Download Assessing the use of Quantitative Light

Photodiagnosis and Photodynamic Therapy 13 (2016) 34–39
Contents lists available at ScienceDirect
Photodiagnosis and Photodynamic Therapy
journal homepage: www.elsevier.com/locate/pdpdt
Assessing the use of Quantitative Light-induced Fluorescence-Digital
as a clinical plaque assessment
Sun-Young Han a,b , Bo-Ra Kim a , Hae-Youn Ko a , Ho-Keun Kwon a , Baek-Il Kim c,∗
a
Department of Preventive Dentistry & Public Oral Health, Brain Korea 21 PLUS Project, Yonsei University College of Dentistry, Seoul, Republic of Korea
Department of Dental Hygiene, Yonsei University Wonju College of Medicine, Wonju, Republic of Korea
Department of Preventive Dentistry & Public Oral Health, Oral Science Research Center, Brain Korea 21 PLUS Project, Yonsei University College of
Dentistry, Seoul, Republic of Korea
b
c
a r t i c l e
i n f o
Article history:
Received 17 September 2015
Received in revised form
12 November 2015
Accepted 7 December 2015
Available online 9 December 2015
Keywords:
Fluorescence
Mature plaque
Quantitative Light-induced
Fluorescence-digital
a b s t r a c t
Background: The aims of this study were to compare the relationship between red fluorescent plaque (RF
plaque) area by Quantitative Light-induced Fluorescence-Digital (QLF-D) and disclosed plaque area by
two-tone disclosure, and to assess the bacterial composition of the RF plaque by real time-PCR.
Methods: Fifty healthy subjects were included and 600 facial surfaces of their anterior teeth were examined. QLF-D was taken on two separate occasions (before and after disclosing), and the RF plaque area was
calculated based on Plaque Percent Index (PPI). After disclosing, the stained plaque area was analyzed to
investigate the relationship with the RF plaque area. The relationship was evaluated using Pearson correlation and paired t-test. Then, the RF and non-red fluorescent (non-RF) plaque samples were obtained
from the same subject for real-time PCR test. Total 10 plaque samples were compared the ratio of the 6
of bacteria using Wilcoxon signed rank test.
Results: Regarding the paired t-test, the blue-staining plaque area (9.3 ± 9.2) showed significantly similarity with the RF plaque area (9.1 ± 14.9, p = 0.80) at R20, however, the red-staining plaque area
(31.6 ± 20.9) presented difference from the RF plaque area (p < 0.0001). In addition, bacterial composition of Prevotella intermedia and Streptococcus anginosus was associated with substantially more the RF
plaque than the non-RF plaque (p < 0.05).
Conclusions: The plaque assessment method using QLF-D has potential to detect mature plaque, and the
plaque area was associated with the blue-staining area using two-tone disclosure.
© 2015 Elsevier B.V. All rights reserved.
1. Introduction
Detection of old plaque in oral cavity has distinct advantages to
caution against oral disease. Old and mature plaque cause oral disease and it could be a sign to notify risk of oral disease. However,
young plaque do not immediately affect patients’ oral disease. Twotone disclosing agent was developed to distinguish old and young
plaque due to the result of diffusion phenomenon of active ingredient [1,2]. It has been frequently used in dental clinic for old plaque
assessment. However, plaque disclosures have some limitations of
which they cannot selectively disclose only plaque, but dye soft
debris and pellicle as well [3]. Also, it needs time to remove the
plaque at the chair side. Another method of measurement for old
∗ Corresponding author: Department of Preventive Dentistry & Public Oral Health,
Yonsei University College of Dentistry, 50 -1 Yonsei-ro, Seodaemun-Gu, Seoul 03122,
Republic of Korea. Fax: +82 2 392 2926.
E-mail address: [email protected] (B.-I. Kim).
http://dx.doi.org/10.1016/j.pdpdt.2015.12.002
1572-1000/© 2015 Elsevier B.V. All rights reserved.
plaque is Silness & Löe plaque index [4]. This index has been developed for grading of plaque thickness. However, it is also relatively
time consuming and the result may be influenced by the examiner’s
subjective decision [5].
