Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
The evolution of lactose tolerance 09 December 2005 Volvox meeting Sean Myles Max Planck Institute for Evolutionary Anthropology Leipzig, Germany Lactose = complex sugar Lactase = digestive enzyme Lactose Lactase Glucose + Galactose Some humans are strange! • All mammals and most humans stop producing lactase after weaning • Lactose tolerance = lactase persistence • Simple dominant mode of inheritance • Human genetic polymorphism • Where is the mutation? Genetic association study Step 1: Identify a candidate gene Step 2: Find a mutation in the candidate gene that associates with the trait of interest Lactose intolerant people AGCTTGCTATCGGTAAGCTTAGCTTAGCT AGCTTGCTATCGGTAAGCTTAGCTTAGCT AGCTTGCTATCGGTAAGCTTAGCTTAGCT AGCTTGCTATCGGTAAGCTTAGCTTAGCT Lactose tolerant people AGCTTGCTATTGGTAAGCTTAGCTTAGCT AGCTTGCTATTGGTAAGCTTAGCTTAGCT AGCTTGCTATTGGTAAGCTTAGCTTAGCT AGCTTGCTATTGGTAAGCTTAGCTTAGCT The Lactase Gene MCM6 LCT = exon C-13910T • 100% association with lactose tolerance • lies in a transcription factor binding site Lactose tolerance frequencies in the Old World Sweden 99% Germany 80% Greece 47% Bedouin 85% Beja 87% Tuareg 87% Fulani 78% Tussi 93% South Africa 5% Japan 15% China ~10% Frequency of lactose tolerance 30% 30-60% 60% Natural Selection “Variations, however slight and from whatever cause proceeding, if they be in any degree profitable to the individuals of a species […] will tend to the preservation of such individuals, and will generally be inherited by the offspring. The offspring, also, will thus have a better chance of surviving, for, of the many individuals of any species which are periodically born, but a small number can survive. I have called this principle, by which each slight variation, if useful, is preserved, by the term natural selection.” (Charles Darwin in The Origin, 1859) Traits that have been driven up in frequency by natural selection are called adaptations. The culture-historical hypothesis Simoons (1965) • Cultures that relied on milk as a nutritional source experienced natural selection for lactose tolerance Gene-culture coevolution • Humans co-directed their own biological evolution by creating the selection pressure for lactose tolerance Gene-Culture Coevolution Cultural mediation of selection pressures Natural Selection Time t+1 Et+1 Natural Selection Gene pool Culture Development Cultural inheritance Et Gene pool Genetic inheritance t Development Cultural mediation of selection pressures Culture Detecting the signature of selection from genetic data AGCTTGCTATCGGTAAGCTTAGCTTAGCT AGCTTGCTATCGGTAAGCTTAGGTTAGCT AGCTTGCTATCGGTAAGCTTAGCTTAGCT AGCTTGCTATCGGTATGCTTAGCTTAGCT AGCTTGCTATTGGTAAGCTTAGCTTAGCT AGCTTGCTATTGGTAAGCTTAGCTTAGCT AGCTTGCTATTGGTATGCTTAGCTTAGCT AGCTTGCTATTGGTAAGCTTAGCTTAGCT SNP = single nucleotide polymorphisms • Occurrence 1 in 1000 nucleotides • Main source of human genetic variation Genome-wide SNP data • HapMap project • approx. 3 million SNPs in 4 human populations • project will be extended • Perlegen data • approx. 1.5 million SNPs in 3 human populations • Populations include: African-Americans European-Americans Chinese-Americans Fst – genetic differentiation • Fst: – a measure of frequency difference between populations Population A Population B = T allele = C allele Little population differentiation Low Fst Pop A = 20% Lots of population differentiation High Fst Pop A = 20% Pop B = 30% Pop B = 80% African-Americans vs. European Americans Fst distribution for 1.5 million SNPs # of SNPs within and around the lactase gene = 100 # of top 1% Fst SNPs within lactase gene = 15 top 1% Fst = 0.5 Evidence for selection? How unusual does the lactase gene look? How often are 15 out of 100 SNPs within the top 1% of the Fst distribution in the whole data set? Sample 10,000 times from data at random blocks of 100 SNPs and count # of top 1% SNPs in each iteration Observed = 15, p = 0.016 What about African dairying populations? . Ga’ali (.53) (0) Wolof (.51) (0) Shaigi (.38) (0) Nuer (.22) (0) Dinka (.26) (0) Evidence for convergent evolution?? Red Frequency of lactose tolerance Blue Expected frequency of lactose tolerance from frequency of -13910T Lessons from Lactase • Lactose tolerance is rare worldwide and is found at high frequencies only in dairying populations • Genetic signature of selection: the lactase gene in Europeans possesses one of the strongest signatures of selection to be detected in the human genome • Gene-culture coevolution: culture can drive biological evolution in humans • Convergent evolution: lactose tolerance may be an example of recent convergent evolution in humans