Download AFLUID June 45/6 - AJP

Structure and activity of OK-GC: a kidney receptor
guanylate cyclase activated by guanylin peptides
ROSLYN M. LONDON,2 SAMMY L. EBER,1,2 SANDHYA S. VISWESWARIAH,4
WILLIAM J. KRAUSE,3 AND LEONARD R. FORTE1,2
1Harry S. Truman Memorial Veterans Hospital and Departments of 2Pharmacology,
and 3Pathology and Anatomical Sciences, School of Medicine, Missouri University,
Columbia, Missouri 65212; and 4Department of Molecular Reproduction, Development
and Genetics, Indian Institute of Science, Bangalore 560012, India
guanosine 38,58-cyclic monophosphate; uroguanylin; OK cells
GUANYLIN, UROGUANYLIN, and lymphoguanylin are small,
heat-stable peptides that regulate the enzymatic activity of transmembrane guanylate cyclase (GC) signaling
molecules. Guanylin was first isolated as a bioactive,
15-amino acid peptide from rat intestine (4). Uroguanylin was also isolated as bioactive, 13-, 14-, and
15-residue peptides from opossum urine and intestinal
mucosa (21). Both peptides were purified using a
bioassay based on the activation of receptor GCs in
human T84 intestinal cells. Lymphoguanylin was identified by homology cloning of a cDNA from opossum
spleen, which encodes a 109-amino acid precursor
similar to preprouroguanylin and preproguanylin (11).
The costs of publication of this article were defrayed in part by the
payment of page charges. The article must therefore be hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. Section 1734
solely to indicate this fact.
F882
Guanylin and uroguanylin have two intramolecular
disulfide bonds, but lymphoguanylin has only one
disulfide. A synthetic form of lymphoguanylin also
activates T84 and OK cell GCs. This family of guanylin
peptides is similar in structure and biological activity
to heat-stable enterotoxin (ST) peptides secreted by
strains of enteric microorganisms that cause secretory
diarrhea (16). The active guanylin peptides are found
at COOH termini of longer, biologically inactive prohormones (6, 11, 22, 48).
Guanylin, uroguanylin, and ST peptides stimulate
the transepithelial secretion of chloride and bicarbonate anions when administered into the apical (mucosal)
reservoirs of Ussing chambers containing mounted
segments of intestinal mucosa (4, 18, 25, 31). These
peptides also increase the short-circuit current of a
model T84 cell epithelium in a luminal pH-dependent
fashion by stimulating electrogenic chloride secretion
(4, 20, 21). Physiological roles for the endogenous
guanylin peptides are postulated to include the regulation of salt and water secretion during digestion, as
well as neutralization of HCl in the duodenum and of
organic acids derived from enteric bacteria in the large
intestine (20, 25). Control of these intestinal functions
by guanylin peptides is mediated via intracellular
cGMP through activation of cGMP-dependent protein
kinase II and/or cAMP-dependent protein kinase II
with subsequent phosphorylation of the cystic fibrosis
transmembrane conductance regulator (CFTR) protein
(15, 25, 40). CFTR and guanylin receptor GCs are
localized together in apical plasma membranes of target enterocytes (12, 32). An intestinal receptor GC has
been identified by molecular cloning of cDNAs encoding
a membrane protein that binds 125I-labeled ST (41), and
this protein also is activated by guanylin peptides and
Escherichia coli ST (4, 11, 21, 41). When this GC gene is
impaired in transgenic mice, a marked reduction in
intestinal secretory responses of suckling mice was
observed (37, 42). However, ⬃10% of specific 125I-ST
binding to receptor sites on intestinal membranes still
remained in GC-C-knockout animals (37). This suggests that an additional gene or multiple genes encoding receptors for guanylin peptides and ST exist in the
mouse genome.
Bacterial STs were the first peptides shown to activate receptor-like GC signaling molecules in mammalian models, thus stimulating intestinal secretion via
cGMP and causing secretory (i.e., traveler’s) diarrhea
(9, 23). Our subsequent finding that E. coli ST also
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.247 on June 16, 2017
London, Roslyn M., Sammy L. Eber, Sandhya S.
Visweswariah, William J. Krause, and Leonard R. Forte.
Structure and activity of OK-GC: a kidney receptor guanylate
cyclase activated by guanylin peptides. Am. J. Physiol. 276
(Renal Physiol. 45): F882–F891, 1999.—Uroguanylin, guanylin, and lymphoguanylin are small peptides that activate
renal and intestinal receptor guanylate cyclases (GC). They
are structurally similar to bacterial heat-stable enterotoxins
(ST) that cause secretory diarrhea. Uroguanylin, guanylin,
and ST elicit natriuresis, kaliuresis, and diuresis by direct
actions on kidney GC receptors. A 3,762-bp cDNA characterizing a uroguanylin/guanylin/ST receptor was isolated from
opossum kidney (OK) cell RNA/cDNA. This kidney cDNA
(OK-GC) encodes a mature protein containing 1,049 residues
sharing 72.4–75.8% identity with rat, human, and porcine
forms of intestinal GC-C receptors. COS or HEK-293 cells
expressing OK-GC receptor protein were activated by uroguanylin, guanylin, or ST13 peptides. The 3.8-kb OK-GC mRNA
transcript is most abundant in the kidney cortex and intestinal mucosa, with lower mRNA levels observed in urinary
bladder, adrenal gland, and myocardium and with no detectable transcripts in skin or stomach mucosa. We propose that
OK-GC receptor GC participates in a renal mechanism of
action for uroguanylin and/or guanylin in the physiological
regulation of urinary sodium, potassium, and water excretion. This renal tubular receptor GC may be a target for
circulating uroguanylin in an endocrine link between the
intestine and kidney and/or participate in an intrarenal
paracrine mechanism for regulation of kidney function via
the intracellular second messenger, cGMP.
OK-GC: KIDNEY UROGUANYLIN RECEPTOR
EXPERIMENTAL PROCEDURE
RT-PCR amplification of a kidney uroguanylin receptor GC.
Total RNA was extracted from various opossum tissues using
the RNEasy Kit (Qiagen, Chatsworth, CA). Total RNA from
opossum kidney (3–5 µg) was reverse transcribed with oligo(dT)18 primer using the Superscript II RNase H-Reverse
Transcriptase kit (GIBCO-BRL; Life Technologies, Gaithersburg, MD). The cDNAs were then used for PCR reactions
employing the protocol recommended in the instructions with
the Superscript II kit. The PCR amplification reaction conditions were as follows: denaturation at 93°C for 5 min; then 30
cycles consisting of 93°C for 1 min, 59°C for 1 min and 72°C
for 1.5 min, and then an extension period at 72°C for 10 min.
A set of primers [GAAACCCTTCCGCCCAGAT and ACG(A)TACTTAAAGGGAAGAGG] was used to amplify a segment of the opossum GC-C kinase-catalytic domain (nucleotides 2155–3130) mRNA/cDNA (8).