Quantitative Light-induced Fluorescence-Digital (QLF-D
BilluminatorTM , Inspektor Research Systems BV, Amsterdam, The
Netherlands) is a novel dental diagnostic tool which is based on
the autofluorescence of teeth. It is the updated version of the first
product, the QLF device (InspektorTM Pro, Inspektor Research Systems BV, Amsterdam, The Netherlands), and it is able to get more
clear plaque image in red using improved filter set (D007; Inspektor Research Systems BV, Amsterdam, The Netherlands). When a
tooth with plaque is excited by a visible light of 405 nm from the
QLF, red fluorescence were shown on the plaque accumulation
area [6,7], and the QLF was able to detect and quantify the area.
Previous studies have shown that mature plaque may produce red
auto-fluorescence and it is associated with products of microbe
metabolism which are called porpyrins [5,6]. The porphyrins are
known to be produced from late colonizing oral bacteria, such
S.-Y. Han et al. / Photodiagnosis and Photodynamic Therapy 13 (2016) 34–39
as Porphyromonas gingivalis and Prevotella intermedia which are
usually found in heavily accumulated plaque [8]. A recent study
reported that the intensity of red fluorescence of plaque which
aged in different concentrations of sucrose had a relationship with
low pH and cariogenic plaque [7]. Nevertheless, there is still lack
of clinical studies on the characteristics of the RF plaque and its
potential pathogenicity.
The prevalence of microorganisms can be investigated using the
16s-rRNA-based polymerase chain reaction (PCR) method. The PCR
method has been known that it is the most sensitive and rapid
method [9], and real-time PCR using the LightCyclerTM system is
useful to detect and quantify bacteria in clinical samples [10].
To increase the utility of the QLF-D into dental clinic, more
studies are required. Therefore, the aims of this study were to evaluate the quantification method of the RF plaque area by QLF-D can
replace existing old plaque assessment method by two-tone disclosure, and to compare of bacterial composition ratio between the
RF and non-fluorescent plaque (non-RF plaque) by real-time PCR
test in vivo.
2. Materials and methods
2.1. Subjects
Ethical approval was obtained from the Yonsei University Dental Hospital (IRB No: 2-2012-0045). This study was performed
from December 2012 to June 2013. This study was conducted in
accordance with the Helsinki Declaration of 1975, as revised in
2000. Total 50 participants through clinical trial recruitment were
included, with a mean age of 34.6 years (±11.3). Inclusion criteria were that the participants have sound anterior teeth with good
general health. Volunteer who had stained teeth or dental caries
region were excluded. Informed consent was given when the participants visited for this study. They were asked to refrain from any
oral hygiene behavior and food intake for at least 4 h before visiting.
2.2. Quantitative Light-induced Fluorescence-digital examination
Intra-oral photographs with QLF-D were taken on two occasions
before and after disclosing procedure with disclosing solution (2ToneTM , Young Dental, Earth City, USA). Facial surface of upper and
lower anterior teeth were taken with edge to edge bite. The tooth
surfaces were dried before photographing. Two different images, a
QLF image and a white light image, were captured at one shooting
with a digital SLR camera (model 550D, Canon, Tokyo, Japan) using
following condition: shutter speed of 1/30 s (QLF image) and 1/50 s
(white light image), aperture value of 5.6 (QLF image) and 8.0 (white
light image), focal length of 0.32 mm, and ISO speed of 1600. The
camera was vertically placed on the facial surface. The images were
automatically stored by default as a bitmap image (BMP). To reduce
ambient light, we covered the cone of the QLF-D with a blackout
fabric.
