Download Erythropoietin gene from a teleost fish, Fugu rubripes

From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
RED CELLS
Erythropoietin gene from a teleost fish, Fugu rubripes
Chih-Fong Chou, Sumanty Tohari, Sydney Brenner, and Byrappa Venkatesh
In this paper we report the cloning and
characterization of the erythropoietin
(Epo) gene from the pufferfish, Fugu rubripes. This is the first nonmammalian
Epo gene to be cloned. The Fugu Epo
comprises 5 exons and 4 introns similar
to the human EPO, and encodes a 185–
amino acid protein that is 32% to 34%
identical to Epo from various mammals.
The synteny of genes at the Epo locus is
conserved between the Fugu and hu-
mans. Unlike in mammals in which adult
kidney is the primary Epo-producing organ, the heart is the main Epo-producing
organ in adult Fugu. In addition to the
heart, Fugu Epo is also expressed in the
liver and brain similar to the human EPO.
Interestingly, the transcripts in the Fugu
brain are generated from a distal promoter and include an alternatively spliced
first coding exon. No such brain-specific
alternative splicing of Epo has been re-
ported in mammals so far. Transient transfection studies in a fish hepatoma cell
line (PLHC-1) and a human hepatoma cell
line (HepG2) suggest that although the
Fugu Epo promoter many not be hypoxia
inducible, the gene may be regulated by
hypoxia. (Blood. 2004;104:1498-1503)
© 2004 by The American Society of Hematology
Introduction
Erythropoietin (Epo) is a glycoprotein hormone that plays a crucial
role in ensuring supply of adequate oxygen to tissues by regulating
the production of red blood cells. In mammals, Epo stimulates
differentiation and proliferation of erythroid precursor cells in the
bone marrow, in response to decreased environmental oxygen
concentration or systemic oxygen deficiency caused by anemia.1 In
humans, fetal liver and adult kidney are the primary sites of EPO
production.1 In addition to these tissues, EPO is also produced in
the central nervous system, bone marrow, spleen, heart, lung,
ovary, testis, and breast cancer cells.2-7 The production of Epo in
the kidney, liver, and the central nervous system is greatly induced
by hypoxic conditions.8,9
The gene encoding the human EPO was first cloned in 1985 by
2 groups independently.10,11 Since then, the Epo gene has been
cloned from several mammalian species including nonhuman
primates, rodents, ruminants, and felines.12-15 The human EPO
gene is transcribed from several start sites in the kidney and liver,
and is thus independently regulated in these tissues.16 Expression of
the human EPO gene in transgenic mice has indicated that the
cis-elements directing expression to the kidney are located between
6 kb and 14 kb upstream of the basal promoter, whereas the
liver-specific elements are located in the 3⬘ flanking region.16 A
43-bp cis-element, capable of mediating the hypoxia response in
the liver, also resides within the 3⬘ flanking region, 120 bp
downstream of the polyadenylation (polyA) signal.16-18 Transient
transfection studies in human hepatoma cell lines have demonstrated that the 3⬘ enhancer induces 15- to 50-fold higher expression of a reporter gene in response to hypoxia.
Although an “immunoreactive erythropoietin” that competes
with human EPO for reaction with human EPO antibodies has been
demonstrated in some teleosts, amphibians, reptiles, and birds,19,20
the Epo gene has not been cloned from any nonmammalian
vertebrates. In teleost fish, the kidney is the primary erythropoietic
organ. Since the kidney of teleosts such as the rainbow trout, carp,
and eel was found to contain a higher level of the immunoreactive
erythropoietin than other tissues, it was concluded that in teleosts,
the kidney is the major erythropoietic as well as Epo-producing
organ.20 Recently, a “draft” genome sequence of the pufferfish,
Fugu rubripes, was completed.21 Interestingly, a homology search
of the Fugu genome using human protein sequences failed to
identify Fugu orthologs for a large number of human cytokines
including EPO. It was concluded that these proteins are either
absent in fish or have evolved rapidly since the divergence of the
mammalian and fish lineages to such an extent that the Fugu
proteins are not recognizable by homology search.21 In this paper,
we report the cloning and characterization of the Epo gene from the
Fugu by using a combination of basic local alignment search tool
(BLAST) and reverse transcription–polymerase chain reaction
(RT-PCR). Our results indicate that the heart is the major Epoproducing organ in the adult Fugu.