RACE-PCR. A 0.9-kb portion of an opossum kidney uroguanylin receptor GC (8) amplified by RT-PCR was extended in
the 38 and 58 direction using rapid amplification of cDNA ends
(RACE)-PCR. For 38-RACE-PCR, total RNA was reverse
transcribed as described above except that an oligo(dT)17
adapter (GACTCGAGTCGACATCGA) was used as the primer.
The cDNAs were then amplified with a gene-specific primer
(GAAACCCTTCCGCCCAGAT) and the adapter primer
(GACTCGAGTCGACATCGA) using the conditions described
above. The PCR product was cloned into pCR II, sequenced,
and analyzed as previously described (36). For 58-RACE-PCR,
total RNA was reverse transcribed with a gene-specific primer
(CAGTCAAAACAACGAGAGTT or CTGATGGAACCTTTATGGAT), the cDNA was purified with a G-50 spin column,
and then it was dA-tailed using terminal deoxyribonucleotidyltransferase (Boehringer Mannheim, Indianapolis, IN). The
dA-tailed cDNA was then amplified using a second genespecific primer (CAACGGATGAAAAGGA or CTATTCAGAGGAATGTTTCTGG) and the oligo(dT)17 adapter and adapter
primer. The PCR product was then cloned into pCRII and
sequenced.
Northern analysis of receptor mRNA expression. Total RNA
(40 µg) from various opossum tissues were fractionated on a
1% agarose gel containing formaldehyde and then transferred to nylon membranes. The membranes were hybridized
with a cDNA representing portions of the ligand-binding
domain (nucleotides 130–631) and ligand-binding and kinasehomology domains (nucleotides 916–1810), which were labeled with [␣-32P]dCTP by the random priming method
(Boehringer Mannheim). A human ␤-actin cDNA (HHCI89;
American Type Culture Collection, Rockville, MD) was also
used in the hybridization to estimate RNA loading; however,
this probe bound to two sizes of mRNA transcript (36). Total
RNA from three different animals was examined on three
separate blots, with the blots being hybridized twice with
each probe.
The membranes were prehybridized for 1–3 h at 68°C with
QuickHyb solution (Stratagene, La Jolla, CA), then hybridized for a further 14–16 h at 68°C with 1 ⫻ 106 cpm of labeled
cDNA per milliliter of QuickHyb solution. The blots were
washed twice with 2⫻ SSC/0.1% SDS at room temperature
followed by a 5- to 15-min wash with 0.2⫻ SSC/0.1% SDS at
60°C. Blots were exposed to film at ⫺80°C with an intensifying screen from 3–72 h.
OK-GC expression. Specific primers were designed to amplify the entire ORF of the opossum kidney uroguanylin
receptor and portions of the 38- and 58-untranslated regions
(UTR) (nucleotides 37–3415). The PCR product was verified
as the cDNA encoding the opossum kidney receptor by
nucleotide sequence analysis, before ligation into a mammalian expression vector pcDNA3.1/V5/His-TOPO (Invitrogen,
San Diego, CA).
For transient transfection, COS-1 cells (1.35 ⫻ 106 cells in
150-mm dishes), maintained in DMEM with 10% FBS, 100
U/ml of penicillin, and 100 µg/ml of streptomycin, were
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.247 on June 16, 2017
stimulates receptor GCs found on OK (opossum kidney)
and PTK-2 (potoroo kidney) cell lines as well as in the
opossum kidney revealed a broader physiological role
for this class of cell surface receptors (13). ‘‘ST receptors’’ also were found in other epithelia in addition to
the receptors localized to brush-border membranes
(BBM) of epithelial cells lining the intestinal tract and
within renal tubules (8, 14, 30, 47). The renal ‘‘ST
receptor’’ predicted the existence of endogenous ST-like
peptides that activate this enzyme, which led to the
isolation of uroguanylin from urine (7, 21, 26). Uroguanylin is the major bioactive peptide found in urine,
which contains very small amounts of bioactive guanylin (7, 21, 26, 38). Thus uroguanylin may regulate the
enzymatic activity of these tubular receptors in vivo.
Uroguanylin or ST stimulates urinary sodium, potassium, and water excretion in both the isolated perfused
rat kidney and in the mouse in vivo (10, 17, 35).
Guanylin has less natriuretic and diuretic potency
compared with either uroguanylin or ST, but guanylin
does elicit a marked kaliuresis in the rat kidney in vitro
(10). Uroguanylin mRNA is most abundant in the small
intestine compared with guanylin mRNA levels, which
peak in the large intestine of rats and mice (2, 36, 46).
Uroguanylin and prouroguanylin are also found in the
circulation, and the gastrointestinal (GI) tract may be a
source of these peptides (6, 38). A natriuretic factor
such as uroguanylin was postulated to exist in the
digestive system as an explanation for the greater
natriuresis elicited by oral compared with intravenous
loads of NaCl (33). The release of a natriuretic hormone
like uroguanylin from the GI tract into the plasma in
response to dietary NaCl may help explain the sustained increase in urinary sodium excretion that occurs
following a high-salt meal (33).
This study investigates the renal mechanism of
uroguanylin action by characterizing the structure and
signaling activity of a membrane GC expressed in OK
cells and in the opossum kidney. A 3,762-bp cDNA was
isolated by molecular cloning and PCR utilizing OK
cells and opossum kidney as sources of kidney mRNA/
cDNA. This OK-GC cDNA contains an open-reading
frame (ORF) encoding a 1,049-residue mature protein
that belongs to a growing family of transmembrane
receptor GC signaling molecules. Transfection and
expression of the OK-GC cDNA in COS cells (Cercopithecus aethiops kidney) and HEK-293 cells (human embryonic kidney) produced a cell surface receptor GC protein that is activated by either uroguanylin, guanylin,
or E. coli ST peptides. The ⬃3.8-kb mRNA encoding
this uroguanylin receptor GC was detected in both the
kidney and OK cells as well as in the mucosa of small
and large intestine.
F883
F884
OK-GC: KIDNEY UROGUANYLIN RECEPTOR
N,N8-methylenebisacrylamide gel and electrophoretically
transferred to a polyvinylidene fluoride membrane (Immobilon; Millipore, Bedford, MD) in 50 mM Tris-glycine buffer, pH
8.5, containing 20% methanol. The membrane was washed
initially with PBS/0.1% Tween 20, then blocked with blocking
reagent for 1 h (Amersham Life Science, Buckinghamshire,
UK). The membrane was rinsed with PBS/0.1% Tween 20
before incubation for 2.5 h at room temperature with the
primary antisera GCC-CTD (a polyclonal antibody for the
COOH-terminal domain of human GC-C) diluted 1:7,500 in
PBS/0.1% Tween 20/0.2% bovine serum albumin. The membrane was washed three times with PBS/0.1% Tween 20, then
incubated with a 1:5,000 dilution of a horseradish peroxidaseconjugated anti-rabbit antibody for 1 h at room temperature
(Amersham). The membrane was washed further three times
with PBS/0.1% Tween 20, and protein bands were detected
using the enhanced chemiluminescence detection system
(ECL; Amersham).
