Download Full-Text PDF

Minerals 2014, 4, 170-190; doi:10.3390/min4010170
OPEN ACCESS
minerals
ISSN 2075-163X
www.mdpi.com/journal/minerals
Article
Acidic Microenvironments in Waste Rock Characterized by
Neutral Drainage: Bacteria–Mineral Interactions at
Sulfide Surfaces
John W. Dockrey 1,†, Matthew B. J. Lindsay 2, K. Ulrich Mayer 1,*, Roger D. Beckie 1,
Kelsey L. I. Norlund 3,‡, Lesley A. Warren 3 and Gordon Southam 4
1
2
3
4
Department of Earth, Ocean and Atmospheric Sciences, The University of British Columbia,
2207 Main Mall, Vancouver, BC V6T 1Z4, Canada; E-Mail: [email protected]
Department of Geological Sciences, University of Saskatchewan, Saskatoon, SK S7N 5E2, Canada;
E-Mail: [email protected]
School of Geography and Earth Sciences, McMaster University, Hamilton, ON L8S 4L8, Canada;
E-Mail: [email protected]
School of Earth Sciences, The University of Queensland, St. Lucia, QLD 4072, Australia;
E-Mail: [email protected]
†
Present Address: Lorax Environmental Services Ltd., Vancouver, BC V6J 3H9, Canada;
E-Mail: [email protected]
‡
Present Address: Rescan Environmental Services Ltd., Vancouver, BC V6E 2J3, Canada;
E-Mail: [email protected]
* Author to whom correspondence should be addressed; E-Mail: [email protected];
Tel.: +1-604-822-1539; Fax: +1-604-822-6088.
Received: 13 January 2014; in revised form: 4 March 2014 / Accepted: 17 March 2014 /
Published: 21 March 2014
Abstract: Microbial populations and microbe-mineral interactions were examined in waste
rock characterized by neutral rock drainage (NRD). Samples of three primary sulfide-bearing
waste rock types (i.e., marble-hornfels, intrusive, exoskarn) were collected from field-scale
experiments at the Antamina Cu–Zn–Mo mine, Peru. Microbial communities within all
samples were dominated by neutrophilic thiosulfate oxidizing bacteria. However, acidophilic
iron and sulfur oxidizers were present within intrusive waste rock characterized by bulk
circumneutral pH drainage. The extensive development of microbially colonized porous
Fe(III) (oxy)hydroxide and Fe(III) (oxy)hydroxysulfate precipitates was observed at
Minerals 2014, 4
171
sulfide-mineral surfaces during examination by field emission-scanning electron
microscopy-energy dispersive X-ray spectroscopy (FE-SEM-EDS). Linear combination
fitting of bulk extended X-ray absorption fine structure (EXAFS) spectra for these
precipitates indicated they were composed of schwertmannite [Fe8O8(OH)6–4.5(SO4)1–1.75],
lepidocrocite [γ-FeO(OH)] and K-jarosite [KFe3(OH)6(SO4)2]. The presence of
schwertmannite and K-jarosite is indicative of the development of localized acidic
microenvironments at sulfide-mineral surfaces. Extensive bacterial colonization of this
porous layer and pitting of underlying sulfide-mineral surfaces suggests that acidic
microenvironments can play an important role in sulfide-mineral oxidation under bulk
circumneutral pH conditions. These findings have important implications for water quality
management in NRD settings.
Keywords: mine tailings; neutral rock drainage; biooxidation; Fe- and S-oxidizing bacteria;
synchrotron; EXAFS
1. Introduction
The extraction and processing of ore deposits generate immense quantities of mine wastes. Waste
rock and mill tailings generated at mines exploiting sulfide ore deposits, which are a primary source of
base and precious metals, pose a substantial risk to water quality. Mine wastes commonly are deposited
under atmospheric conditions where sulfide minerals, for example pyrite [FeS2] or pyrrhotite [Fe1–xS],
become thermodynamically unstable [1]. Oxidative dissolution of these and other sulfide minerals
generates acidity, and releases sulfate, iron and associated metals to pore waters. The quality of
drainage emanating from sulfide-bearing mine wastes is dependent on many factors, including
mineralogical and geochemical properties, hydrogeologic conditions, and the activity of lithoautotrophic
microorganisms [2]. Despite ongoing sulfide-mineral oxidation, neutral rock drainage (NRD)
conditions may persist in mine wastes containing an abundance of carbonate minerals [3]. Principal
threats to water quality under circumneutral pH conditions are weakly-hydrolyzing metals, including
Zn, Ni, Cu(I) and Fe(II), and oxyanion-forming metals, including Mo, As, Se and Cr [4,5]. Exhaustion
of the intrinsic acid-neutralization capacity of waste rock or mill tailings may facilitate generation of
acidic rock drainage (ARD) and large increases in dissolved concentrations of Zn, Ni, Cu, Fe and other
metals [6,7].
Mechanisms of sulfide-mineral oxidation in ARD settings are well established. Under acidic
pH conditions, chemical oxidation by Fe(III) is the predominant oxidation mechanism and
microbially-catalyzed Fe(II) oxidation largely controls overall reaction rates [8–10]. The importance of
this oxidation mechanism could be expected to diminish at circumneutral pH due to limitations on
Fe(III) solubility. Nevertheless, acidophilic iron oxidizing bacteria (e.g., Acidithiobacillus ferrooxidans)
and acidophilic sulfur oxidizing bacteria (e.g., Acidithiobacillus thiooxidans) have been cultured from
NRD settings, where a pH limitation on growth would be anticipated [5,11–13]. Although acidophiles
may be active within NRD systems, associated microbial communities are commonly dominated by
neutrophilic sulfur oxidizing bacteria (i.e., Thiobacillus spp.) [5,12,13]. These bacteria mediate the
Minerals 2014, 4
172
oxidation of intermediate sulfur compounds, including thiosulfate (S2O32−), trithionate (S3O62−) and
tetrathionate (S4O62−), which form as a result of sulfide-mineral oxidation by Fe(III) at circumneutral
pH [14–16]. At acidic pH, elemental sulfur (S80), pentathionate (S5O62−) and sulfate (SO42−) are important
products of Fe(III) oxidation of sulfide minerals [16]. In these environments, sulfur oxidizing bacteria
are thought to enhance oxidation rates by limiting the accumulation of reaction products or inhibiting
the formation of secondary sulfur-bearing precipitates at sulfide-mineral surfaces [17].
The degree to which acidophilic iron oxidizers catalyze sulfide-mineral oxidation under bulk
circumneutral pH conditions remains poorly constrained. The importance of Fe(III) oxidation of
sulfides within NRD settings is dependent on the solubility of Fe(III) and activity of acidophilic iron
oxidizing bacteria at the sulfide-mineral surface. Southam and Beveridge [11] proposed that
acidophilic iron oxidizers overcome pH limiting growth conditions by forming acidic microenvironments
at sulfide-mineral surfaces. This hypothesis was subsequently confirmed through detailed microscopy
studies, which revealed close association of A. ferrooxidans to sulfide-mineral surfaces and the
corresponding occurrence of Fe(III) (oxy)hydroxide and Fe(III) (oxy)hydroxysulfate minerals [18,19].
These secondary Fe(III) phases generally are thought to enhance the Fe(III) solubility within close
proximity of the mineral surface, and limit diffusive transport of sulfide-oxidation products to bulk
solution [18]. Extracellular polymeric substances (EPS) deposited by acidophilic bacteria also may
contribute to enhanced dissolution rates by complexing Fe(III) compounds, thereby making them
available for sulfide-mineral oxidation [20]. Ongoing development of acidic microenvironments due to
bacterial growth, EPS deposition and mineral precipitation at the sulfide-mineral surface may have
important implications for sulfide-mineral oxidation within NRD settings. Understanding mechanisms
of sulfide mineral-oxidation and metal transport in NRD settings, and anticipating temporal or spatial
transitions between NRD and ARD conditions, is central to the development and implementation of
effective strategies for water quality management at mining operations.