From the Institute of Molecular and Cell Biology, Singapore.
An Inside Blood analysis of this article appears in the front of this issue.
Submitted October 3, 2003; accepted March 29, 2004. Prepublished online as
Blood First Edition Paper, May 13, 2004; DOI 10.1182/blood-2003-10-3404.
Reprints: B. Venkatesh, Institute of Molecular and Cell Biology, 30 Medical Dr,
Singapore 117609; e-mail: [email protected].
Supported by the Agency for Science, Technology, and Research (A*STAR) of
Singapore.
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
The online version of the article contains a data supplement.
© 2004 by The American Society of Hematology
1498
Materials and methods
Isolation of the Fugu Epo gene
The draft Fugu genome sequence21 database at http://www.fugu-sg.org
(Release 6.1.1; the Second Assembly) was BLAST searched with human and
mouse Epo protein sequences using the “tblastn” algorithm. This version of the
draft Fugu genome is composed of 12 403 scaffolds (unordered fragments
of genomic DNA) that span 332 Megabases (Mb), accounting for about
95% of the nonrepetitive portion of the 365-Mb Fugu genome.
BLOOD, 1 SEPTEMBER 2004 䡠 VOLUME 104, NUMBER 5
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
BLOOD, 1 SEPTEMBER 2004 䡠 VOLUME 104, NUMBER 5
Fugu RNA preparation, RT-PCR, Northern blot, and RACE
(rapid amplification of cDNA ends)
Total RNA was extracted from various Fugu tissues using Trizol reagent
(Gibco BRL, Grand Island, NY) by following the manufacturer’s protocol.
The purified total RNA was reverse transcribed into cDNA using AMV
reverse-transcriptase first-strand cDNA synthesis kit (Gibco BRL). The
following primers, complementary to putative Fugu Epo exons, were used
to clone a fragment of cDNA: FEPOF (5⬘-CTTGCCTTCCTGTTGATCGTGTTG-3⬘) and FEPOR (5⬘-CAAACTCAACTGTTGTTTGGGGAAC-3⬘).
The same primer pair was used to analyze the expression pattern of Epo in
various Fugu tissues. The PCR cycles comprised a denaturation step at
95°C for 2 minutes, 35 cycles of 95°C for 30 seconds, 55°C for 1 minute,
and 72°C for 1 minute, followed by a final elongation step at 72°C for 5
minutes. Representative RT-PCR products were sequenced to confirm their
identity. A fragment of actin cDNA was amplified as an internal control for
the quality and quantity of cDNA using the primers ACTF (5⬘AACTGGGAYGACATGGAGAA-3⬘) and ACTR (5⬘-TTGAAGGTCTCAAACATGAT-3⬘). The Northern blot analysis was carried out by
fractionating Fugu total RNA on a 1.2% agarose gel containing formaldehyde. The RNA was transferred to a nylon membrane and probed with
[␣-32P]–labeled Fugu Epo cDNA or actin probe.
The 5⬘- and 3⬘-RACE were performed using the SMART RACE cDNA
Amplification kit (Clontech, Palo Alto, CA) in a nested PCR. The RACE
products were cloned into a T-vector and sequenced completely. The
gene-specific primers used for 5⬘-RACE are FEPOR and FEPOR2 (5⬘GAATCTGACAGGGTACATCCCTC-3⬘), and for 3⬘-RACE are FEPOF
and FEPOF1 (5⬘-GTACCCTGTCAGAT TCCGTGATTG-3⬘). The PCR
cycles were similar to those used in the RT-PCR except that annealing was
done at 60°C for 30 seconds.
DNA sequencing
A Fugu cosmid, no. c068C11, from Greg Elgar’s Fugu cosmid library
(HGMP-RC, MRC, Hinxton, United Kingdom), that spans the Epo locus
was identified based on the similarity of its end sequences to scaffold no.