RESULTS
We used 38- and 58-RACE-PCR to extend the structure of a previously isolated cDNA that encodes part of
the kinase homology and catalytic domains of a GC
expressed in OK cells (8). By PCR, we have produced
and cloned the OK-GC receptor cDNA of 3,762 bp that
contains 76 bp of 58-UTR, 3,195 bp of ORF, and 491 bp
of 38-UTR (Fig. 1). A consensus polyadenylation site,
AATAAA, is found at nucleotides 3734–3739 of this
cDNA. The ORF encodes a 1,065-amino acid precursor
protein containing a 16-residue putative signal peptide.
The mature protein (OK-GC) is deduced to be 1,049
amino acids in length. OK-GC is similar to other
membrane GC proteins in having an NH2-terminal,
extracellular agonist-binding domain, a single lipophilic transmembrane region and intracellular kinase
homology, and GC catalytic domains (41). The predicted
mature protein has 10 potential N-linked glycosylation
sites and 8 cysteine residues in the 409-amino acid long
extracellular domain. There are an additional 8 cysteine residues in the 619-amino acid long intracellular
domain. The OK-GC protein appears to be a new
member of the growing family of membrane receptors
for guanylin peptides. OK-GC shares 72.4, 75.8, and
75.0% identity of primary structure with the BBM
receptors for guanylin peptides expressed in the rat,
human, and pig intestine, respectively (Fig. 2; see Refs.
41, 43, 45). Consistent with the high conservation of
primary structure between the catalytic domains of
GCs is the similarity between the OK-GC catalytic
region and guanylin receptors of rat, human, and
porcine intestine, which share 92.2, 94.1, and 95.2%
identity, respectively, with OK-GC (41, 43, 45). The
most highly variable region of membrane receptor GCs
occurs within the NH2-terminal ligand-binding domains of these proteins. The OK-GC protein shares
only 55.4–58.6% identity in this domain compared with
the intestinal receptors for guanylin peptides previously identified in other mammals (41, 43, 45). The
intestinal guanylin/uroguanylin receptors of other mammalian species are more closely related than this,
because the extracellular ligand-binding region of an
intestinal receptor of rats shares 70.1 and 69.9% iden-
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.247 on June 16, 2017
transfected with 22.5 µg of the expression construct
(pcDNA3.1-OK-GC) or with vector alone (pcDNA3.1) using
the Fugene transfection reagent following the manufacturer’s
instruction (Boehringer Mannheim). The cells were harvested 24 h after transfection and reseeded into 24-well
plates (⬃10,000 cells/well) for cGMP accumulation assay.
Cells were allowed to grow a further 72 h before bioassay for
cGMP accumulation in response to guanylin (10 µM), uroguanylin (10 µM), and E. coli ST13 (1 µM).
For stable expression, HEK-293 cells were transfected with
5 µg of pcDNA3.1-OK-GC per 100-mm dish using the Fugene
transfection reagent. The cells were maintained in MEM
Earle’s base with 10% FBS, 1 mM nonessential amino acid, 1
mM pyruvate, 100 U/ml of penicillin, and 100 µg/ml of
streptomycin. On the 4th day, the medium was supplemented
with 400 µg/ml of Geneticin (G418, GIBCO-BRL) to select for
neomycin-resistant clones. The G418 selection was continued
until isolated resistant colonies could be identified and expanded for determining OK-GC expression by cGMP accumulation bioassay (4, 21).
cGMP accumulation bioassay. Transiently transfected
COS-1 cells, stably transfected HEK-293 cells or OK-E cells
in 24-well plates were stimulated with 1 µM synthetic E. coli
ST13 or 10 µM of synthetic opossum guanylin or uroguanylin
(4, 21). In brief, these peptides were diluted in 150 µl DMEM
containing 20 mM HEPES, pH 7.4, and 1 mM IBMX. The cells
were washed with 200 µl DMEM before the addition of the
peptides or media alone. The cells were incubated at 37°C for
40 min. After incubation, the media was removed for later
radioimmunoassay (RIA), the cells washed with 200 µl PBS,
and 200 µl of 3.3% perchloric acid was added to each well to
stop the reaction and extract the cGMP from the cells. The
extract was adjusted to pH 7 with 10 N KOH before 50 µl of
the supernatant was used to measure cGMP by RIA.
Preparation of membranes. BBM preparations were made
from opossum small intestinal mucosa, kidney medulla, and
kidney cortex (1, 14). The tissues were homogenized for 1 min
on ice with an Ultra-Turrax (Tekmar, Cincinnati, OH) in a
solution containing 300 mM mannitol, 12 mM Tris · HCl, pH
7.4, 5 mM EGTA, 1 µM aprotinin, 1 µM leupeptin, 0.1 mM
phenylmethylsulfonyl fluoride (PMSF), and 0.1 µM pepstatin
A (7.5 ml/g tissue). The homogenate was centrifuged at 2,450
g. To the supernatant, 10.5 ml of ice-cold 12 mM MgSO4 was
added, and the solution was stirred constantly on ice for 15
min. The homogenate was centrifuged at 31,000 g, and the
pellet was resuspended in 15 ml of medium containing 20%
glycerol, 300 mM mannitol, 1 mM MgSO4, 1 µM aprotinin, 1
µM leupeptin, 0.1 mM PMSF, 0.1 µM pepstatin A, and 50 mM
Tris, pH 7.5, and stored frozen at ⫺80°C.
Membranes were prepared from confluent T84 and OK
cells, and from COS cells at 72 h posttransfection with
pcDNA3.1-OK-GC or pcDNA3.1. The cells were washed four
times with 10 ml ice-cold PBS and scraped into 1 ml of ice-cold
lysis buffer (50 mM HEPES, pH 7.4, 100 mM NaCl, 5 mM
EDTA, 1 mM dithiothreitol, 2 mM PMSF, 1 µg/ml leupeptin,
and 1 µg/ml aprotinin). The cells were disrupted by sonication
and centrifuged for 1 h at 4°C and 15,000 g. The cell pellet
was suspended by homogenization in 250 µl of buffer (50 mM
HEPES, pH 7.4, 10 µg/ml leupeptin, and 10 µg/ml aprotinin)
and stored at ⫺80°C.
Western analysis of receptor protein expression. Membrane
protein concentrations were estimated using the Bradford
protein assay (3). Fifty micrograms of kidney or intestinal
BBMs and 150 µg of membranes from cultured cells were
resuspended in sample buffer containing ␤-mercaptoethanol
and boiled for 3 min prior to SDS-PAGE. The solubilized
proteins (20 µl) were separated on a 7.5% acrylamide, 0.65%
OK-GC: KIDNEY UROGUANYLIN RECEPTOR
F885
tity with a corresponding domain in the intestinal
receptors of human and pig intestine, respectively (41,
43, 45). Thus OK-GC may represent a distinct subtype
of receptor GC within the emerging family of cellsurface receptor signaling molecules that interact with
and are controlled by the guanylin peptides.