The objective of this study was to examine the role of acidophilic bacteria within waste rock
characterized by bulk circumneutral pH conditions. Additionally, this study aimed to assess
mechanisms by which acidophiles colonize sulfide-mineral surfaces under these conditions. Samples
of sulfide-bearing waste rock were collected from field-scale experiments conducted at the Antamina
Cu–Zn–Mo mine, Peru. Culture-dependent and culture-independent techniques were used to examine
the distribution of neutrophilic and acidophilic bacteria. Fluorescence in situ hybridization (FISH) was
employed to probe the presence of Acidithiobacillus spp. within the samples. Secondary electron
scanning electron microscopy (SEM)-equipped with Energy Dispersive Spectroscopy (EDS), powder
X-ray diffraction (XRD) and X-ray absorption spectroscopy (XAS) were utilized to examine
microbial-mineral interactions at surfaces of sulfide minerals.
2. Experimental Section
2.1. Site Description
The Antamina Cu–Zn–Mo mine is located in the Peruvian Andes (9°32' S, 77°03' W), approximately
270 km northeast of Lima, at an elevation of 4300 m above sea level. Despite its high elevation, mean
annual temperatures ranged from 5.4 to 8.5 °C between 2001 and 2009, which is reflective of the
Minerals 2014, 4
173
tropical latitude of the mine. Approximately 80% of the average annual rainfall of ~1200 mm occurs
during the wet season, which typically lasts from November to April. The mine exploits a Cu–Zn skarn
deposit with ore-grade mineralization transported via quartz-monzonite porphyries intruding
Cretaceous limestone strata. For a detailed description of the lithologic, stratigraphic, and structural
setting of Antamina, see Love and Clark [21]. Pyrite and chalcopyrite [CuFeS2] are the dominant
sulfide minerals within the orebody, while molybdenite [MoS2], sphalerite [(Zn,Fe)S], pyrrhotite and
arsenopyrite [FeAsS] are less abundant. Waste rock from the open pit is stored in large, unsaturated
piles that extend vertically by >400 m. Acidity generated by sulfide-mineral oxidation is largely
neutralized by carbonate minerals, which are abundant within the waste rock. Bulk drainage from the
waste rock piles is generally characterized by circumneutral pH conditions and discharge
concentrations of Zn, As, Se and Mo are the water quality parameters of principal concern at the mine.
Three large-scale experimental waste rock piles were constructed for this project by the Antamina
mine for use between 2006 and 2009; approximately three years of weathering. A primary objective of
this experiment was to characterize drainage quality from waste rock composed of three primary
lithologic units associated with the ore body (Table 1). These experimental piles each were constructed
using 25–30 kt of waste rock, which was deposited by end-dumping from a 10 m high access ramp
onto a 36 m × 36 m basal lysimeter constructed of impermeable geotextile liner. Instrumentation to
facilitate monitoring of spatial and temporal variations in hydrology and geochemistry was installed
within each experimental waste rock pile. Additionally, a series of complementary field-scale
weathering (bioleaching) experiments was initiated to monitor geochemical evolution of drainage from
the individual rock types included in the experimental waste rock piles (Table 1). These field-cell
experiments were established as lysimeters containing 260–350 kg of waste rock overlying 15 cm of
silica sand within 208 L (i.e., 55 U.S. liquid gallons) high-density polyethylene drums. The tops of the
lysimeters were open to the atmosphere to facilitate infiltration, gas transport, and microbial
colonization via wind-blown particles.
Table 1. Summary of average drainage pH and calculated cumulative mass discharges for
July 2008–June 2009. Weathering duration indicates number of years since initiating the
experiment. Parameters with values < 0.1 mg∙kg−1 were not reported.
Cumulative mass discharge (mg∙kg−1)
Lithologic Unit
Experimental ID
Weathering Duration (year)
pHavg
Marble-hornfels
Pile 1
2.5
7.73
35
Intrusive
FC-1-3A
Pile 2
FC-2-2B
2.6
1.5
1.5
7.85
7.45
7.88
140
78
170
2.6
0.5
0.3
Exoskarn
FC-2-3A
Pile 3
FC-3-2A
1.4
1.5
1.4
6.18
7.46
7.32
310
100
590
17
1.5
15
SO42−
Zn
Mo
Cu
0.1
0.3
7.1
13
0.1
2.2. Sample Collection and Preservation
Samples of marble-hornfels (Pile 1, FC1-3A), intrusive (Pile 2, FC-2-2B, FC2-3A) and exoskarn
(Pile 3, FC-3-2A) waste rock types were collected in February 2009, at the height of the rainy season.
Minerals 2014, 4
174
These samples were selected because they represent the three primary waste rock lithologies at the
study site. For comparison, separate samples for each waste rock type were collected from the
experimental piles and from the field cells. Samples from the field cells were extracted from holes cut
immediately above the interface between the waste rock and underlying silica sand. For the
experimental piles, samples were collected from the base of 1 m deep test pits excavated at the top
central region of each pile. Bulk samples ranging in mass from 200 to 250 g were placed in 200 mL
polyethylene bottles (Nalgene, Rochester, NY, USA). Sub-samples of metal sulfides from these
sample bottles, selected for field emission-scanning electron microscopy (FE-SEM) imaging, were
rinsed three times with deionized water and field fixed with 1% (v/v) glutaraldehyde (Electron
Microscopy Sciences, Hatfield, PA, USA) in sterile 50 mL polypropylene conical centrifuge tubes
(Falcon; BD Biosciences, San Jose, CA, USA). All samples were shipped to the University of British
Columbia for analysis. Additional mineral grains, selected for FE-SEM imaging from the bulk
samples, were fixed with 1% (v/v) glutaraldehyde in the laboratory.
2.3. Mineralogical and Geochemical Analyses
Quantitative mineralogical analysis was performed by powder XRD and Rietveld refinement. A
mortar and pestle was used to crush 40 to 50 g sub-samples of material from each location to <1 mm,
and further grinding to <5 µm utilized a micronizing mill (McCrone Microscopes and Accessories,
Westmont, IL, USA). The powdered samples were then mounted as pressed pellets, and XRD patterns
were collected by step scanning from 3°–80°2θ using a CuKα X-ray source supplied by a Siemens
D5000 Bragg-Brentano diffractometer (Siemens AG, Munich, Germany). The scan data was refined
using the Rietveld analysis program Topas 3.0 (Coelho Software, Brisbane, Australia). Subsequent
examination using a Philips XL30 (FEI™, Hillsboro, OR, USA) scanning electron microscope (SEM)
equipped with a Bruker Quanta 200 (Milton, ON, Canada) energy-dispersion X-ray microanalysis
system (EDS) to assess the presence of geochemically important minerals (i.e., sulfides, carbonates
and phosphates) not detected by powder XRD. Fine-grained samples were mounted on aluminum stubs
using carbon tape, and sputter coated with carbon to ensure conductance. An accelerating potential of
15 kV was used for imaging and semi-quantitative chemical analyses.
The local atomic environment of Fe in secondary mineral phases was examined by synchrotron- based
X-ray absorption spectroscopy (XAS). Extended X-ray adsorption fine structure (EXAFS) spectra for
Fe were collected on beamline 11-2 at the Stanford Synchrotron Radiation Lightsource (Menlo Park,
CA, USA). A double crystal Si(220) monochromator was utilized for energy selection and scans were
conducted from +100 to +1000 eV relative to the Fe K-edge (E0 = 7111 eV). The data reduction
software SIXPACK/IFEFFIT was used to isolate backscattering contributions by subtracting a spline
function from the EXAFS data region [22]. The results were then converted from eV to k(Å−1) and
weighted by k3 and windowed from 3 to 14 Å−1. Least squares linear combination fitting (LCF) was
performed to assess the occurrence of Fe(III) (oxy)hydroxide and Fe(III) (oxy)hydroxysulfate phases.