7655. The gaps in the scaffold sequence were filled by sequencing cosmid
DNA using primers flanking the gaps. DNA sequencing was carried out on
an Applied Biosystems 3700 DNA Analyzer (Foster City, CA) using the
dye-terminator chemistry. The Fugu Epo sequence has been submitted to
GenBank (accession number AY303753).
Sequence analyses, alignment, and hydrophilicity plot
Protein sequences for the mammalian Epo were retrieved from the National
Center for Biotechnology Information (NCBI) database. Alignments of the
Fugu and mammalian Epo sequences were generated using the program
ClustalX. The hydrophilicity plots of the Epo sequences were generated
using the program Protean (DNAStar, Madison, WI) with the default Kyte
& Doolittle hydrophilicity parameters.
Construction of Epo promoter-luciferase reporter constructs
The upstream intergenic region of Fugu Epo (⫺5.9 kb) was amplified by
PCR using cosmid c068C11 as a template and the following primer pair:
5⬘-GCATCCGCATTTGCAGTCTTC-3⬘ and 5⬘-TCGCGATCAGGTGGCGCATC-3⬘. The PCR fragment was blunt ended and cloned into the SmaI site
of pGL3-basic vector (Promega, Madison, WI). Then, 5⬘ end deletions were
made in this construct by digesting with SalI, EcoRV, and NsiI to generate
⫺3.8 kb, ⫺2.1 kb, and ⫺0.8 kb promoter constructs, respectively. The first
intron (3.1 kb, specific to the heart and liver) was amplified by using the
primer pair 5⬘-GAGGTCCGAGATCTCGCGG-3⬘ and 5⬘-ACAGGAAGGCAAGCAATCCTG-3⬘. The PCR product was blunt ended and cloned
into the Fugu Epo promoter-luciferase reporter construct at the blunt-ended
XhoI site downstream of the promoter sequence. The 3⬘ intergenic region
(1.58 kb, from Epo stop codon to the stop codon of downstream RPP20
gene), designated 3⬘IGR, was amplified by PCR using the primers
5⬘-GCGCGGCCGCTGCCGGCTGACATTTCCACTC-3⬘ and 5⬘-GCGCGGCCGCCAGTATGAGGCTTCATGTGCTC-3⬘ containing restriction sites
for NotI, and cloned into the NotI site of the Fugu Epo promoter-luciferase
ERYTHROPOIETIN GENE FROM PUFFERFISH
1499
reporter construct. All the recombinant Fugu Epo promoter-luciferase
reporter constructs were sequenced to confirm the sequence and orientation
of the promoter. The 5.9-kb promoter contained 6 single base substitutions
compared with the genomic clones, presumably due to the error introduced
during PCR.
An 11-kb SalI and XmaI fragment of the cosmid c68C11, containing the
Epo gene flanked by 3.8-kb upstream and 0.95-kb downstream sequences,
was subcloned into pBluescript and used for transfection.
A 420-bp fragment of the human EPO promoter was amplified from the
genomic DNA using the primers 5⬘-CCCAAGCTTGGAACTCAGCAACCCAGGCATCTCTG-3⬘ and 5⬘-CCCAAGCTTGCGGTGGCCCCGGTCCGGCTC-3⬘, digested with HindIII and cloned into pGL3-basic vector. A
266-bp fragment containing the human EPO enhancer was amplified using
the primers 5⬘-GCGGTACCCTGGGAACCTCCAAATCCCCT-3⬘ and 5⬘GCGGTACCGCGCACTGCAGCCTTGCCC-3⬘, cloned into the KpnI site
upstream of the EPO enhancer to generate the “human EPO promoterenhancer” construct.