2.3. Image analysis of the plaque area
Among 600 anterior teeth, 170 teeth (28.3%) showing the
stained plaque in blue (blue plaque) with the disclosing agent when
an examiner observed with naked eyes, were selected to investigate
the relationship of the plaque area between the RF plaque and the
disclosed plaque. Plaque area from the plaque images was revealed
as Plaque Percent Index (PPI). The index was calculated by the
pixel number of tooth and covered plaque area based on planimetric method [11,12]. The QLF image of the RF plaque was analyzed
using proprietary software (QA2 v1.21, Inspektor Research Systems
BV, Amsterdam, The Netherlands) (Fig. 2(E)). The software provides
35
pixel numbers of whole tooth area and intensities of red fluorescence as the thirteen threshold levels (from R0 to R120). As
increasing the threshold level, it means that fluorescence intensity is getting stronger. For example, R30 means that at least 30%
of redness difference with respect to that of sound teeth is exist
between the plaque and the tooth [13], and R120 is the strongest
red intensity of the plaque. And white light image of the disclosed
plaque was analyzed using image analysis software (Image-Pro
PLUS, Media Cybernetics, MD, USA). An outline was drawn using an
irregular AOI options (Fig. 2(A)–(D)). Then the tap called ‘count &
measure object’ and ‘select colors’ on manual options were used to
adjust color-range within histogram base. The images were generated using a function which displays the value of the red, green, and
blue channel (RGB). The red and blue values in the histogram were
fixed as 255 and the value of green was adjusted to find thresholds of a border line of the red- and blue-staining plaque. When
the red-staining plaque area was selected, the blue-staining area
was included. Forty teeth were randomly selected and analyzed
to decide the optimum thresholds which could be determined as
acceptable on visual assessment by a single examiner. The final
threshold was decided as 49 for a border line of the stained plaque
in red (red plaque) and 29 for that of the blue plaque. Examiner then
transferred it to an Excel spreadsheet to calculate the PPI (PPIRF ,
PPIred , and PPIblue ). All analysis was performed by a single examiner.
2.4. Real-time PCR test
To investigate the characteristics of the bacterial composition of
the RF plaque, real-time PCR test was performed. Among 50 participants, the plaque samples from 10 subjects (20%) were collected.
Plaque emitting red fluorescence was collected as the RF plaque
sample. And if the plaque was dyed and did not show red fluorescence, it was collected as the non-RF plaque sample to compare of
the bacterial composition. The RF and the non-RF plaque samples
were obtained from different teeth of the same subject.
The test was performed according to the manufacturer’s instructions. Plaque samples were collected from subject’s anterior teeth
using sterilized dental probe. The samples were put into a 1.5 ml
tube containing 1 ml sterilized distilled water then they were stored
in a freezer at −70 ◦ C as soon as possible until their use. Whole
genomic DNA was extracted using DNeasy Blood & Tissue kit (Quagen, Chatsworth, CA, USA). Then isolated DNA was quantified by
Spectrophotometer (Nanodrop ND-1000; NanoDrop Technologies,
DE, USA). Real-time PCR amplification reactions were carried out
using Master mixture of 1 ␮l DNA. The Master mixture used in this
study was Light Cycler 480 SYBR Green (Roche Diagnostics, Basel,
Switzerland) with LC480II(Roche, Basel, Switzerland). The following bacteria were studied: Streptococcus mutans [14], Lactobacillus
casei [15], Actinomyces israelii [16], Streptococcus anginosus [17], P.
gingivalis [18], and P. intermedia [19].
The condition for initial denaturation of six bacteria was at 95 ◦ C
for 10 min. 50 polymerase chain reaction method cycles were as
follows; P. gingivalis, S. mutans : 50 cycles of 95 ◦ C for 20 s, 58 ◦ C
for 20 s, and 72 ◦ C for 20 s, and A. israelii, L. casei, P. intermedia, S.
anginosus and total bacteria: 50 cycles of 95 ◦ C for 20 s, 50 ◦ C for
20 s, and 72 ◦ C for 20 s. After the amplification, melting curve analysis was performed to identify whether the real-time PCR reaction
ordinarily was done.