The expression of OK-GC mRNA was examined in
tissues from opossums using Northern assays with
OK-GC cDNAs as the hybridization probes (Fig. 3). An
⬃3.8-kb mRNA was observed in total RNA preparations isolated from the kidney, OK cells, urinary bladder, adrenal gland, heart, and intestinal mucosa indicating that the 3,762-bp OK-GC cDNA clone that we
isolated represents most of the OK-GC mRNA. The
subclonal cell line, OK-E, and the wild-type OK cell line
both express high levels of OK-GC mRNA, as does the
renal cortex of opossums. Lower levels of OK-GC
mRNA were detected in the corticomedullary junction
and medullary regions of kidney. Other tissues with
relatively low levels of OK-GC mRNA are the urinary
bladder, adrenal gland, and both the ventricle and atria
of heart. In the GI tract, high levels of OK-GC mRNA
were observed in the mucosa of duodenum, jejunum,
and ileum of small intestine and in the cecum and
colon. OK-GC mRNA was not detected in the stomach
mucosa and skin. Thus OK-GC mRNA is highly ex-
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.247 on June 16, 2017
Fig. 1. Nucleotide and deduced amino acid sequence of OK-guanylate cyclase (GC) receptor. Cloned OK-GC
receptor consists of 76 bp of 58-untranslated region (UTR), 3,195 bp of open-reading frame (ORF), and 491 bp of
38-UTR, producing a deduced membrane receptor GC of 1,049 amino acids. Predicted signal peptide is in boldface
lowercase letters. Amino acids are numbered beginning at the signal cleavage site (arrow). Predicted transmembrane domain is shown with the long overbar, the potential N-linked glycosylation sites are indicated with the bold
underscore, and cysteine residues are indicated with the doubled underscore. Polyadenylation site is shown at
bottom right, in boldface lowercase letters with boldface double underscore.
F886
OK-GC: KIDNEY UROGUANYLIN RECEPTOR
pressed in the kidney cortex and intestinal mucosa,
with mRNA transcripts occurring at lower levels in the
other tissues.
The OK-GC cDNA was transfected into COS cells for
transient expression of the OK-GC protein. We observed that COS cells transfected with the OK-GC
cDNA became responsive to stimulation with E. coli ST
yielding cGMP accumulation responses to this peptide
agonist (Fig. 4A). However, COS-1 cells transfected
with the plasmid vector alone had no detectable cGMP
responses to ST stimulation (Fig. 4A). Thus we sought
to establish an OK-GC-transfected cell line using HEK293 cells as a model system. An HEK-293-C6 clonal
subline was subsequently isolated following transfection with the OK-GC cDNA, and these cells exhibited
substantial cGMP accumulation responses to uroguanylin, guanylin, and E. coli ST synthetic peptides (Fig.
4B). These agonists increased cGMP by 3.6- to 4.3-fold,
at 10 µM concentration in HEK-293-C6 cells. There
were no significant differences in estimated potencies
between the peptides. However, ST appeared slightly
more potent than uroguanylin and guanylin, as seen
previously in T84 and OK cell lines (8, 21, 26). This
level of cGMP response in the HEK-293-C6 cells is
considerably lower than that observed for these peptides in the OK-E cells (Fig. 4C). Concentrations of 10
µM guanylin and uroguanylin and 1 µM ST increased
cGMP levels in confluent OK-E cells by 460-, 491-, and
421-fold, respectively. However, the rank order of potencies of ST ⬎ uroguanylin ⬵ guanylin was similar
between OK-E and HEK-293-C6 cell lines expressing
the OK-GC receptors. All of these synthetic peptides
are full agonists for activation of OK-GC receptors
expressed in HEK-293-C6 cells or for activation of the
native receptor GCs found in OK-E cells.
We further characterized the OK-GC receptor protein using Western blot assays with a polyclonal antisera that interacts with a conserved portion (amino
acids 1011–1073; Fig. 3) of the human intestinal receptor for guanylin/uroguanylin/ST (39). Illustrated in Fig.
5 are results obtained with T84 human intestinal, OK,
and transiently transfected COS-1 cells, as well as
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.247 on June 16, 2017
Fig. 2. Comparison of amino acid sequences deduced from OK-GC cDNA (OKGC) with human intestinal GC-C
(HUGCC). The GCG program (Wisconsin University Genetics Computer Group v8.0) was used to deduce the amino
acid sequence of the 3,762-bp OK-GC cDNA that was cloned from the opossum kidney cortex. This sequence was
compared with the published sequenced for the human GC-C protein and was found to share 75.8% identity over the
entire ORF. Human GC-C protein (expressed as a fusion protein with glutathione S-transferase) used to raise the
GCC-CTD polyclonal antibody is indicated by the shaded region. OK-GC protein shares 73% identity with the
human GC-C protein in this region. GCC-CTD, a polyclonal antibody for the COOH-terminal domain of human
GC-C. Single dots and double dots are GCG descriptions of relative similarity.
OK-GC: KIDNEY UROGUANYLIN RECEPTOR
F887
protein from opossum kidney BBMs and opossum
intestinal BBMs that react with this antisera. The
immunoreactive proteins found in COS-1 cells expressing the OK-GC receptor activity have a 160-kDa band
of a size similar to that found in the opossum kidney
and intestinal BBMs and T84 and OK cell membranes.
This antisera also reacts with a 140-kDa protein that is
relatively abundant in OK and T84 cell membranes and
opossum small intestinal BBM, with a much lower level
seen in kidney BBM. The 160- and 140-kDa bands may
represent differentially glycosylated forms of the OK-GC
receptor protein as previously reported for human and
rat membrane receptor GCs (39, 44). The 140-kDa band
may be undetectable in the kidney medulla BBM and
COS-1 cells transiently expressing OK-GC, because the
amount of protein present may be below the detection
level. The OK-GC protein expressed in COS-1 cells
migrates on SDS-PAGE similarly to the mobilities of
the native receptor proteins found in either of the cell
culture models or in the guanylin/uroguanylin target
tissues. The apparent protein level for OK-GC in the
COS-1 cells is lower than the expression of OK-GC in
either intestine or renal cortical BBM or the cultured
cell models.
DISCUSSION
Our findings are consistent with the hypothesis that
the OK-GC protein is a renal tubular receptor for
uroguanylin and/or guanylin peptides, which participates in a cGMP signaling pathway for regulation of
the urinary excretion of sodium, potassium, and water
(10, 17, 35). OK-GC is the first kidney receptor for the
guanylin family peptides to be defined at a molecular
level. Prior to the identification of receptor GC signaling molecules for E. coli ST in the OK and PTK-2 cells
and in the opossum kidney (13, 14, 30, 47), it was
thought that ST-stimulated GCs were restricted to the
intestinal mucosa (19). Thus identification of receptor
activities for OK-GC in OK cells and opossum kidney
(13, 14, 30, 47) opened a new field of inquiry that
culminated recently with the discoveries of guanylin,
uroguanylin, and lymphoguanylin peptides (4, 11, 21).
