proc Natl Acad Sci USA 1998;95:2509 –14.
71. Hennings H, Glick AB, Lowry DT, et al. FVB/N mice: an inbred strain sensitive to
the chemical induction of squamous cell carcinomas in the skin. Carcinogenesis
1993;14:2353– 8.
72. Littlewood TD, Hancock DC, Danielian PS, Parker MG, Evan GI. A modified
oestrogen receptor ligand-binding domain as an improved switch for the regulation of
heterologous proteins. Nucleic Acids Res 1995;23:1686 –90.
73. Blackwood EM, Lugo TG, Kretzner L, et al. Functional analysis of the AUG- and
CUG-initiated forms of the c-Myc protein. Mol Biol Cell 1994;5:597– 609.
74. Adams JC, Tucker RP. The thrombospondin type 1 repeat (TSR) superfamily: diverse
proteins with related roles in neuronal development. Dev Dyn 2000;218:280 –99.
75. Guo N, Krutzsch HC, Inman JK, Roberts DD. Thrombospondin 1 and type I repeat
peptides of thrombospondin 1 specifically induce apoptosis of endothelial cells.
Cancer Res 1997;57:1735– 42.
76. Iruela-Arispe ML, Lombardo M, Krutzsch HC, Lawler J, Roberts DD. Inhibition of
angiogenesis by thrombospondin-1 is mediated by 2 independent regions within the
type 1 repeats. Circulation 1999;100:1423–31.
77. Claassen GF, Hann SR. Myc-mediated transformation: the repression connection.
Oncogene 1999;18:2925–33.
78. Cerezo A, Stark HJ, Moshir S, Boukamp P. Constitutive overexpression of human
telomerase reverse transcriptase but not c-myc blocks terminal differentiation in
human HaCaT skin keratinocytes. J Investig Dermatol 2003;121:110 –9.
79. Derynck R, Akhurst RJ, Balmain A. TGF-␤ signaling in tumor suppression and
cancer progression. Nat Genet 2001;29:117–29.
80. Amati B. Integrating Myc and TGF-␤ signalling in cell-cycle control. Nat Cell Biol
2001;3:E112–3.
81. Gumienny TL, Padgett RW. The other side of TGF-␤ superfamily signal regulation:
thinking outside the cell. Trends Endocrinol Metabol 2002;13:295–9.
82. Crawford SE, Stellmach V, Murphy-Ullrich JE, et al. Thrombospondin-1 is a major
activator of TGF-␤1 in vivo. Cell 1998;93:1159 –70.
83. Ribeiro SM, Poczatek M, Schultz-Cherry S, Villain M, Murphy-Ullrich JE. The
activation sequence of thrombospondin-1 interacts with the latency-associated peptide
to regulate activation of latent transforming growth factor ␤. J Biol Chem 1999;274:
13586 –93.
84. Chen H, Herndon ME, Lawler J. The cell biology of thrombospondin-1. Matrix Biol
2000;19:597– 614.
85. Petropoulo C, Trougakos I, Kolettas E, Toussaint O, Gonos E. Clusterin/apolipoprotein J is a novel biomarker of cellular senescence that does not affect the proliferative
capacity of human diploid fibroblasts. FEBS Lett 2001;509:287–97.
86. Zhou W, Janulis L, Park II, Lee C. A novel anti-proliferative property of clusterin in
prostate cancer cells. Life Sci 2002;72:11–21.
87. Bettuzzi S, Scorcioni F, Astancolle S, Davalli P, Scaltriti M, Corti A. Clusterin
(SGP-2) transient overexpression decreases proliferation rate of SV40-immortalized
human prostate epithelial cells by slowing down cell cycle progression. Oncogene
2002;21:4328 –34.
88. DiGiovanni J. Multistage carcinogenesis in mouse skin. Pharmacol Ther 1992;54:
63–128.
89. Redondo M, Villar E, Torres-Munoz J, Tellez T, Morell M, Petito CK. Overexpression of clusterin in human breast carcinoma. Am J Pathol. 2000;157:393–9.
90. Parczyk K, Pilarsky C, Rachel U, Koch BC. Gp80 (clusterin; TRPM-2) mRNA level
is enhanced in human renal clear cell carcinomas. J Cancer Res Clin Oncol 1994;
120:186 – 8.
91. Steinberg J, Oyasu R, Lang S, et al. Intracellular levels of SGP-2 (Clusterin) correlate
with tumor grade in prostate cancer. Clin Cancer Res 1997;3:1707–11.
92. Dai CY, Furth EE, Mick R, et al. p16(INK4a) expression begins early in human colon
neoplasia and correlates inversely with markers of cell proliferation. Gastroenterology
2000;119:929 – 42.
93. Miyake H, Gleave M, Arakawa S, Kamidono S, Hara I. Introducing the clusterin gene
into human renal cell carcinoma cells enhances their metastatic potential. J Urol
2002;167:2203– 8.
94. Cui W, Fowlis DJ, Bryson S, et al. TGF-␤1 inhibits the formation of benign skin
tumors, but enhances progression to invasive spindle carcinomas in transgenic mice.
Cell 1996;86:531– 42.
95. Qian X, Tuszynski GP. Expression of thrombospondin-1 in cancer: a role in tumor
progression. Proc Soc Exp Biol Med 1996;212:199 –207.
96. Miyake H, Hara I, Kamidono S, Gleave ME. Synergistic chemosensitization and
inhibition of tumor growth and metastasis by the antisense oligodeoxynucleotide
targeting clusterin gene in a human bladder cancer model. Clin Cancer Res 2001;7:
4245–52.
97. Gleave ME, Miyake H, Zellweger T, et al. Use of antisense oligonucleotides targeting
the antiapoptotic gene, clusterin/testosterone-repressed prostate message 2, to enhance androgen sensitivity and chemosensitivity in prostate cancer. Urology 2001;
58:39 – 49.
3136
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2004 American Association for Cancer
Research.
Myc-Transformed Epithelial Cells Down-Regulate Clusterin,
Which Inhibits Their Growth in Vitro and Carcinogenesis in
Vivo
Andrei Thomas-Tikhonenko, Isabelle Viard-Leveugle, Michael Dews, et al.
Cancer Res 2004;64:3126-3136.
Updated version
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/64/9/3126
This article cites 96 articles, 39 of which you can access for free at:
http://cancerres.aacrjournals.org/content/64/9/3126.full.html#ref-list-1
This article has been cited by 10 HighWire-hosted articles. Access the articles at:
/content/64/9/3126.full.html#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 2004 American Association for Cancer
Research.