To compare bacterial compositions between the RF and the
non-RF plaque, relative quantification was performed. The result
expressed as Ct which is the number of cycle passed threshold to
detect the mRNA. To normalize the value, we carried out Ct (target
mean C—reference mean Ct ). Higher Ct means lower expression of mRNA. Each Ct of the samples was used to compare the
36
S.-Y. Han et al. / Photodiagnosis and Photodynamic Therapy 13 (2016) 34–39
Table 1
Relationship between stained plaque area and the RF plaque (N = 170).
Plaque area
RF plaque by QLF-D
Red stained plaque
Blue stained plaque
9.1 (14.9)
31.6 (20.9)
9.3 (9.2)
Table 2
Species-specific primers and probes for real-time PCR.
p-valuea
<0.0001
0.795
Paired t-test. Data are shown as% (SD).
RF plaque, red fluorescent plaque.
a
Data denote the result compared with the RF plaque area.
mRNA amount. For this analysis, LightCycler 480 software (LCS480
1.5.0.39, Roche Applied Science, Mannheim, Germany) was used.
Target
Sequence (5 –3 )
Product size (bp)
S. mutans
GCCTACAGCTCAGAGATGCTATTCT
GCCATACACCACTCATGAATTGA
AGTAGGACGCACAGTTTAT
AGCATCTAACATGTGTTAC
CTATAAGTAAGCTTTGATCCGGAGATTT
CTTCCTGCGGGTACTGAGATGT
TGAGTAACACGTGAGTAACC
CCAAAAACACCACAAAAGTG
TACCCATCGTCGCCTTGGT
CGGACTAAAACCGCATACACTTG
AATACCCGATGTTGTCCACA
TTAGCCGGTCCTTATTCGAA
114
S. anginosus
L. casei
A. israelii
P. gingivalis
P. intermedia
155
134
125
126
340
2.5. Data analysis
Pearson correlation coefficient and paired t-test were tested to
compare of plaque area between the RF plaque and the disclosed
plaque (blue and red plaque). In comparison of the mRNA amount
of the 6 bacteria between the RF and the non-RF plaque, data
was tested using Wilcoxon-signed rank test using PASW Statistics
ver.18.0 (SPSS, Chicago, IL, USA) (˛ = 0.05).
3. Results
3.1. Comparison of plaque area between RF plaque and disclosed
plaque
Table 3
Comparison of relative quantity of the 6 bacteria between RF and non-RF plaque
samples (N = 10).
RF plaque
S. mutans
S. anginosus
L. casei
A. israelii
P. gingivalis
P. intermedia
14.82
11.47
4.47
11.64
11.12
15.69
±
±
±
±
±
±
5.60
7.49
5.26
5.77
3.32
8.29
non-RF plaque
14.03
16.30
5.76
13.91
12.83
19.33
±
±
±
±
±
±
3.86
6.87
4.19
5.83
3.60
6.13
p-value
0.575
0.017
0.103
0.114
0.093
0.028
Wilcoxon signed rank test. Data are shown as Ct; mean ± SD.
4. Discussion
As a result of the correlation analysis, the PPIRF shows that higher
correlation with the blue plaque area (PPIblue ) than that with the red
plaque area (PPIred ) at the every R levels (Fig. 1). The correlation
coefficient of the PPIblue was gradually increasing as the level of R
is getting higher. The correlation of the PPIred , on the other hand,
shows gradually decreasing tendency. Scatterplot matrix demonstrated that the PPIblue was observed slightly linear distribution, on
the other hand, there was no linear association in the PPIred (Fig. 3).
Regarding the paired t-test, the PPIred was significantly different
from the PPIRF at R20 (p < 0.0001), however, the PPIblue presented
similarity with the PPIRF at R20 (p = 0.80) (Table 1).
3.2. Comparison of bacterial composition ratio between RF
plaque and non-RF plaque
The sequences of primers were shown in Table 2. Regarding the
Wilcoxon-signed rank test, P. intermedia and S. anginosus in the RF
plaque shows significantly more amount than that in the non-RF
plaque (Table 3, p < 0.05). Although there was no statistical difference, A. israelii and P. gingivalis showed more amount in the RF
plaque than that in the non-RF plaque. S. mutans and L. casei, which
are known not emitting red fluorescence, were also observed in the
RF plaque with similar amount to the non-RF plaque.