These peptides activate OK-GC and may serve as
endogenous agonists for this membrane receptor GC
(11, 21). The OK cell line has functional properties like
those of renal proximal tubules, and receptor autoradiography experiments with 125I-ST have clearly shown
that specific binding sites for this uroguanylin-like
radioligand are found in cells of the convoluted and
straight portions of proximal tubules in opossum kidney (8, 14, 30). High levels of these 125I-ST-labeled
receptors are also found in BBMs isolated from the
kidney and intestine, indicating that this receptor GC
is preferentially localized to apical plasma membranes
of both kidney and intestinal target cells (14, 47). It is
likely that OK-GC serves as a physiological receptor for
uroguanylin, which is the major bioactive peptide found
in opossum urine (21). However, guanylin was also
isolated from opossum urine, indicating that this pep-
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.247 on June 16, 2017
Fig. 3. Tissue expression of OK-GC mRNA. A: total
RNA (40 µg) from OK-E, OK, segments of kidney,
bladder, adrenal, skin, and heart tissues was electrophoresed on a 1% agarose denaturing gel and transferred onto a nylon membrane. Membrane was
probed with 32P-labeled human ␤-actin and 32Plabeled OK-GC cDNA encoding parts of the extracellular and kinase-homology domain (nucleotides 916–
1810). Blot was hybridized at 60°C and stringently
washed with 0.2⫻ SSC/0.1% SDS at 60°C before
exposure with an intensifying screen at ⫺80°C for 72
h. This is a representative Northern analysis of the
OK-GC expression in various opossum tissues. Similar receptor expression was observed when blot was
probed with the cDNA encoding the ligand binding
domain (nucleotides 916–1810). B: total RNA (40 µg)
from segments of opossum gastrointestinal (GI) tract
(stomach, duodenum, jejunum, ileum, cecum, and
colon) was analyzed as above; however, exposure was
for 24 h at ⫺80°C. This is a representative Northern
analysis of OK-GC expression in opossum GI tissues.
Similar receptor expression was observed when blot
was probed with the cDNA encoding the ligand
binding domain (nucleotides 916–1810). C: total
RNA (20 µg) from COS-1 cells and COS-1 cells
transiently transfected with pcDNA3.1 and
pcDNA3.1-OK-GC, respectively, was probed with
32P-labeled OK-GC cDNA. Blot was hybridized and
exposed for 16 h at ⫺80°C with an intensifying
screen.
F888
OK-GC: KIDNEY UROGUANYLIN RECEPTOR
tide may influence renal function in vivo via cGMP (21).
Active uroguanylin and inactive prouroguanylin peptides circulate in plasma, thus providing a source for
the urinary forms of bioactive uroguanylin in opossum,
human, and rat urine (7, 21, 26). The kidney also
expresses uroguanylin and guanylin mRNAs, which
offers the possibility that an intrarenal signaling pathway exists for the guanylin peptides as well as providing another potential source of uroguanylin in the urine
(2, 8, 46). Physiologically, uroguanylin may regulate
kidney function via an endocrine axis linking the
intestine to the kidney and/or through an intrarenal
paracrine mechanism. Both possibilities involve the
activation of OK-GC as a key signaling molecule in
renal tubular target cells that possess the GC-cGMP
signal transduction machinery in opossum kidney (13,
14, 30, 47).
Although more than 10 years have elapsed since the
initial report that opossum kidney responds to a uroguanylin-like peptide with increased cGMP (13), the general concept of uroguanylin/cGMP-mediated regulation
of kidney function has been slow to be accepted as a
physiological mechanism that applies to all mammals.
In part, this may be associated with using the North
American opossum, Didelphis virginiana, as an animal
model and OK cells as a cell model for these studies (8,
13, 14, 30, 47). Following the isolation of cDNAs
encoding the intestinal receptors for guanylin family
peptides, it was reported that mRNAs encoding these
receptors are not detected in rat kidney (41). This
suggested that rat kidney was not a target for guanylin
peptides. Clearly, the rat, mouse, and opossum kidneys
Fig. 4. Expression of OK-GC in COS-1 and HEK-293 cells. A: COS-1
cells transiently transfected with pcDNA3.1-OK-GC and pcDNA3.1
were stimulated with varying concentrations of synthetic E. coli ST13
peptide, and cGMP formation was measured. COS-1 cells were
replated (24 h posttransfection) in 24-well plates and maintained for
72 h prior to cGMP accumulation assay. In 3 separate transfection
experiments, 1 µM heat-stable enterotoxin (ST) was found to increase
cGMP levels ⬃4-fold in COS-1 cells transiently expressing OK-GC. B:
cellular cGMP accumulation responses to uroguanylin (UGN), guanylin (GN), and ST13 were assessed in HEK-293 cells stably expressing OK-GC. Data are means ⫾ SE from 4 independent experiments.
Error bar for ST13 and uroguanylin is drawn above the plotted curve
and for guanylin it is drawn below the curve. C: response of OK-E
cells to various concentrations of synthetic opossum guanylin, uroguanylin, and E. coli ST; 10 µM guanylin and uroguanylin and 1 µM ST
were found to increase cGMP levels in confluent OK-E cells by 460-,
491-, and 421-fold, respectively. This is a representative experiment
that has been repeated with similar results (7).
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.247 on June 16, 2017
Fig. 5. Expression of OK-GC protein. Western analysis of membranes (150 µg) prepared from T84, OK, and transiently transfected
COS-1 cells (with pcDNA3.1-OK-GC and pcDNA3.1 vectors) and
brush-border membrane (BBM) preparations (50 µg) of opossum
kidney medulla, kidney cortex, and small intestine. Membranes were
resolved by SDS-PAGE electrophoresis and blotted onto polyvinylidene fluoride membranes and probed with GCC-CTD, a polyclonal
antisera raised against the COOH-terminal domain of human GC-C.
Bound antibody was detected by enhanced chemiluminescence (ECL,
Amersham). Antisera detected 2 protein bands of ⬃160- and 140-kDa
sizes. Both bands were detected in T84 and OK cell membranes, as
well as in the opossum small intestine, and very faintly in the kidney
cortex BBMs. In opossum kidney medulla BBM and the OK-GCexpressing COS-1 cell membrane, only the 160-kDa protein band was
detected. COS-1 cells transiently transfected with the pcDNA3.1
vector did not display any protein bands of the 160- and 140-kDa
sizes.
OK-GC: KIDNEY UROGUANYLIN RECEPTOR
receptor was isolated from the GI mucosa of rats (36).
However, a 53-amino acid deletion in this receptor
within the region linking the kinase homology and
catalytic domain, along with several other differences
in the primary structure of the deduced protein, suggests that this membrane GC expressed in the GI tract
is derived from a novel gene. The cloning and molecular
identification of OK-GC provides an opportunity to
identify the second gene product that serves as a
receptor for the guanylin peptides in either eutherian
or metatherian species. Two different receptor GCs
with different agonist selectivity properties, combined
with the heterogeneity exhibited by the presence of
guanylin, uroguanylin, and lymphoguanylin genes
found in the opossum, provide for a physiologically
complex signal transduction pathway for cGMP-mediated control of cell and organ function in this mammalian animal model (4, 11, 21).