Solid-phase concentrations of metals were determined by X-ray fluorescence (XRF) spectroscopy
(PW-2400; PANalytical B.V., Almelo The Netherlands), whereas sulfur and carbon contents were
quantified using combustion-infrared absorption (CNS-1000; LECO Corp., St. Joseph, MI, USA).
Sample fractions that passed through a 1.18 mm sieve were ground and pulverized using methods
Minerals 2014, 4
175
similar to those described for XRD analysis. This size fraction was selected for elemental analysis
because silt-sized and clay-sized particles generally comprise the majority of reactive surface area
within mine waste deposits [23]. Fusion pellets for major oxide analyses were prepared using
Li-tetraborate/Li-metaborate, whereas trace element concentrations were determined for samples
prepared as pressed powder pellets.
2.4. Microbial Enumerations
Due to the coarse texture and variability in grain-size distribution among samples, microbial
characterization focused on the fine-grained (i.e., sub-millimeter) fraction separated from the samples
by a DI water wash. This wash was performed by adding 40 mL of sterile DI water to the 200 mL
sample bottles containing 200–250 g of waste rock. The bottles were sealed, shaken vigorously by
hand, 30 times through the arc of 50 cm and the suspended sediment was decanted into sterile 50 mL
Falcon tubes. Isolated particles were suspended in solution by manual shaking and then vortex mixing
for 30 s prior to analysis. Dry weights of solids in this suspension were determined for mass
normalization among samples.
Culture-dependent and culture-independent techniques were used to characterize the microbial
community. A five-tube most probable number (MPN) approach was used to enumerate iron-oxidizing
acidophiles, sulfur-oxidizing acidophiles and thiosulfate-oxidizing neutrophiles [24]. The culture
medium for iron oxidizers was comprised of a basal salt solution and an Fe(II) stock solution, which
were prepared separately to prevent Fe(II) oxidation prior to inoculation. The basal salt solution was
prepared by dissolving (0.9 L−1) 0.4 g (NH4)2SO4, 0.1 g K2HPO4 and 0.4 g MgSO4∙7H2O in DI water,
and adjusting the pH to 2.2 using H2SO4. The Fe(II) stock was prepared by dissolving (L−1) 33.3 g
FeSO4∙7H2O into DI water that had previously been acidified to pH 2.2 with H2SO4. These solutions
were filter sterilized through 0.45 µm membranes, and 4.5 mL of stock solution plus 0.5 mL of Fe(II)
stock solution were combined in sterile culture tubes.
Sulfur-oxidizing acidophiles were grown in a culture medium prepared by dissolving (L−1) 0.3 g
(NH4)2SO4, 0.1 g KH2PO4, 0.4 g MgSO4∙7H2O, 0.33 g CaCl2∙2H2O and 18 mg FeSO4∙7H2O in DI
water and adjusting the final pH to 2.3 using H2SO4. The culture medium for thiosulfate oxidizing
neutrophiles was prepared by adding (L−1) 0.3 g (NH4)2SO4, 0.1 g KH2PO4, 0.4 g MgSO4∙7H2O, 0.33 g
CaCl2∙2H2O and 4.93 g Na2S2O3∙5H2O to DI water and adjusting the final pH to 7 with NaOH. These
media were filter sterilized through a 0.45 µm membrane, and 5 mL aliquots were dispensed into
separate sterile culture tubes. Inoculation was performed by pipetting 1 mL of the sample suspension
into each of five sterile culture tubes containing a given culture medium. A series of nine 10-fold serial
dilutions was performed immediately following inoculation, and the contents of each tube were
vortexed for 30 s prior to each dilution. Following inoculation, a thin film of ~0.15 g of elemental
(sublimed) S was added as a substrate for the sulfur-oxidizing acidophiles. Results for all MPN
enumerations were tabulated after a six-week incubation period at room temperature (~21 °C).
Total (live and dead) bacteria were quantified using a Live/Dead® Baclight™ bacterial viability kit
(Molecular Probes Inc., Burlington, ON, Canada). This fluorescence-based assay distinguishes
between live and dead cells using two nucleic acid stains: (1) a green fluorescent stain, SYTO® 9,
which labels membranes of both live and dead cells; and (2) a red fluorescent stain, propidium iodide,
Minerals 2014, 4
176
which selectively labels only damaged (dead) cell membranes. Propidium iodide preferentially labels
dead cells over SYTO® 9; therefore, bacterial viability can be assessed through quantification of both
live and dead cells. The assays were initiated by pipetting 6 µL of sample suspension into 1 mL of
sterile DI water contained in micro-centrifuge tubes. The addition of 3 µL of a 1:1 (v/v) mixture of
each stain preceded incubation in the dark and at room temperature. After 15 min, the solution was
passed through a 0.1-µm filter and retained bacterial cells were counted by fluorescence
photomicroscopy (Nikon Optiphot-2, Melville, NY, USA). The integrated criteria of shape, size, and
fluorescence were used to distinguish stained bacteria from autofluorescence and non-specific binding
of fluorophores to clay particles.
2.5. Fluorescence in Situ Hybridization
Fluorescence in situ hybridization (FISH) uses fluorescently tagged oligonucleotide probes to
identify specific rRNA sequences within microbial cells. Probes specific to different taxonomic levels,
including at the genus and species levels, have been developed and can be applied to whole-cell
hybridization of environmental and laboratory samples providing valuable insight into microbial
community structure, spatial arrangement and cell viability [25].
Samples of fines (as above) were suspended in 3 mL PBS solution (L−1 distilled water: 8 g NaCl, 0.2 g
KCl, 1.44 g Na2HPO4 and 0.24 g KH2PO4, pH-adjusted to 7.4) and preserved in 4% paraformaldehyde
for 16 h. Gelatin-coated slides (ethanol-sterilized slides coated by dipping in a 50 °C filter-sterilized
solution of 0.1% (w/v) gelatin and 0.01% (w/v) KCr(SO4)2 prepared in distilled water) were
UV-irradiated for 30 min. Five μL of sample was applied to the slide, smearing it with the end of the
pipette tip in a dime-sized circle. Slides were air-dried in a sterile environment for 1 h at room
temperature. Samples were dehydrated by soaking slides in an increasing ethanol series (3 min at 50%,
80% and 95% ethanol) and air-dried in a sterile environment for 1 h at room temperature. Twenty-five
microliter of hybridization solution (24 μL of hybridization buffer (0.9 M NaCl, 100 mM Tris, 1%
SDS and 20% formamide) and 50 ng of probe) was applied to the dried sample. Samples were covered
with plastic cover slips to ensure even hybridization. The probe used was the genus-specific molecular
probe Thio820 (ACCAAACATCTAGTATTCATC 5′-labelled Alexafluor 647; Acidithiobacillus).
Slides were incubated in the dark at 37 °C for 4–9 h in a container kept humid by tissues soaked in
hybridization buffer. Cover slips were removed following hybridization by dipping slides into staining
jars filled with hybridization buffer equilibrated to 37 °C. Slides were rinsed twice (10 min shaking in
a water bath) in a wash buffer (0.5 M NaCl, 100 mM Tris, 5 mM EDTA, 0.1% SDS) equilibrated to
37 °C followed by a final rinse in distilled water. Slides were then air-dried in the dark at room
temperature. Slides were counterstained with 20 µL of DAPI (1 µg/mL) and glass cover slips were
sealed over the sample. Fluorescence imaging was performed with a Leica LEITZ DMRX epifluorescence
microscope (Leica Microsystems, Richmond Hill, ON, Canada). Openlab 2.2.5 (Improvision,
Coventry, UK) was used for digital imaging.