Fig. 1. Correlation between the RF plaque area and the disclosed plaque area.
In this study, the characteristics of the RF plaque were investigated with two experimental approaches. The one was the clinical
approach by comparing with a representative disclosing method.
The other one was molecular biological analysis of dental biofilm.
First, it was observed that the RF plaque area was significantly similar with blue plaque area by two-tone agent. The area of the RF
plaque demonstrated a higher correlation with the area of blue
plaque than that of red plaque (Fig. 1). Second, the RF plaque was
compared with non-RF plaque in real-time PCR test. At the results
of assessing the composition ratio of each 6 bacterial species associated with dental caries and/or periodontal disease, the Ct value in
the RF plaque was lower than that in the non-RF plaque except for in
S. mutans. In particular, P. intermedia and S. anginosus showed a significant difference between two plaque samples (Table 3, p < 0.05).
Red auto-fluorescence from endogenous porphyrins emitted
with a wavelength of 405 nm has been observed in old and mature
plaque [5,6,8,20]. Kim et al. reported that the red fluorescence of
dental microcosm biofilm was observed from the 3rd day, and
the intensity of the RF was increased over time [20]. The authors
demonstrated that the aciduric bacterial CFUs and the severity of
demineralization were increased with maturation of biofilm. Red
auto-fluorescence is also observed in carious lesions even though
cariogenic species have been known that they might do not fluoresce red [7,21,22]. Coulthwaite et al. [6] explained the reason that
mature plaque may play role as harbors of plaque. Hence, the bacteria which do not fluoresce red could be observed in the RF plaque.
The QLF-D, therefore, can be used as a detecting device to distinguish between pathological region and healthy tooth surface by
assessing the red fluorescence. With this context, QLF system can
substitute for conventional staining procedure with two-tone disclosure to find old plaque. The QLF-D device can capture two images
(QLF image and white light image), and it can compare between
before and after oral hygiene care. Furthermore, it will be leading
to not only reduction of time to remove disclosing parts but also
patient’s compliance for oral health instruction.
In comparison on the plaque area, the area of the RF plaque
demonstrated a higher correlation with the blue plaque area than
S.-Y. Han et al. / Photodiagnosis and Photodynamic Therapy 13 (2016) 34–39
37
Fig. 2. Image analysis procedure of the stained plaque on the tooth surface (A) outlining (B) selected tooth surface area (C) selected red stained plaque area (D) selected blue
stained plaque area (E) RF plaque area with QLF-D.
Fig. 3. Scatterplot matrix of red (A) and blue (B) stained plaque area with the RF plaque area at the highest correlation threshold. (For interpretation of the references to
color in this figure legend, the reader is referred to the web version of this article.)
red plaque area. As redness intensity was rising, the correlation
coefficient with blue plaque was improved. The highest correlation
with blue plaque was shown at the PPI of R110 (r = 0.62, p < 0.01).
This result was in accordance with previous studies which reported
a relation between the RF and maturation of plaque [5,6]. However,
the PPI of the RF plaque at R110 was only 4.4% respect to the tooth
surface area, and it was not similar with blue plaque area in the
paired t-test. On the other hands, the PPI of the RF plaque at R20
showed the similarity as 9.1% with the blue plaque area. Regarding
the paired t-test results, we chose the R20 as criteria for detecting
old plaque assessment then the PPI at the R20 was presented in
Table 1.
There is lack of study comparing the RF plaque and disclosed
plaque by two-tone agent. Early study which used a previous
version of QLF system demonstrated that the QLF plaque analysis was a reliable technique but auto-fluorescing plaque volume
is not related to total plaque volume [5]. In the study, however,
authors compared between the RF plaque and disclosed plaque
using a single type of disclosing agent. The other study was conducted to assess the relationship between the RF plaque and
dark-blue stained plaque [23]. The result showed that width of
red-fluorescing plaque had high correlation with that of dark-blue
stained plaque (rho = 0.61, p < 0.001). This study, however, measured plaque using an ordinal scale based on Quigley–Hein plaque
index and did not consider relationship with red stained plaque
38
S.-Y. Han et al. / Photodiagnosis and Photodynamic Therapy 13 (2016) 34–39
(young plaque). On the other hand, the present study compared the
previous studies was found more information according to comparing the RF plaque at 13 threshold levels of red intensity with young
and old plaque due to continuous scale and image analysis.