Expression of the OK-GC mRNA in the intestinal
mucosa at levels equivalent to those found in renal
cortex suggests that this signaling protein may be the
major receptor GC of both small and large intestine of
opossums. Studies using receptor autoradiography and
in vitro cGMP responses of isolated mucosa to the
guanylin peptides with opossums as well as other
mammals, and in birds and reptiles, has revealed that
the guanylin/uroguanylin/ST receptors have their greatest concentration in the proximal small intestine, and
receptor levels then decrease progressively along the
longitudinal axis of the small and large intestine
(27–29). Receptor autoradiography, in situ hybridization, and immunohistochemistry experiments are in
general agreement that the guanylin peptide receptors
also exhibit a gradient of concentration along the
crypt-villus axis (27–29, 34, 39). The highest apparent
level of receptors appears to be on the lower one-third of
the villi of small intestinal cells and within the crypts of
large intestine. It is likely that these receptors are
involved in the tissue responses to this family of enteric
peptides resulting in a paracrine influence of guanylins
on the transepithelial secretion of chloride and bicarbonate anions during digestion (18, 25, 31). Thus OK-GC in
the opossum may be a physiological counterpart to the
receptor GC, GC-C, that has been identified by molecular cloning in the rat, human, and porcine intestine (41,
43, 45). Regulation of intestinal fluid secretion together
with bicarbonate secretion-dependent neutralization of
the highly acidic contents within the lumen of the
duodenum and cecum are prominent physiological actions of this enteric paracrine mechanism and intracellular cGMP signaling pathway in the intestinal tract.
Cell-specific expression of the receptors for guanylin
family peptides is also observed in the opossum kidney
and testis with the highest levels found in cells comprising the pars recta and convoluted portions of the renal
proximal tubules and in seminiferous tubules of testis
(8, 14, 30). These high-density receptor sites in the
nephron of the opossum kidney, as detected by receptor
autoradiography and tissue cGMP response assays, are
consistent with the high levels of OK-GC mRNA detected in the renal cortex compared with the mRNA
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.247 on June 16, 2017
all respond to treatment with either E. coli ST, uroguanylin, or guanylin with marked increases in urinary
sodium, potassium, and water excretion indicating that
uroguanylin/guanylin receptors are present in the kidneys of both major classes of extant mammals (10, 13,
14, 17, 30, 35, 47). If eutherian (placental, e.g., rat,
mouse) and metatherian (marsupial, e.g., opossum)
classes of mammals have functional receptors in the
kidney that respond to guanylin family peptides, then
it is quite clear that genes encoding these guanylin/
uroguanylin receptors existed prior to the evolutionary
divergence of placental and marsupial mammals from
ancestral mammals that lived ⬃130 million years ago
(24). Moreover, the guanylin and uroguanylin genes are
also present in the genomes of both metatherian and
eutherian mammals (4, 6, 21, 22, 48). Although certain
differences between mammalian species may occur in
some aspects of the uroguanylin-cGMP signaling pathway in the kidney, it is likely that the broader physiological features of this mechanism occur in the kidneys of
all mammals. Thus we propose that the opossum
kidney and cultured OK cell lines are useful experimental models that can provide new insights into the renal
mechanism of action of uroguanylin and guanylin as
novel regulatory peptides that influence kidney function via the intracellular second messenger, cGMP.
OK-GC may be a new member of an emerging family
of receptor GCs that interact with guanylin peptides.
The primary structure of the ligand-binding domain of
OK-GC shares only 55.4–58.6% identity with the corresponding domain in the intestinal form of guanylin
receptors in rats, humans, and pigs (41, 43, 45). In
contrast, the ligand-binding domains of the intestinal
receptors within these eutherian mammals share ⬃70%
identity. This extracellular portion of the membrane
GCs is the most highly variable domain, which accounts for the selectivity of these receptors for different
peptide agonists. For example, the receptors for guanylin peptides do not interact with atriopeptins, and
atriopeptin receptor GCs are not activated by the
guanylins (5). OK-GC may be a second member of an
emerging family of receptors for the guanylin peptides,
in addition to the intestinal guanylin receptors that
were identified previously (41, 43, 45). Other evidence
supports the hypothesis that multiple genes exist in the
mammalian genome that encode additional receptors
for guanylin peptides. Transgenic mice with disabled
genes for an intestinal receptor GC have no intestinal
fluid secretion responses to E. coli ST in vivo, yet
intestinal BBMs isolated from these guanylin receptorknockout animals still retain specific binding sites for
125I-ST, a uroguanylin-like peptide agonist (37). These
125I-ST binding sites associated with intestinal BBMs
are likely to represent another membrane receptor GC
and physiological target for the guanylin peptides.
Other molecular evidence supports the interpretation
that at least two genes are present in the mammalian
genome that encode receptors for the guanylin peptides. A partial cDNA encoding part of the kinase
homology and catalytic domains of a membrane GC
that is closely related to an intestinal form of guanylin
F889
F890
OK-GC: KIDNEY UROGUANYLIN RECEPTOR
We thank Linda M. Rowland for technical support.
We acknowledge financial support from a University of Missouri
Research Board Grant and a Short Term Associateship from the
Department of Biotechnology, Government of India, to S. S. Visweswariah.
Address for reprint requests and other correspondence: R. M.
London, Dept. of Pharmacology, School of Medicine, Missouri Univ.,
Columbia, MO 65212 (E-mail: [email protected]).
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
Received 23 October 1998; accepted in final form 9 March 1999.
REFERENCES
1. Biber, J., B. Stieger, W. Haase, and H. Murer. A high yield
preparation for rat kidney brush border membranes. Different
behaviour of lysosomal markers. Biochim. Biophys. Acta 647:
169–176, 1981.
2. Blanchard, R. K., and R. J. Cousins. Upregulation of rat
intestinal uroguanylin mRNA by dietary zinc restriction. Am. J.
Physiol. 272 (Gastrointest. Liver Physiol. 35): G972–G978, 1997.
3. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principles of
protein-dye binding. Anal. Biochem. 72: 248–254, 1976.
4. Currie, M. G., K. F. Fok, J. Kato, R. J. Moore, F. K. Hamra,
K. L. Duffin, and C. E. Smith. Guanylin: an endogenous
activator of intestinal guanylate cyclase. Proc. Natl. Acad. Sci.
USA 89: 947–951, 1992.
5. Drewett, J. G., and D. L. Garbers. The family of guanylyl
cyclase receptors and their ligands. Endocr. Rev. 15: 135–162,
1994.
6. Fan, X., F. K. Hamra, R. H. Freeman, S. L. Eber, W. J.
Krause, R. W. Lim, V. M. Pace, M. G. Currie, and L. R. Forte.
18.
19.
20.
21.
Uroguanylin: cloning of preprouroguanylin cDNA, mRNA expression in the intestine and heart and isolation of uroguanylin and
prouroguanylin from plasma. Biochem. Biophys. Res. Commun.
219: 457–462, 1996.