2.6. Electron Microscopy
Two samples of weathered metal sulfides (phenotypic evidence of oxidation) were collected from
each of the three experimental waste rock piles (Pile 1, Pile 2 and Pile 3) and one field cell (FC-2-3A)
Minerals 2014, 4
177
for detailed examination by electron microscopy. Samples fixed in 1% glutaraldehyde were dehydrated
through a graded ethanol series (25, 50, 75 and 100 vol % ethanol for 30 min each) and dried using a
SamDri® CO2(l) critical-point drier (Tousimis Research Corp., Rockville, MD, USA) to preserve cell
structure. Samples were mounted on aluminum stubs using carbon tape and coated with platinum to
ensure conductance.
Imaging and semi-quantitative chemical analysis was performed on a LEO 1540XB field
emission-scanning electron microscope (Carl Zeiss SMY AG, Oberkochen, Germany) fitted with an
EDAX™ (Ametek, Berwyn, PA, USA) energy dispersive X-ray spectrometer (FE-SEM-EDS). An
accelerating potential of 3 kV was used for secondary electron (SE) imaging and EDS spectra were
collected at a 10 kV accelerating potential. Cross-sections of sulfide-mineral surfaces were exposed for
FE-SEM-EDS examination by sputter milling with an integrated focused ion beam (FIB).
3. Results and Discussion
3.1. Bulk Mineralogy and Geochemistry
Calcite was observed in samples from experiments containing marble-hornfels and exoskarn waste
rock (Table 2). The calcite content of the marble-hornfels, which generally occurs at the margins of the
deposit, was 67 wt % for FC-1-3A and 53 wt % for Pile 1. Calcite contents for experimental samples
containing exoskarn were 9.1 wt % (FC-3-2A) and 3.0 wt % (Pile 3). Calcite was not detected by
powder XRD analysis of intrusive rock samples (FC-2-2B, FC-2-3A and Pile 2); however, this
acid-neutralizing phase is present in intrusive rocks from the Antamina deposit. The pH of drainage
emanating from experimental piles and field cells containing marble-hornfels or exoskarn ranged from
7.3 to 7.9 between July 2008 and June 2009 (Table 1). Calcite was detected as a primary component
of the mineral assemblage in these samples, and the observed pH values are indicative of
carbonate-mineral dissolution.
Table 2. Results of mineralogical investigation using X-ray diffraction (XRD) and
scanning electron microscopy-energy dispersive X-ray spectroscopy (SEM-EDS). Minerals
detected by XRD are reported in wt % determined during Rietveld refinement.
Lithologic Unit
Experimental ID
Marble-Hornfels
Pile 1
FC-1-3A
Pile 2
FC-2-2B
FC-2-3A
Pile 3
FC-3-2A
Intrusive
Exoskarn
Cal
53
67
3.0
9.1
Mineral Abundance (wt %)
Py
Ccp
Sp
Mo
Gn
0.8
0.7
0.3
1.4
*
0.2
0.3
0.9
<0.1
0.5
0.8
1.7
2.6
0.2
13.0
3.7
1.1
8.6
0.9
5.1
Apy
Po
*
*
Note: * Mineral phases detected by SEM-EDS and not XRD.
Sulfide minerals were detected in waste rock from all experiments; however, samples of exoskarn
consistently exhibited the greatest sulfide-mineral content. Pyrite was the most abundant sulfide
mineral in the exoskarn (Pile 3, FC-3-2A) and marble-hornfels (Pile 1, FC-1-3A) rock types, while
Minerals 2014, 4
178
chalcopyrite was the most abundant sulfide mineral in the intrusive (Pile 2, FC-2-2B, FC-2-3A) waste
rock. In addition to chalcopyrite, samples from experiments that contained intrusive waste rock also
contained pyrite (0.3 to 1.7 wt %) and molybdenite (≤0.2 wt %). Subsequent examination of these
samples by SEM-EDS confirmed the presence of arsenopyrite (FC-2-2B) and pyrrhotite (FC-2-3A).
The bulk geochemistry of the samples largely reflected the mineral assemblage of the waste rock
(Figure 1). Concentrations of Fe, Cu and Zn generally corresponded to the relative abundance of
pyrite, chalcopyrite and sphalerite, respectively. Low concentrations of Mo and Pb were detected in
samples where molybdenite and galena were not detected by XRD, suggesting these phases were
present in low amounts. Furthermore, trace concentrations of As were observed in waste rock samples,
which is indicative of the presence of arsenopyrite or other As-bearing minerals at low abundance in
these waste rock types. Total-S contents generally corresponded to total sulfide-mineral abundance,
whereas elevated total-C concentrations were observed for samples where calcite was identified by
XRD. Low total-C concentrations also were detected in samples of intrusive waste rock (Pile 2,
FC-2-2B, FC-2-3A) where calcite could not be detected in XRD patterns.
Figure 1. Whole-rock analyses by X-ray fluorescence (XRF) (Fe, Cu, Zn, Mo, Pb and As)
or combustion-infrared detection (S and C) for waste rock samples collected in February 2009.
3.2. Microbiology
Populations of neutrophilic thiosulfate oxidizers were clearly abundant in all piles; exceeding a
million per gram, with populations ranging from 3.6 × 106 to 2.2 × 108 MPN∙g−1 of washed sediment
(Figure 2). Growth of acidophiles was observed only for samples of intrusive waste rock collected
from Pile 2 and FC-2-3A. Elevated populations of acidophilic iron oxidizers (6.5 × 106 MPN∙g−1) and
sulfur oxidizers (1.1 × 107 MPN∙g−1) were associated with the field cell, while only acidophilic iron
oxidizers (4.9 × 101 MPN∙g−1) were successfully cultured from Pile 2. Cultured acidophiles were capable
of oxidizing both Fe and S, which is indicative of Acidithiobacillus ferrooxidans as opposed to other
commonly-identified acidophiles (e.g., Acidithiobacillus thiooxidans, Leptospirillum ferrooxidans).
Total bacterial populations estimated from direct counts of live and dead bacteria viability ranged
from 1.0 × 107 to 3.4 × 108 bacteria g−1 (Figure 2). In five of the seven samples the bacteria were >75%
viable, indicating that the microbial populations were likely active within the experimental waste rock
Minerals 2014, 4
179
piles and field cells. The two samples with highest populations as measured by both Live/Dead
Baclight™ and MPN techniques (Figure 2) also exhibited the lowest proportion of living bacteria (Pile
3, FC-3-2A). This difference may be indicative of geochemical stress resulting from biological activity
in the exoskarn waste rock, which exhibited the greatest sulfide-mineral and metal contents, and an
average annual pH of 7.4. The total count value can be less than the cultured count when you consider
that bacteria occurring “underneath” minerals are not counted; therefore, the microscopic counts are
underestimates of the total number of bacteria.
Figure 2. Bacterial enumerations performed on waste rock samples collected in February
2009. Enumerations of total and live bacteria performed using Live/Dead Baclight™.
Culture-based enumeration of Thiobacillus spp., e.g., A. thiooxidans and A. ferrooxidans,
was performed using the most probable number (MPN) technique.
Fluorescent in situ hybridization (FISH) imaging of samples revealed the presence of bacterial cells
that hybridized with the genus-specific probes for Acidithiobacillus sp. (Thio820) in four of the seven
samples (Piles 2 and 3, FC-2-3A, and FC-3-2A). The highest proportion of cells stained with both
Thio820 and DAPI were observed in samples from Pile 3. Three bacterial cell morphologies were
observed; slightly curved rods, highly curved rods, and filamentous bacteria. The most abundant cell
morphology was the slightly curved rod, which was commonly observed during FE-SEM-EDS and the
Live/Dead Baclight™ microscopy. This bacterial morphology is characteristic of Acidithiobacillus sp.
and was observed in samples from Pile 2 and FC-2-3A. Less abundant were highly curved rod-shaped
bacteria similar in morphology to Leptospirillum spp. [26] observed in sample FC-2-3A. Filamentous
bacteria were observed in samples FC-2-2B, FC-3-2A, FC-1-3A, and Pile 3 during Live/Dead
Baclight™ procedure. These filamentous bacteria are similar to Thermothrix thiopara, which is
capable of thiosulfate oxidation at circumneutral pH [27]. Filamentous bacteria were not observed
during FE-SEM imaging.