In comparison of composition of bacteria, relative quantity of
P. intermedia and S. anginosus in the RF plaque was significantly
larger than that in the non-RF plaque (Table 3, p < 0.05). More L.
casei, A. israelii, P. gingivalis were existed in the RF plaque (p > 0.05),
however the p-values of A. israelii and P. gingivalis were much
smaller (p = 0.114 and 0.093, respectively) than that of L. casei
(p = 0.103). On the other hand, relative quantity of S. mutans showed
that there was no difference between in the non-RF plaque and
in the RF plaque (p = 0.575). As results, there were substantially
more bacterial species except for S. mutans in the RF plaque than
in the non-RF plaque, including the caries pathogens. The common caries pathogens, Lactobacilli and Streptococci, are known
that they do not show red fluorescence [24]. As a pilot study,
the result of real-time PCR test in this study was investigated a
potential of the QLF system for assessing old plaque. Therefore, further studies are required with increasing the number of bacteria
species.
The RF plaque has been known to be composed of bacteria which
are usually found in mature plaque, such as anaerobic bacteria [6,8].
P. gingivalis, P. intermedia and Fusobacterium nucleatum was mainly
found in mature plaque and they are considered as a pathogenic
microbiota related in periodontal disease [25]. A. israelii concerned
in early periodontitis and root caries has been frequently found in
heavy and mature plaque [6]. These species have been detected on
supragingival plaque even if it was not associated with the presence
of active dental caries [26]. In one of the early studies, the authors
concluded that when the thickness of biofilm increases with aging,
increased intensity of the red fluorescence was observed by QLF
[8]. They reported that Actinomyces odontolyticus and P. intermedia
revealed a strong red fluorescence, and aerobic bacteria however
did not show red fluorescence. Also, P. gingivalis displayed obligate
red fluorescence when it existed with Peptostreptococcus micros.
And the red fluorescent plaque was comprised 62% of total plaque.
In previous studies, differences in red fluorescence intensity
in vitro were examined due to different cariogenic characteristics [8,27]. Some cariogenic bacteria did not reveal red
auto-fluorescence when they exist as a single species [27]. The
results however revealed that with increasing cariogenicity, intensity of red fluorescence was higher. The authors explained that
this occurred because the cariogenic biofilm is associated with the
production of porphyrin complex. The other study was conducted
revealing higher red fluorescence with increasing maturity [28].
The researchers evaluated the effect of time and biofilm thickness on red fluorescence using in vitro biofilm model. After 7 days,
red fluorescence was observed and the intensity was higher with
increasing thickness of the biofilm (r2 = 0.47, p < 0.001). Thus, diversity of bacteria would be more associated with the intensity of
the red fluorescence rather than the presence of a single bacteria species. It can be explained that why caries pathogens were
detected in the RF plaque in present study. To enhance the utilization of QLF-D in research and clinical environment, further studies
are needed to investigate bacterial species in the RF plaque and its
role. From our results, it was expected that the QLF technology can
be used as a novel method for detecting mature plaque based on
microbial characteristics. In order to do this, further studies using
more various bacterial species are needed.
5. Conclusions
The plaque assessment method using the QLF-D was a clinical
acceptable tool to detect mature plaque. The consists of bacteria
was more associated with the maturity of plaque rather than the
presence of a certain single species, and the plaque area was associated with the blue stained area using two-tone disclosure.
Conflict of interest
The authors declare that they have no conflict of interest.