Cell culture and transfection
A fish hepatoma cell line (PLHC-1, top minnow hepatoma) and a human
hepatoma cell line (HepG2) were obtained from the American Type Culture
Collection (Manassas, VA). Both cell lines were grown in Dulbecco
modified Eagle medium (DMEM) supplemented with 10% fetal bovine
serum (FBS), penicillin, and streptomycin in a CO2 incubator (Forma
Scientific, Marietta, OH) with 5% CO2. PLHC-1 cells were incubated at
room temperature, while HepG2 cells were grown at 37°C. DMRIE-C
(1,2-dimyristyloxypropyl-N, N-dimethyl-N-hydroxyethylammonium bromide; Gibco BRL) was used as the transfection reagent. DNA construct (2
␮g/mL) or Fugu Epo cosmid DNA was mixed with 16 ␮g/mL DMRIE-C in
OptiMEM (Gibco BRL) and transfected into the 80% confluent cell culture,
as recommended by the manufacturer. Plasmid cytomegalovirus ␤-galactosidase (pCMV␤-gal) (0.5 ␮g/mL) was cotransfected for normalizing the
transfection efficiency. Cells were split into desired replicates 6 hours after
the transfection and cultured with complete medium for 30 hours, and then
grown under normoxic, hypoxic, or anaerobic conditions or in the presence
of 100 ␮M cobalt chloride (Sigma, St Louis, MO), for another 18 hours.
Hypoxic conditions were created by filling an air-tight incubator with 1%
O2, 5% CO2, and 94% N2. Anaerobic cultures were done in an anaerobic
culture jar using GasPak anaerobic system (Becton Dickinson, San Jose,
CA), and the depletion of oxygen was monitored by using a disposable
anaerobic indicator (Becton Dickinson, Sparks, MD).
Luciferase and ␤-gal assays
Cells were harvested and lysed in passive lysis buffer (Promega). Lysates
were assayed for luciferase activity using the Luciferase Assay System kit
(Promega) according to the protocol described by the manufacturer.
Luciferase activity was measured using a TD-20/20 luminometer (Promega). ␤-galactosidase activity was determined using the ␤-galactosidase
enzyme assay system (Promega) according to the protocol recommended
by the manufacturer and used to normalize levels of luciferase activity in
the lysates.
Results
Identification and cloning of the Fugu Epo gene
To identify the Fugu Epo gene, we BLAST searched the draft Fugu
genome sequence with human and mouse Epo sequences. The
BLAST search identified 2 short exons (90 bp and 53 bp) on
scaffold no. 7655 (62 kb) that were about 36% identical to the
human EPO at the amino acid level. We designed primers
complementary to these putative exons and amplified a 193-bp
cDNA fragment from the Fugu liver. Comparison of the sequence
of this cDNA to genomic DNA identified a 97-bp intron containing
the consensus GT and AG splice donor and acceptor sequences. We
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
1500
CHOU et al
BLOOD, 1 SEPTEMBER 2004 䡠 VOLUME 104, NUMBER 5
then obtained the complete sequence of the cDNA by 5⬘- and
3⬘-RACE PCR. The full-length Fugu cDNA encodes a protein with
185 amino acids, which is more similar to mammalian Epo
sequences than any other protein sequence in the public database.
Since teleosts are known to contain 2 copies of several
single-copy mammalian genes due to a whole-genome duplication
early during the evolution of teleosts,22,23 we searched the Fugu
genome using the protein sequence of the Fugu Epo cloned by us to
determine if there is a second copy. However, our search indicated
that Epo is single copy in the Fugu.
Structure of the Fugu Epo gene
We determined the exon-intron structure of the Fugu Epo by
mapping the cDNA cloned from the liver to the genomic sequence.
The Fugu Epo contains 5 exons and 4 introns similar to the human
Epo (Figure 1A). The transcription start site (tss) is located at 237
bp from the first codon (Figure 1A), and a putative TATA box, with
an atypical sequence TAATAA, is present at ⫺31 bp. The human
Epo also contains an atypical TATA box.11 The 3⬘ untranslated
region of the Fugu Epo does not contain a typical polyadenylation
signal (AATAAA), but has an atypical AAGAAA at 17 to 22 bp
upstream of the polyA site. Interestingly, the human gene contains a
similar atypical signal (AAGAAC) at 11 to 16 bp upstream of the
polyA site.11 The Fugu gene spans 5.9 kb from the transcription
start site to the polyA signal and is larger than the human Epo,
which spans only 2.9 kb. The large size of the Fugu gene is mainly
because of its larger first and last introns (Figure 1A).