Although waste rock from Pile 1 and FC-1-3A (marble-hornfels) had been subjected to the longest
period of oxidation, colonization by acidophiles was not apparent from MPN enumerations. Electron
microscopy (FE-SEM) revealed a fine-grained secondary precipitate had accumulated within Pile 1;
however, bacterial cells were not observed. Cumulative sulfate mass discharges were lowest for the
Minerals 2014, 4
180
marble-hornfels waste rock when comparing results among corresponding experiments. Although
colonization by acidophiles was not observed, the presence of Zn and Cu in drainage from FC-1-3A is
indicative of ferric leaching of sphalerite and chalcopyrite (Reactions (1)–(3)). Limited discharge of
these metals from Pile 2 is attributed to secondary controls (i.e., co-precipitation, sorption) on their
mobility within the experimental waste rock piles. Despite the higher pyrite content of the exoskarn
waste rock, microbial communities in samples from Pile 3 and FC-3-2A also were dominated by
neutrophilic Thiobacillus spp. at similar populations to those observed for the marble-hornfels waste
rock. Calcite comprised a smaller component of the exoskarn mineral assemblage compared to that of
marble-hornfels; however, this waste rock type exhibited the highest pyrite content (Table 2). The
presence of bacteria associated with a thin filamentous film at the grain margin suggests involvement
in sulfide-mineral oxidation. However, limited biofilm development and a general lack of secondary
Fe(III) precipitates suggests that growth on A. ferrooxidans or other acidophilic bacteria were pH
limited. Drainage from the experiments containing exoskarn also exhibited circumneutral average pH
values of 7.5 (Pile 3) and 7.3 (FC-3-2A). Nonetheless, cumulative mass discharges for sulfate and zinc
were the highest compared among experimental piles or field cells. The relatively rapid colonization of
intrusive waste rock type by acidophiles, combined with a general lack of acidophiles in
marble-hornfels and exoskarn waste rock, indicate that carbonate-mineral content and bulk pH
controlled the colonization of sulfide-minerals by acidophilic bacteria.
Fe2+ + H+ + ¼ O2 → Fe3+ + ½ H2O; biotic
(1)
8 Fe3+ + ZnS + 4 H2O → 8 Fe2+ + Zn2+ + SO42− + 8 H+; abiotic
(2)
14 Fe3+ + FeCuS2 + 7 H2O → 15 Fe2+ + Cu2+ + 2 SO42− + 14 H+; abiotic
(3)
In addition to Thiobacillus spp., microbial communities within samples from Pile 2 and FC-2-3A
(intrusive) included viable populations of acidophilic iron oxidizers. The largest population of acidophilic
iron oxidizers was found in FC-2-3A, which also was characterized by an elevated population of
acidophilic sulfur oxidizers and an average annual drainage pH of 6.2. These bacteria appear to have
colonized the sulfide mineral surface initially by direct attachment, cementation and formation of an
acidic expansion front (Pile 2; Figure 3), as proposed by Mielke et al. [18]. The extensive occurrence of
microbially-colonized Fe(III) (oxy)hydroxysulfate, e.g., jarosite (KFe3(OH)6(SO4)2) and Fe(III)
(oxy)hydroxide phases within FC-2-3A suggests that formation of these precipitates may support
growth of acidophilic bacteria in NRD systems following the initial colonization stage (below). The
occurrence of acidophiles in Pile 2 and FC-2-3A is attributed to the low calcite content of the intrusive
waste rock, which may facilitate the rapid development of an acidic layer at sulfide-mineral surfaces.
Cumulative mass discharges for sulfate were similar between intrusive and marble-hornfels waste rock
for a given experiment (i.e., experimental piles or field cells); however, precipitation of gypsum or
other sulfate phases may complicate relative comparisons of sulfate discharge among waste rock types.
3.3. Mineralogy and X-ray Absorption Spectroscopy
Weathered sulfide minerals from the three waste rock piles, and one field cell FC-2-3A that exhibited
elevated populations of acidophilic bacteria, were selected for detailed examination by FE-SEM-EDS.
Minerals 2014, 4
181
Bacterial cells were generally sparse on samples from the field cells; however, surfaces of weathered
pyrite grains from Pile 2 were colonized by bacteria (Figure 3A). For Pile 2, dissolution pits
surrounded by secondary minerals were observed in the absence of bacterial cells at the surface of a
chalcopyrite grain (Figure 3B). The occurrence of secondary precipitates surrounding the dissolution
pit is indicative of bacterial attachment, which has been associated with localized precipitation of
Fe(III) phases at cell margins and on EPS deposits [18,28,29]. Despite exhibiting the highest MPN
population of neutrophilic thiosulfate oxidizers, relatively few bacterial cells were observed at
chalcopyrite or pyrite surfaces in samples collected from Pile 3 (data not shown).
Figure 3. Field emission-scanning electron microscopy secondary electron (FE-SEM SE)
micrographs of: (A) bacterially-colonized secondary Fe(III) (oxy)hydroxysulfate precipitates
at the sulfide-mineral surface in FC-2-3A (EDS analysis indicated the presence of Fe, S
and O—data not shown); and (B) relic direct attachment pits at the surface of a chalcophyrite
grain in Pile 2. Scale bars equal 3 µm.
A macroscopic sulfide clast comprised of chalcopyrite, pyrrhotite, sphalerite and pyrite (based on
EDS analyses), and characterized by the presence of extensive weathering products was selected from
FC-2-3A for detailed analysis. Imaging of the weathered clast by FE-SEM revealed extensive
secondary mineral-precipitation and biofilm formation at mineral surfaces. Bacterial cells were largely
associated with porous precipitate localized at surfaces of weathered pyrite and pyrrhotite within the
clast (Figures 4–6). The highest density of bacterial cells was observed within this porous layer rather
than on the underlying mineral surfaces (Figure 4). This secondary-precipitate layer exhibited the fibrous
morphology characteristic of schwertmannite, and was commonly bound between the sulfide-mineral
surface and a less porous, smooth precipitate crust (Figure 4A). The mineralogical composition of this
secondary Fe(III)-bearing coating could not be distinguished from primary phases in powder XRD
analysis of liberated grains. However, LCF of bulk Fe K-edge EXAFS spectra (Χ2 = 0.44) was
achieved by fitting pyrite, schwertmannite [Fe8O8(OH)6–4.5(SO4)1–1.75], lepidocrocite [γ-FeO(OH)] and
K-jarosite [KFe3(OH)6(SO4)2] (Figure 5). The fitted ratio of schwertmannite to lepidocrocite to
Minerals 2014, 4
182
K-jarosite was found to be 4.2:1.6:1, indicating that schwertmannite was the most abundant secondary
Fe-bearing precipitate within the secondary mineral coating on this weathered sulfide grain. Pitting of
the pyrrhotite surface was observed for a location where the schwertmannite had become detached,
whereas pitting was limited to the adjacent pyrrhotite surface (Figure 4D). This observation
suggests that the Fe incorporated into schwertmannite is derived from dissolution of the underlying
sulfide-mineral surface.
Figure 4. FE-SEM SE micrographs of: (A) a exposed region of porous schwertmannite
covered by a thin, non-porous crust; (B) bacteria within the porous schwertmannite layer
observed at higher magnification; (C) bacterially-colonized porous schwertmannite beneath
the thin, non-porous crust; and (D) an area of bacterially-colonized schwertmannite that
separated from sulfide-mineral surface revealing extensive pitting. Scale bars equal 10 µm,
1 µm, 1 µm and 1 µm, respectively.