Acknowledgments
This research was supported by a grant of the Korea Health
Technology R&D Project through the Korea Health Industry Development Institute (KHIDI), funded by the Ministry of Health &
Welfare, Republic of Korea (grant number: HI15C0889).
References
[1] P.L. Block, R.R. Lobene, J.P. Derdivanis, A two-tone dye test for dental plaque, J.
Periodontol. 43 (1972) 423–426 http://dx.doi.org/10.1902/jop.1972.43.7.423.
[2] I.H. Gallagher, S.J. Fussell, T.W. Cutress, Mechanism of action of a two-tone
plaque disclosing agent, J. Periodontol. 48 (1977) 395–396 http://dx.doi.org/
10.1902/jop.1977.48.7.395.
[3] L.P. Lim, F.B. Tay, I.M. Waite, D.E. Cornick, A comparison of 4 techniques for
clinical detection of early plaque formed during different dietary regimes, J.
Clin. Periodontol. 13 (1986) 658–665.
[4] H. Loe, The gingival index, the plaque index and the retention index systems, J.
Periodontol. 38 (1967) 610–616 http://dx.doi.org/10.1902/jop.1967.38.6.610.
[5] I.A. Pretty, W.M. Edgar, P.W. Smith, S.M. Higham, Quantification of dental
plaque in the research environment, J. Dent. 33 (2005) 193–207 http://dx.doi.
org/10.1016/j.jdent.2004.10.017.
[6] L. Coulthwaite, I.A. Pretty, P.W. Smith, S.M. Higham, J. Verran, The
microbiological origin of fluorescence observed in plaque on dentures during
QLF analysis, Caries Res. 40 (2006) 112–116 http://dx.doi.org/10.1159/
000091056.
[7] E.S. Lee, S.M. Kang, H.Y. Ko, H.K. Kwon, B.I. Kim, Association between the
cariogenicity of a dental microcosm biofilm and its red fluorescence detected
by Quantitative Light-induced Fluorescence-Digital (QLF-D), J. Dent. 41 (2013)
1264–1270 http://dx.doi.org/10.1016/j.jdent.2013.08.021.
[8] M.H. van der Veen, R.Z. Thomas, M.C. Huysmans, J.J. de Soet, Red
autofluorescence of dental plaque bacteria, Caries Res. 40 (2006) 542–545
http://dx.doi.org/10.1159/000095655.
[9] A. Ashimoto, C. Chen, I. Bakker, J. Slots, Polymerase chain reaction detection of
8 putative periodontal pathogens in subgingival plaque of gingivitis and
advanced periodontitis lesions, Oral Microbiol. Immunol. 11 (1996) 266–273.
[10] M. Sakamoto, Y. Takeuchi, M. Umeda, I. Ishikawa, Y. Benno, Rapid detection
and quantification of five periodontopathic bacteria by real-time PCR,
Microbiol. Immunol. 45 (2001) 39–44.
[11] N.P. Lang, E. Ostergaard, H. Loe, A fluorescent plaque disclosing agent, J.
Periodontal. Res. 7 (1972) 59–67.
[12] S. Kinoshita, A. Schait, M. Brebou, H.R. Muhlemann, Effects of sucrose on early
dental calculus and plaque, Helv. Odontol. Acta 10 (1966) 134–137.
[13] S.Y. Han, B.R. Kim, H.Y. Ko, H.K. Kwon, B.I. Kim, Validity and reliability of
autofluorescence-based quantification method of dental plaque, Photodiagn.
Photodyn. Ther. 003 (2015) http://dx.doi.org/10.1016/j.pdpdt.2015.10.003.
[14] N. Suzuki, A. Yoshida, Y. Nakano, Quantitative analysis of multi-species oral
biofilms by TaqMan real-time PCR, Clin. Med. Res. 3 (2005) 176–185.
[15] M. Haarman, J. Knol, Quantitative real-time PCR analysis of fecal Lactobacillus
species in infants receiving a prebiotic infant formula, Appl. Environ.
Microbiol. 72 (2006) 2359–2365 http://dx.doi.org/10.1128/AEM.72.4.