Fan, X., F. K. Hamra, R. M. London, S. L. Eber, W. J. Krause,
R. H. Freeman, C. E. Smith, M. G. Currie, and L. R. Forte.
Structure and activity of uroguanylin isolated from urine and
intestine of rats. Am. J. Physiol. 273 (Endocrinol. Metab. 36):
E957–E964, 1997.
Fan, X., Y. Wang, R. M. London, S. L. Eber, W. J. Krause,
R. H. Freeman, and L. R. Forte. Signaling pathways for
guanylin and uroguanylin in the digestive, renal, central nervous, reproductive and lymphoid systems. Endocrinology 138:
4636–4648, 1997.
Field, M., L. H. Graf, Jr., W. J. Laird, and P. L. Smith.
Heat-stable enterotoxin of Escherichia coli: in vitro effects on
guanylate cyclase activity, cyclic GMP concentration, and ion
transport in small intestine. Proc. Natl. Acad. Sci. USA 75:
2800–2804, 1978.
Fonteles, M. C., R. N. Greenberg, H. S. A. Monteiro, M. G.
Currie, and L. R. Forte. Natriuretic and kaliuretic activities of
guanylin and uroguanylin in the isolated perfused rat kidney.
Am. J. Physiol. 275 (Renal Physiol. 44): F191–F197, 1998.
Forte, L. R., S. L. Eber, X. Fan, R. M. London, Y. Wang, L. M.
Rowland, D. T. Chin, R. H. Freeman, and W. J. Krause.
Lymphoguanylin: cloning and characterization of a unique member of the guanylin peptide family. Endocrinology 140: 1800–
1806, 1999.
Forte, L. R., and F. K. Hamra. Guanylin and uroguanylin:
intestinal peptide hormones that regulate epithelial transport.
News Physiol. Sci. 11: 17–24, 1996.
Forte, L. R., W. J. Krause, and R. H. Freeman. Receptors and
cGMP signaling mechanism for E. coli enterotoxin in opossum
kidney. Am. J. Physiol. 255 (Renal Fluid Electrolyte Physiol. 24):
F1040–F1046, 1988.
Forte, L. R., W. J. Krause, and R. H. Freeman. Escherichia
coli enterotoxin receptors: localization in opossum kidney, intestine and testis. Am. J. Physiol. 257 (Renal Fluid Electrolyte
Physiol. 26): F874–F881, 1989.
Forte, L. R., P. K. Thorne, S. L. Eber, W. J. Krause, R. H.
Freeman, S. H. Francis, and J. D. Corbin. Stimulation of
intestinal Cl⫺ transport by heat-stable enterotoxin: activation of
cAMP-dependent protein kinase by cGMP. Am. J. Physiol. 263
(Cell Physiol. 32): C607–C615, 1992.
Giannella, R. A. Escherichia coli heat-stable enterotoxin, guanylins, and their receptors: What are they and what do they do?
J. Lab. Clin. Med. 125: 173–181, 1995.
Greenberg, R. N., M. Hill, J. Crytzer, W. J. Krause, S. L.
Eber, F. K. Hamra, and L. R. Forte. Comparison of effects of
uroguanylin, guanylin, Escherichia coli heat-stable enterotoxin
STa in mouse intestine and kidney: evidence that uroguanylin is
an intestinal natriuretic hormone. J. Investig. Med. 45: 276–282,
1997.
Guba, M., M. Kuhn, W.-G. Forssmann, M. Classen, M.
Gregor, and U. Seidler. Guanylin strongly stimulates rat
duodenal HCO3⫺ secretion: proposed mechanism and comparison
with other secretagogues. Gastroenterology 111: 1558–1568,
1996.
Guerrant, R. L., J. M. Hughes, B. Chang, D. C. Robertson,
and F. Murad. Activation of intestinal guanylate cyclase by
heat-stable enterotoxin of Escherichia coli: studies of tissue
specificity, potential receptors, and intermediates. J. Infect. Dis.
142: 220–228, 1980.
Hamra, F. K., S. L. Eber, D. T. Chin, M. G. Currie, and L. R.
Forte. Regulation of intestinal uroguanylin/guanylin receptormediated responses by mucosal acidity. Proc. Natl. Acad. Sci.
USA 94: 2705–2710, 1997.
Hamra, F. K., L. R. Forte, S. L. Eber, N. V. Pidhorodeckyj,
W. J. Krause, R. H. Freeman, D. T. Chin, J. A. Tompkins,
K. F. Fok, C. E. Smith, K. L. Duffin, N. R. Siegel, and M. G.
Currie. Uroguanylin: structure and activity of a second endogenous peptide that stimulates intestinal guanylate cyclase. Proc.
Natl. Acad. Sci. USA 90: 10464–10468, 1993.
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.247 on June 16, 2017
abundance found in corticomedullary and medullary
regions of the kidney. These studies do not rule out the
possibility of the existence of a separate and distinct
receptor for the guanylin peptides that may also be
expressed in renal tubules. Receptor autoradiography
reveals a relatively high density of 125I-ST binding sites
in the cells of the pars recta, which reside in the
corticomedullary region of the kidney (8, 14, 30). The
relatively low levels of OK-GC mRNA compared with
the putative high receptor activity in this anatomical
region is of interest. This apparent paradox could be
explained by the expression of a receptor gene different
from that of OK-GC in the corticomedullary region of
the opossum kidney. Additional studies will be required
to determine whether the receptor sites labeled by
125I-ST in vitro in various regions of the nephron can be
quantitatively accounted for by the expression of the
OK-GC receptor GC in opossum kidney.
In conclusion, OK-GC is the first kidney receptor GC
that serves as a cell-surface receptor for guanylin
peptides to be identified at a molecular level. Its
expression in the kidney provides a key signaling
molecule and physiological target for uroguanylin and/or
guanylin acting as renal hormones in vivo. Uroguanylin and guanylin may serve to regulate the renal
excretion of NaCl and water as a physiological means of
maintaining salt and fluid balance in the body secondary to the consumption of meals containing excess salt.
This postulated mechanism could have both an intestinal-to-kidney endocrine axis and/or an intrarenal paracrine signaling pathway, which ultimately influences
the urinary excretion of sodium, potassium, and water
via the intracellular second messenger, cGMP.
OK-GC: KIDNEY UROGUANYLIN RECEPTOR
35. Lima, A. A. M., H. S. A. Monteiro, and M. C. Fonteles. The
effects of Escherichia coli heat-stable enterotoxin in renal sodium
tubular transport. Pharmacol. Toxicol. 70: 163–167, 1992.
36. London, R. M., W. J. Krause, X. Fan, S. L. Eber, and L. R.
Forte. Signal transduction pathways via guanylin and uroguanylin in the stomach and intestine. Am. J. Physiol. 273 (Gastrointest. Liver Physiol. 36): G93–G105, 1997.
37. Mann, E. A., M. L. Jump, J. Wu, E. Yee, and R. A. Giannella.
Mice lacking the guanylyl cyclase C receptor are resistant to
STa-induced intestinal secretion. Biochem. Biophys. Res. Commun. 239: 463–466, 1997.