To determine if the Fugu Epo is transcribed from different sites,
we cloned the 5⬘ end sequence of the Epo transcripts from the heart
and brain by 5⬘-RACE. Interestingly, whereas the 5⬘ sequence from
the heart was identical to that from the liver, the transcript from the
brain contained an alternative first exon. This exon codes for only 4
residues (MEFP) and is located 702 bp upstream of the first coding
exon of the liver transcripts. The start site of the transcript in the
brain is located 60 bp upstream (Figure 1A) and contains a typical
TATA box at ⫺49 bp.
Conserved synteny between the Fugu and human Epo locus
We annotated all the genes present in the 62-kb Fugu Epo locus
based on their homology to sequences in GenBank. The Fugu locus
contains 5 genes besides Epo (Figure 1B). The human orthologs of
Figure 1. Comparisons of the Fugu and human Epo loci. (A) The transcription
start site is shown by an arrow. Exons are shown as rectangles and introns shown as
thin lines. The sizes of introns are shown. (B) Genes are shown as arrows, with the
syntenic genes shown as filled arrows. The gene order at the human locus on Chr7
was obtained from the UCSC Human Genome Browser (http://genome.ucsc.edu).
The human gene for 2700038N03Rik was identified in this study.
Figure 2. The hydrophilicity plots for Epos from Fugu, human, horse, pig, and
rat generated using Kyte & Doolittle hydrophilicity parameters. The location of
the N-terminal amino acid residue of the signal peptide is shown. aa indicates amino
acid.
2 of these genes, PERQ1 and RPP20, have been mapped to the
human EPO locus (University of California, Santa Cruz [UCSC]
Human Genome Gateway at http://genome.ucsc.edu) upstream of
the EPO gene (Figure 1B). BLAST searching of the human genome
sequence with the other Fugu genes from the Epo locus uncovered
a new gene at the human EPO locus. This gene has a high similarity
to mouse cDNA 2700038N03Rik. It is located downstream of the
human EPO gene separated by 5 other genes (Figure 1B). Thus, the
synteny of 4 of the genes, PERQ1, 2700038N03Rik, Epo, and
RPP20, at the Fugu and human EPO loci is conserved, although
their order has been shuffled. This conserved synteny between the
human and Fugu Epo loci provides further evidence that the Fugu
gene we cloned is indeed the Fugu ortholog of the human EPO.
Comparisons of Fugu and mammalian Epo sequences
An alignment of the Fugu and mammalian Epos is shown in Figure
S1 (see the Supplemental Figures link at the top of the online article
on the Blood website). The Fugu Epo shows an overall identity of
only 32% to human EPO and 32% to 34% to other mammalian
Epos. However, the hydrophilicity plots of the Fugu and mammalian Epos are very similar (Figure 2). The first 21 residues of the
Fugu Epo are highly hydrophobic similar to the signal peptide of
the human EPO, indicating that this sequence is the signal peptide
of the Fugu Epo (Figure 2). The mature human protein contains 4
cysteine residues that form 2 disulphide bridges, a main bridge
linking the amino and carboxyl terminal (Cys7 and Cys161), and a
short internal bridge (Cys29 and Cys33).24 The main disulphide
bridge is important for the stability and function of the mature
protein, whereas the short bridge is not essential for the function of
EPO.14,25 The 4 cysteine residues are conserved in all mammals
except rodents, in which 1 of the cysteine residues that forms the
internal short bridge is replaced by proline (Figure 2). In the Fugu,
however, all 4 cysteine residues are conserved (Figure S1),
indicating that the Fugu Epo is folded in the same way as the
human EPO.