[16] C. Jauh-Hsun, T. Vinh, J.K. Davies, D. Figdor, Molecular approaches to the
differentiation of Actinomyces species, Oral Microbiol. Immunol. 14 (1999)
250–256.
[17] K. Kumagai, N. Sugano, M. Takane, H. Iwasaki, H. Tanaka, N. Yoshinuma, et al.,
Detection of Streptococcus anginosus from saliva by real-time polymerase
chain reaction, Lett. Appl. Microbiol. 37 (2003) 370–373.
[18] H. Kato, A. Yoshida, S. Awano, T. Ansai, T. Takehara, Quantitative detection of
volatile sulfur compound- producing microorganisms in oral specimens using
real-time PCR, Oral Dis. 11 (2005) 67–71 http://dx.doi.org/10.1111/j.
[19] H. Maeda, C. Fujimoto, Y. Haruki, T. Maeda, S. Kokeguchi, M. Petelin, et al.,
Quantitative real-time PCR using TaqMan and SYBR Green for Actinobacillus
actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, tetQ
gene and total bacteria, FEMS Immunol. Med. Microbiol. 39 (2003) 81–86.
[20] Y.S. Kim, E.S. Lee, H.K. Kwon, B.I. Kim, Monitoring the maturation process of a
dental microcosm biofilm using the Quantitative Light-induced
Fluorescence-Digital (QLF-D), J. Dent. (2014) http://dx.doi.org/10.1016/j.
jdent.2014.03.006.
[21] R. Heinrich-Weltzien, J. Kuhnisch, M. van der Veen, E. de Josselin de Jong, L.
Stosser, Quantitative light-induced fluorescence (QLF)-a potential method for
the dental practitioner, Quintessence Int. 34 (2003) 181–188.
S.-Y. Han et al. / Photodiagnosis and Photodynamic Therapy 13 (2016) 34–39
[22] A.M. Lennon, W. Buchalla, L. Brune, O. Zimmermann, U. Gross, T. Attin, The
ability of selected oral microorganisms to emit red fluorescence, Caries Res.
40 (2006) 2–5 http://dx.doi.org/10.1159/000088898.
[23] M.H. Van der Veen, Y. Fernandez, M. Mostajo, D.E. Slot, G. van Anraat, G. van
der Weijden, Visual comparison of red-fluorescing and disclosed plaque on
clinical photos, IADR (2012).
[24] K. Koenig, R. Hibst, H. Meyer, G. Flemming, H. Schneckenburger,
Laser-induced autofluorescence of carious regions of human teeth and
caries-involved bacteria, SPIE 2080 (1993) 170–180.
[25] G.A. Van der Weijden, M.F. Timmerman, E. Reijerse, G.N. Wolffe, A.J. Van
Winkelhoff, U. Van der Velden, The prevalence of A. actinomycetemcomitans, P.
gingivalis and P. intermedia in selected subjects with periodontitis, J. Clin.
Periodontol. 21 (1994) 583–588.
39
[26] S. Tanaka, Y. Murakami, K. Seto, K. Takamori, M. Yosida, K. Ochiai, et al., The
detection of Porphyromonas gingivalis, Prevotella intermedia, and Actinobacillus
actinomycetemcomitans in the supragingival plaque of children with and
without caries, Pediatr. Dent. 25 (2003) 143–148.
[27] G. Ferrante, M. Nakano, F. Prati, G. Niccoli, M.T. Mallus, V. Ramazzotti, et al.,
High levels of systemic myeloperoxidase are associated with coronary plaque
erosion in patients with acute coronary syndromes: a clinicopathological
study, Circulation 122 (2010) 2505–2513 http://dx.doi.org/10.1161/
CIRCULATIONAHA.110.955302.
[28] C.M. Volgenant, M.H. van der Veen, J.J. de Soet, J.M. ten Cate, Effect of
metalloporphyrins on red autofluorescence from oral bacteria, Eur. J. Oral Sci.
121 (2013) 156–161 http://dx.doi.org/10.1111/eos.12045.