Minerals 2014, 4
183
Figure 5. FE-SEM SE micrograph of microbially-colonized, secondary Fe-bearing mineral
coating on surface of a sulfide-mineral clast from intrusive waste rock (FC-2-3A). Scale
bar equals 5 µm. Corresponding bulk Fe K-edge extended X-ray absorption fine structure
(EXAFS) spectra (solid line) and linear combination fitting (LCF) fit (circles) of
sulfide-mineral weathering products.
A transect measuring ~30 µm long was FIB milled through the schwertmannite-rich layer near an
exposed pyrrhotite surface to facilitate FE-SEM-EDS examination across this layer (Figure 6). Three
distinct layers exhibiting different chemical composition and texture were observed in SE images
showing this cross-section (Figure 6D). The upper layer was composed of an Fe–S–O precipitate
containing minor amounts of Si. The molar Fe:S ratio of this layer was 8:2.4, which is similar to the
8:(1–1.75) molar ratio that is characteristic of schwertmannite. Slight variation from the ideal molar
ratio may result from the precipitation of sulfate phases during sample drying. A lighter-colored
intermediate Fe–O–Si layer contained ~20% (molar) Si and trace concentrations of Al content. A
distinct transition from the middle Fe–O–Si layer to a lighter colored Fe–O layer was observed, which
was comprised solely of Fe and O. The porosity of the upper schwertmannite layer was estimated to be
8.2% based on two dimensional binary image analysis of the SE image. Approximately 50% of this
porosity was associated with a large void located in the upper left quadrant of the image (Figure 6D,E).
The porosity of the upper schwertmannite layer, which was poorly preserved during FIB milling, is
likely much greater at zones more distal to the primary sulfide-mineral surface.
Poorly ordered ferrihydrite [nominally Fe2O3∙½H2O] and schwertmannite generally are the first
Fe(III) phases to precipitate during oxidation of iron-sulfide minerals [30,31]. These minerals are
metastable with respect to more crystalline and less soluble Fe(III) (oxy)hydroxides, and will
transform to goethite [αFeOOH] at circumneutral pH with lepidocrocite [γFeOOH] commonly forming
Minerals 2014, 4
184
as an intermediate phase [30,32–35]. Under low-pH conditions (i.e., pH ≤ 3), these Fe(III)
(oxy)hydroxides can transform to jarosite in the presence of monovalent cations [30,36,37]. Due to the
nano-crystalline nature schwertmannite, and the geochemical conditions under which this phase forms,
schwertmannite has been commonly identified as the predominant Fe precipitate produced by
acidophilic iron oxidizing bacteria [36,38–41]. Dissolved Fe concentration in drainage from the
experimental piles and field cells generally remained below the method detection limit (0.001 mg∙L−1)
due to the low solubility of Fe(III) in circumneutral pH waters. This result precluded geochemical
equilibrium modeling of associated mineral saturation indices.
Figure 6. FE-SEM SE micrographs of: (A) an overview of the surface of a
bacterially-colonized, weathered pyrrhotite grain with areas selected for higher magnification
imaging; (B) a bacterially-colonized layer of porous schwertmannite and adjacent pyrrhotite
surface exhibiting no direct bacterial attachment; (C) a mineralised biofilm surrounded by
porous schwertmannite with non-porous crust present at the top of the image; (D) three
different layers of iron oxides exposed by the focused ion beam (FIB) cut; and
(E) mineralized bacteria (arrows) within the micrometer-scale porous structure located
approximately 5 µm below the outer margin of the schwertmannite layer. Scale bars equal
50 µm, 5 µm, 2 µm, 5 µm and 0.5 µm, respectively.
Minerals 2014, 4
185
The biogeochemical conditions under which ferrihydrite or schwertmannite will precipitate remains
somewhat uncertain [42]. Thermodynamic-based predictions indicate that ferrihydrite precipitation is
favored at circumneutral and alkaline pH, whereas schwertmannite precipitation is favored under
circumneutral to acidic pH conditions [33,37,38]. The average pH of drainage from FC-2-3A initially
was mildly alkaline (pH > 8), but decreased to 6.2–6.5 after approximately 3 months. Under bulk
circumneutral pH conditions observed in this field cell, the precipitation of schwertmannite may be
thermodynamically favored in the presence of sulfate [42]. Iron K-edge EXAFS spectra indicated that
schwertmannite was the dominant Fe-bearing precipitate on the weathered sulfide clast from FC-2-3A
(intrusive), while lesser amounts of K-jarosite and lepidocrocite were present. Bigham et al. [33] found
that schwertmannite was the predominant Fe(III) phase in acid sulfate waters (n = 28) at pH 2.8–4.5,
whereas K-jarosite dominated at pH < 2.5 and mixtures of ferrihydrite and goethite occurred at
pH > 6.5. The presence of both schwertmannite and K-jarosite on this weathered sulfide clast is
indicative of the development of an acidic microenvironment at the sulfide mineral surface, i.e., is an
important habitat, in this intrusive waste rock (FC-2-3A), which at the time of sample collection was
characterized by bulk NRD conditions.
3.4. Bacteria-Mineral Interactions
Examination of sulfides using FE-SEM revealed that bacteria in the FC-2-3A intrusive sample were
commonly associated with schwertmannite at the weathered sulfide-mineral surface (Figures 3C and 4–6).
These bacteria occurred within the porous structure of schwertmannite, which was often covered with
a thin, non-porous crust (Figure 5A,C). Bacteria were also found in porous schwertmannite on the
fringe of the crusted region (Figure 4C), and buried within schwertmannite between the crust and the
sulfide mineral surface (Figure 6D,E). The crust formed only in regions with thick schwertmannite
layers, suggesting that changes in biogeochemical conditions at greater distance from the sulfide-mineral
surface may not favor schwertmannite precipitation. The abundance of bacteria within the porous
schwertmannite layer indicates that precipitation of this mineral phase is an important microbial
habitat. This layer has potential to provide isolation from bulk geochemical conditions within the waste
rock, thereby facilitating the development of an acidic microenvironment.
Intuitively, the porosity within the schwertmannite must be amenable to microbial growth. Sulfide
surfaces covered with the non-porous lower two layers exposed in the FIB transect (Figure 6D)
demonstrate that sulfides may quickly become armored. However, the oxidation of sulfide minerals
coated by porous schwertmannite may be subjected to ongoing oxidation due to the diffusive transport
of oxidants through this layer. If sulfide mineral surfaces continue to be oxidized beneath the porous
schwertmannite, acidic conditions could persist within the pore space of the schwertmannite. This
mechanism was inferred where a schwertmannite layer became detached from the underlying pyrrhotite
surface, exposing dissolution pitting uncharacteristic of bacterial attachment [18,19,28,43]. The
occurrence of K-jarosite in FC-2-3A reflects the presence of acidic conditions at the sulfide-mineral
surfaces, and indicates that Fe(III) contributes to sulfide-mineral oxidation in this NRD system.