38. Nakazato, M., H. Yamaguchi, H. Kinoshita, K. Kangawa, H.
Matsuo, N. Chino, and S. Matsukura. Identification of biologically active and inactive human uroguanylins in plasma and
urine and their increases in renal insufficiency. Biochem. Biophys. Res. Commun. 220: 586–593, 1996.
39. Nandi, A., R. Bhandari, and S. S. Visweswariah. Epitope
conservation and immunohistochemical localization of the guanylin/stable toxin peptide receptor, guanylyl cyclase C. J. Cell.
Biochem. 66: 500–511, 1997.
40. Pfeifer, A., A. Aszodi, U. Seidler, P. Ruth, F. Hofmann, and
R. Fassler. Intestinal secretory defects and dwarfism in mice
lacking cGMP-dependent protein kinase II. Science 274: 2082–
2086, 1996.
41. Schulz, S., C. K. Green, P. S. T. Yuen, and D. L. Garbers.
Guanylyl cyclase is a heat-stable enterotoxin receptor. Cell 63:
941–948, 1990.
42. Schulz, S., M. J. Lopez, M. Kuhn, and D. L. Garbers.
Disruption of the guanylyl cyclase-C gene leads to a paradoxical
phenotype of viable but heat-stable enterotoxin-resistant mice.
J. Clin. Invest. 100: 1590–1595, 1997.
43. Singh, S., G. Singh, J. M. Helm, and R. Gerzer. Isolation and
expression of a guanylate cyclase-coupled heat stable enterotoxin
receptor cDNA from a human colonic cell line. Biochem. Biophys.
Res. Commun. 179: 1455–1463, 1991.
44. Vaandrager, A. B., S. Schulz, H. R. De Jonge, and D.
Garbers. Guanylyl cyclase C is an N-linked glycoprotein receptor that accounts for multiple heat-stable enterotoxin-binding
proteins in the intestine. J. Biol. Chem. 268: 2174–2179, 1993.
45. Wada, A., T. Hirayama, S. Kitao, J. Fujisawa, Y. Hidaka,
and Y. Shimonishi. Pig intestinal membrane-bound receptor
(guanylyl cyclase) for heat-stable enterotoxin: cDNA cloning,
functional expression, and characterization. Microbiol. Immunol. 38: 535–541, 1994.
46. Whitaker, T. L., D. P. Witte, M. C. Scott, and M. B. Cohen.
Uroguanylin and guanylin: distinct but overlapping patterns of
messenger RNA expression in mouse intestine. Gastroenterology
113: 1000–1006, 1997.
47. White, A. A., W. J. Krause, J. T. Turner, and L. R. Forte.
Opossum kidney contains a functional receptor for the Escherichia coli heat-stable enterotoxin. Biochem. Biophys. Res.
Commun. 159: 363–367, 1989.
48. Wiegand, R. C., J. Kato, and M. G. Currie. Rat guanylin
cDNA: characterization of the precursor of the endogenous
activator of intestinal guanylate cyclase. Biochem. Biophys. Res.
Commun. 185: 812–817, 1992.
Downloaded from http://ajprenal.physiology.org/ by 10.220.32.247 on June 16, 2017
22. Hill, O., Y. Cetin, A. Cieslak, H.-J. Magert, and W.-G.
Forssmann. A new human guanylate cyclase-activating peptide
(uroguanylin): precursor cDNA and colonic expression. Biochim.
Biophys. Acta 1253: 146–149, 1995.
23. Hughes, J. M., F. Murad, B. Chang, and R. L. Guerrant. Role
of cyclic GMP in the action of heat-stable enterotoxin of Escherichia coli. Nature 271: 755–756, 1978.
24. Janke, A., X. Xu, and U. Arnason. The complete mitochondrial
genome of the walaroo (Macropus robustus) and the phylogenetic
relationship among Monotremata, Marsupialia, and Eutheria.
Proc. Natl. Acad. Sci. USA 94: 1276–1281, 1997.
25. Joo, N. S., R. M. London, H. D. Kim, L. R. Forte, and L. L.
Clarke. Regulation of intestinal Cl⫺ and HCO3⫺ secretion by
uroguanylin. Am. J. Physiol. 274 (Gastrointest. Liver Physiol.
37): G633–G644, 1998.
26. Kita, T., C. E. Smith, K. F. Fok, K. L. Duffin, W. M. Moore,
P. J. Karabatsos, J. F. Kachur, F. K. Hamra, N. V. Pidhorodeckyj, L. R. Forte, and M. G. Currie. Characterization of
human uroguanylin: member of the guanylin peptide family.
Am. J. Physiol. 266 (Renal Fluid Electrolyte Physiol. 35): F342–
F348, 1994.
27. Krause, W. J., G. L. Cullingford, R. H. Freeman, S. L. Eber,
K. C. Richardson, K. F. Fok, M. G. Currie, and L. R. Forte.
Distribution of heat-stable enterotoxin/guanylin receptors in the
intestinal tract of man and other mammals. J. Anat. 184:
407–417, 1994.
28. Krause, W. J., R. H. Freeman, S. L. Eber, F. K. Hamra, M. G.
Currie, and L. R. Forte. Guanylyl cyclase receptors and
guanylin-like peptides in reptilian intestine. Gen. Comp. Endocrinol. 107: 229–239, 1997.
29. Krause, W. J., R. H. Freeman, S. L. Eber, F. K. Hamra, K. F.
Fok, M. G. Currie, and L. R. Forte. Distribution of Escherichia
coli heat-stable enterotoxin/guanylin/uroguanylin receptors in
the avian intestinal tract. Acta Anat. (Basel) 153: 210–219, 1995.
30. Krause, W. J., R. H. Freeman, and L. R. Forte. Autoradiographic demonstration of specific binding sites for E. coli enterotoxin in various epithelia of the North American opossum. Cell
Tissue Res. 260: 387–394, 1990.
31. Kuhn, M., K. Adermann, J. Jahne, W. G. Forssmann, and G.
Rechkemmer. Segmental differences in the effects of guanylin
and Escherichia coli heat-stable enterotoxin on Cl⫺ secretion in
human gut. J. Physiol. (Lond.) 479: 433–440, 1994.
32. Kuno, T., Y. Kamisaki, S. A. Waldman, J. Gariepy, G.
Schoolnik, and F. Murad. Characterization of the receptor for
heat-stable enterotoxin from Escherichia coli in rat intestine. J.
Biol. Chem. 261: 1470–1476, 1986.
33. Lennane, R. J., W. S. Peart, R. M. Carey, and J. A. Shaw.
Comparison of natriuresis after oral and intravenous sodium
loading in sodium-depleted rabbits: evidence for a gastrointestinal or portal monitor of sodium intake. Clin. Sci. Mol. Med. 49:
433–436, 1975.
34. Li, Z., and M. F. Goy. Peptide-regulated guanylate cyclase
pathways in rat colon: in situ localization of GCA, GCC, and
guanylin mRNA. Am. J. Physiol. 265 (Gastrointest. Liver Physiol.
28): G394–G402, 1993.
F891