The direct attachment model is often used to explain the colonization of acidophilic bacteria in
circumneutral pH environments [18,44]. This model describes the development of acidic
microenvironment at the bacteria-mineral interface, where increased Fe(III) solubility facilitates Fe
Minerals 2014, 4
186
redox cycling coupled with sulfide oxidation [18]). Relic direct attachment sites (i.e., pits) on the
chalcopyrite surface in Pile 2 (Figure 2B) were surrounded by a secondary Fe(III) precipitate,
presumably reflecting direct attachment by acidophiles. The secondary Fe(III) precipitate associated
with the attachment sites exhibited a tubular structure similar to schwertmannite, which is in distinct
contrast to precipitates not associated with attachment sites. Acidophilic iron oxidizing bacteria can
promote the precipitation of Fe(III) (oxy)hydroxide and Fe(III) (oxy)hydroxysulfate minerals on or
near the cell surface [29]). The close association of attachment sites and secondary Fe(III) precipitates,
combined with limited pitting in surrounding areas of the chalcopyrite surface, suggest that acidophilic
bacteria were facilitating sulfide-mineral oxidation via Fe(III) generation. Acidophilic iron oxidizing
bacteria were not abundant, but viable populations were cultured from Pile 2 (intrusive), where these
relic direct attachment sites were observed. The expansion of acidic microenvironments from initial
attachment sites appears to have been facilitated through precipitation of schwertmannite and
K-jarosite, which supported the larger populations of acidophilic bacteria observed in FC-2-3A.
3.5. Implications for Drainage Quality
Rates of sulfide-mineral oxidation are dependent on the activity of lithoautotrophic bacteria [10].
Hollings et al. [45] demonstrated that microbial activity accounted for a doubling of O2 consumption
rates—a proxy for sulfide-mineral oxidation—in sulfidic waste rock characterized by NRD conditions.
At circumneutral pH, the chemical oxidation of sulfide-minerals by Fe(III) could be expected to be
limited by the low solubility of this electron acceptor. However, development of acidic microenvironments
at sulfide-mineral surfaces may support localized increases in Fe(III) solubility and sulfide-mineral
oxidation rates. Rates of abiotic Fe(II) oxidation are relatively slow at pH < 4, making this process a
potential rate-limiting step in in the oxidation of sulfide minerals [8,9]. However, the microbial
catalysis of Fe(II) oxidation can greatly increase rates of Fe(III) generation, and therefore
sulfide-mineral oxidation, under acidic conditions [10].
The relative increase in MPN populations of acidophilic iron and sulfur oxidizers within intrusive
waste rock (FC-2-3A) is indicative of a transition in the microbial community towards ARD
conditions. This transition has previously been observed prior to acidification of mine waste [1,12,44].
Although bulk drainage pH for this waste rock remained circumneutral during the study period, a
transition from NRD to ARD conditions would result in substantial changes in drainage chemistry.
Dissolved concentrations of several metals (i.e., Fe, Zn, Cu) generally exhibit an indirect relationship
with pH; therefore, the development of ARD conditions would have important implications for water
quality management.
4. Conclusions
Results of this study indicate that extensive development of acidic microenvironments may support
growth of acidophilic bacteria within bulk neutral rock drainage settings. The formation of porous
schwertmannite layers at sulfide-mineral surfaces supported relatively large populations of acidophilic
bacteria, which likely were contributing to sulfide-mineral oxidation by generating Fe(III) for
sulfide-mineral oxidation. Assuming bulk pore-water chemistry is amenable to schwertmannite
stability, the ongoing growth of this schwertmannite layer is expected to facilitate proliferation of
Minerals 2014, 4
187
acidophilic iron oxidizing bacteria. A principal implication of the development of this acidic
microenvironment is the potential for increased oxidation rates due to localized increases in Fe(III)
solubility at sulfide-mineral surfaces. Limited growth of acidophiles in waste rock characterized by
higher calcite contents (i.e., marble-hornfels, exoskarn) indicates that the formation of acidic
microenvironments is inhibited or delayed by carbonate dissolution reactions.
Waste rock environments are highly heterogeneous with respect to both mineralogy and
geochemistry [46]. Although the field cell containing intrusive waste rock (FC-2-3A) exhibited varied
microbial and geochemical characteristics to the other experiments, this system provided the ideal
opportunity to evaluate processes controlling the transition from circumneutral to acidic pH conditions.
Geochemical conditions favorable to extensive growth of acidophilic bacteria clearly can develop
within mine wastes characterized by bulk circumneutral pH drainage. This information is critical for
the development of innovative strategies for managing water quality in neutral rock drainage settings.
Acknowledgments
We thank Celedonio Aranda, Sharon Blackmore, Stephane Brienne, Bevin Harrison, Trevor Hirsche
and Holly Peterson for logistical and technical contributions. We also thank Dr. Ben Kocar of Stanford
University for performing XAS analysis. Funding was provided by Compañía Minera Antamina S.A.,
Teck Resource Ltd., and the Natural Sciences and Engineering Research Council of Canada (NSERC)
through a Collaborative Research and Development (CRD) grant and through the NSERC Discovery
program (Southam).
Author Contributions
Mayer and Beckie had the original concept for the project. Southam provided guidance on linking
microbiology to geochemistry and mineralogy. Dockrey and Lindsay were a MSc and post-doctoral
fellow at UBC who worked on the project and produced the first draft of the manuscript; both visited
Southam’s laboratory. Norlund and Warren provided their molecular expertise to the bacterial
identifications. All authors were involved with data interpretation and in writing the manuscript.
Conflicts of Interest
The authors declare no conflict of interest.
References
1.
2.
3.
Blowes, D.W.; Ptacek, C.J.; Jambor, J.L.; Weisener, C.G. The geochemistry of acid mine
drainage. Treatise Geochem. 2003, 9, 149–204.
Nordstrom, D.K. Hydrogeochemical processes governing the origin, transport and fate of major
and trace elements from mine wastes and mineralized rock to surface waters. Appl. Geochem.
2011, 26, 1777–1791.
Jurjovec, J.; Ptacek, C.J.; Blowes, D.W. Acid neutralization mechanisms and metal release in
mine tailings: A laboratory column experiment. Geochim. Cosmochim. Acta 2002, 66, 1511–1523.
Minerals 2014, 4
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
188
Heikkinen, P.M.; Räisänen, M.L.; Johnson, R.H. Geochemical characterisation of seepage and
drainage water quality from two sulphide mine tailings impoundments: Acid mine drainage versus
neutral mine drainage. Mine Water Environ. 2009, 28, 30–49.
Lindsay, M.B.J.; Condon, P.D.; Jambor, J.L.; Lear, K.G.; Blowes, D.W.; Ptacek, C.J. Mineralogical,
geochemical, and microbial investigation of a sulfide-rich tailings deposit characterized by neutral
drainage. Appl. Geochem. 2009, 24, 2212–2221.
Nordstrom, D.K.; Alpers, C.N.; Ptacek, C.J.; Blowes, D.W. Negative pH and extremely acidic
mine waters from Iron Mountain, California. Environ. Sci. Technol. 2000, 34, 254–258.
Moncur, M.C.; Ptacek, C.J.; Blowes, D.W.; Jambor, J.L. Release, transport and attenuation of
metals from an old tailings impoundment. Appl. Geochem. 2005, 20, 639–659.
Singer, P.C.; Stumm, W. Acidic mine drainage: The rate determining step. Science 1970, 167,
1121–1123.
Williamson, M.A.; Rimstidt, J.D. The kinetics and electrochemical rate-determining step of
aqueous pyrite oxidation. Geochim. Cosmochim. Acta 1994, 58, 5443–5454.
Nordstrom, D.K.; Southam, G. Geomicrobiology of sulfide mineral oxidation. Rev. Mineral.
1997, 35, 361–390.
Southam, G.; Beveridge, T.J. Enumeration of thiobacilli within pH-neutral and acidic mine
tailings and their role in the development of secondary mineral soil. Appl. Environ. Microbiol.
1992, 58, 1904–1912.
Blowes, D.W.; Al, T.A.; Lortie, L.; Gould, W.D.; Jambor, J.L. Microbiological, chemical and
mineralogical characterization of the Kidd Creek Mine Tailings Impoundment, Timmins area,
Ontario. Geomicrobiol. J. 1995, 13, 13–31.
Blowes, D.W.; Jambor, J.L.; Hanton-Fong, C.J.; Lortie, L.; Gould, W.D. Geochemical, mineralogical
and microbiological characterization of a sulphide-bearing carbonate-rich gold mine tailings
impoundment, Joutel, Quebec. Appl. Geochem. 1998, 13, 687–705.
Goldhaber, M.B. Experimental study of metastable sulfur oxyanion formation during pyrite
oxidation at pH 6–9 and 30 °C. Amer. J. Sci. 1983, 283, 193–217.
Moses, C.O.; Herman, J.S. Pyrite oxidation at circumneutral pH. Geochim. Cosmochim. Acta
1991, 55, 471–482.
Schippers, A.; Jozsa, P.-G.; Sand, W. Sulfur chemistry in bacterial leaching of pyrite. Appl.
Environ. Microbiol. 1996, 62, 3424–3431.
Dopson, M.; Lindstrom, E.B. Potential role of Thiobacillus caldus in arsenopyrite bioleaching.
Appl. Environ. Microbiol. 1999, 65, 36–40.
Mielke, R.E.; Pace, D.L.; Porter, T.; Southam, G. A critical stage in the formation of acid mine
drainage: Colonization of pyrite by Acidithiobacillus ferrooxidans under pH-neutral conditions.
Geobiology 2003, 1, 81–90.
Pace, D.L.; Mielke, R.E.; Southam, G.; Porter, T.L. Scanning force microscopy studies of the
colonization and growth of A. ferrooxidans on the surface of pyrite minerals. Scanning 2005, 27,
136–140.
Sand, W.; Gehrke, T.; Hallman, R.; Schippers, A. Sulfur chemistry, biofilm, and the (in)direct
attack mechanism—A critical evaluation of bacterial leaching. Appl. Microbiol. Biotechnol. 1995,
43, 961–966.
Minerals 2014, 4
189
21. Love, D.A.; Clark, A.H. The lithologic, stratigraphic, and structural setting of the giant Antamina
copper-zinc skarn deposit, Ancash, Peru. Econ. Geol. 2004, 99, 887–916.
22. Webb, S.M. SIXpack: A graphical user interface for XAS analysis using IFEFFIT. Phys. Scr.
2005, 2005, 1011–1014.
23. Strömberg, B.; Banwart, S.A. Experimental study of acidity-consuming processes in mining waste
rock: some influences of mineralogy and particle size. Appl. Geochem. 1999, 14, 1–16.
24. Cochran, W.G. Estimation of bacterial densities by means of the “most probable number”.
Biometrics 1950, 6, 105–116.
25. Amann, R.I.; Ludwig, W.; Schleifer, K.H. Phylogenetic identification and in situ detection of
individual microbial cells without cultivation. Microbiol. Rev. 1995, 59, 143–169.
26. Chapana, R.J.A.; Tributsch, H. Interfacial activity and leaching patterns of Leptospirillum
ferrooxidans on pyrite. FEMS Microbiol. Ecol. 2004, 47, 19–29.
27. Brannan, L.D.K.; Caldwell, D.E. Thermothris thiopara: Growth and metabolism of a newly
isolated thermophile capable of oxidizing sulfur and sulfur compounds. Appl. Environ. Microbiol.
1980, 40, 211–216.
28. Edwards, K.J.; Hu, B.; Hamers, R.J.; Banfield, J.F. A new look at microbial leaching patterns on
sulfide minerals. FEMS Microbiol. Ecol. 2001, 34, 197–206.
29. Fortin D.; Langley, S. Formation and occurrence of biogenic iron-rich minerals. Earth Sci. Rev.
2005, 72, 1–19.
30. Jang, J.H.; Dempsey, B.A.; Catchen, G.L.; Burgos, W.D. Effects of Zn(II), Cu(II), Mn(II), Fe(II),
NO3−, or SO42− at pH 6.5 and 8.5 on transformation of hydrous ferric oxide (HFO) as evidenced
by Mössbauer spectroscopy. Colloids Surf. A 2003, 22, 55–68.
31. Regenspurg, S.; Brand, A.; Peiffer, S. Formation and stability of schwertmannite in acidic mining
lakes. Geochim. Cosmochim. Acta 2004, 68, 1185–1197.
32. Schwertmann, U.; Taylor, R.M. The influence of silicate on the transformation of lepidocrocite to
goethite. Clays Clay Miner. 1972, 20, 159–164.
33. Bigham, J.M.; Schwertmann, U.; Traina, S.J.; Winland, R.L.; Wolf, M. Schwertmannite and the
chemical modeling of iron in acid sulfate waters. Geochim. Cosmochim. Acta 1996, 60, 2111–2121.
34. Jönsson, J.; Persson, P.; Sjöberg, S.; Lövgren, L. Schwertmannite precipitated from acid mine
drainage: Phase transformation sulphate release and surface properties. Appl. Geochem. 2005, 20,
179–191.
35. Schwertmann, U.; Carlson, L. The pH dependent transformation of schwertmannite to goethite at
25 °C. Clay Miner. 2005, 40, 63–66.
36. Schwertmann, U.; Bigham J.M.; Murad, E. The first occurrence of schwertmannite in a natural
stream environment. Eur. J. Miner. 1995, 7, 546–552.
37. Yu, J.Y.; Heo, B.; Choi, I.K.; Cho, J.P.; Chang, H.W. Apparent solubilities of schwertmannite and
ferrihydrite in natural stream waters polluted by mine drainage. Geochim. Cosmochim. Acta 1999,
63, 3407–3416.
38. Kawano, M.; Tomita, K. Geochemical modeling of bacterially induced mineralization of
schwertmannite and jarosite in sulfuric acid spring water. Am. Miner. 2001, 86, 1156–1165.
39. Fukushi, K.; Sasaki, M.; Sato, T.; Yanase, N.; Amano, H.; Ikeda, H. A natural attenuation of
arsenic in drainage from an abandoned arsenic mine dump. Appl. Geochem. 2003, 18, 1267–1278.
Minerals 2014, 4
190
40. Liao, Y.; Zhou, L.; Liang, J.; Xiong, H. Biosynthesis of schwertmannite by Acidithiobacillus
ferrooxidans cell suspensions under different pH condition. Mater. Sci. Eng. C 2009, 29, 211–215.
41. Liao, Y.; Zhou, L.; Bai, S.; Liang, J.; Want, S. Occurrence of biogenic schwertmannite in sludge
bioleaching environments and its adverse effect on solubilization of sludge-borne metals.
Appl. Geochem. 2009, 24, 1739–1746.
42. Majzlan, J.; Navrotsky, A.; Schwertmann, U. Thermodynamics of iron oxides: Part III. Enthalpies
of formation and stability of ferrihydrite (Fe(OH)3), schwertmannite (FeO(OH)3/4(SO4)1/8) and
ε-Fe2O3. Geochim. Cosmochim. Acta 2004, 68, 1049–1059.
43. Pisapia, C.; Humbert, B.; Chaussidon, M.; Mustin, C. Perforative corrosion of pyrite enhanced by
direct attachment of Acidithiobacillus ferrooxidans. Geomicrobiol. J. 2008, 25, 261–273.
44. Southam, G.; Beveridge, T.J. Examination of lipopolysaccharide (O-Antigen) populations of
Thiobacillus ferrooxidans from two mine tailings. Appl. Environ. Microbiol. 1993, 59, 1283–1288.
45. Hollings, P.; Hendry, M.J.; Nicholson, R.V.; Kirkland, R.A. Quantification of oxygen consumption
and sulphate release rates for waste rock piles using kinetic cells: Cluff lake uranium mine,
northern Saskatchewan, Canada. Appl. Geochem. 2001, 16, 1215–1230.
46. Nichol, C.; Smith, L.; Beckie, R. Field-scale experiments of unsaturated flow and solute transport
in a heterogeneous porous medium. Water Resour. Res. 2005, 41, 1–11.
© 2014 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article
distributed under the terms and conditions of the Creative Commons Attribution license
(http://creativecommons.org/licenses/by/3.0/).