The human EPO is highly glycosylated; nearly 40% of its
molecular weight is due to sugars.25 It carries 3 N-linked sugar
chains on Asn24, Asn38, and Asn83, and 1 O-linked sugar chain on
Ser126 (highlighted in Figure S1). These N- and O-linked glycosylation sites are conserved in all mammals except rodents, in which
the O-linked glycosylation site is absent (Figure S1). Interestingly,
the Fugu Epo does not contain the 3 N-glycosylation sites
(N-X-S/T), but contains a potential O-linked glycosylation site at
the same position as in the human sequence (Figure S1). The
carbohydrate moieties of the EPO are known to be important for
the synthesis and secretion of the protein, and siacylation of the
carbohydrates extends the half-life of EPO. However, siacylation
reduces the affinity of EPO to its receptor.26 The presence of only 1
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
BLOOD, 1 SEPTEMBER 2004 䡠 VOLUME 104, NUMBER 5
ERYTHROPOIETIN GENE FROM PUFFERFISH
1501
Figure 3. Expression pattern of the Fugu Epo gene. (A) RT-PCR analysis. The Fugu Epo cDNA (fEpo) was amplified by RT-PCR using primers complementary to exons 2
and 3. The kidney tissue used for RNA extraction includes the head and the tail kidney. Actin was amplified as an internal control for the quality of Fugu cDNA. (B) Northern blot
analysis. Each lane contains about 20 ␮g (brain, heart, kidney, ovary) or 10 ␮g (liver) of Fugu total RNA. The Epo transcript in the brain (1.54 kb) is shorter than that in the heart
and liver (1.73 kb). A larger transcript of 3.1 kb is also found in these tissues. The sequence of this transcript is not clear from the exon-intron structure of Epo predicted by us.
potential glycosylation site in Fugu Epo, in contrast to the 4
glycosylation sites in human EPO, suggests that Fugu Epo may
have a higher affinity to the receptor than the human EPO.
Besides the 4 cysteine residues, several other residues are also
conserved in the Fugu and mammalian Epos (Figure S1). The
conservation of these residues over 450 million years of divergent
evolution of fish and mammalian lineages, despite an overall low
identity of fish and mammalian Epos, indicates that these residues
may be functionally important.
Expression pattern of Fugu Epo
We analyzed the expression pattern of Fugu Epo by RT-PCR and
Northern blot analysis. Our results show that in adult Fugu, the
heart is the main Epo-producing organ (Figure 3). Besides the
heart, Epo production was also detected in the liver and brain.
Interestingly, contrary to the previous immunohistochemical studies that suggested the kidney as the main Epo-producing organ in
fish,19,20 we did not detect Epo transcripts in the Fugu kidney. It
appears that the previous expression studies done using the human
EPO antibody19,20 were flawed in some way, and the “expression”
signals observed were due to some nonspecific binding of the
human antibody.
Characterization of the Fugu Epo promoter
In order to characterize the Fugu Epo promoter, we made a series of
promoter-luciferase reporter constructs as well as Fugu genomic
fragments and analyzed their activity in a fish and a human
Figure 4. Fugu promoter analysis in a fish (top
minnow) hepatoma cell line (PLHC-1). (A) Schematic
representation of the luciferase (Luc) reporter gene
constructs. Fugu Epo locus is shown at the top. The
transcription start site is shown by an arrow. (B) The
luciferase activity of pGL-basic (PGL3-basic) and pGL3control (PGL3-SV40) vectors transfected into the PLHC-1
cell line. SV40-promoter/enhancer driven pGL3-control
vector, which was used as a positive control, showed up
to 115-fold increase in the luciferase activity. (C) The
luciferase activity of various promoter-luciferase constructs transfected into the PLHC-1 cell line. The level of
luciferase activity obtained with various fEpo promoterluciferase constructs was significantly higher (P ⬍ .05)
than that of the pGL3-basic vector. (D) The luciferase
activity of the various promoter-luciferase constructs
under normal conditions (control), in the presence of
cobalt chloride (CoCl2), under hypoxic conditions, and
under anaerobic conditions. *Significantly different from
the corresponding control at P ⬍ .05. RLU indicates
relative light unit. The data shown are the mean (n ⫽ 3) ⫾
standard error of the mean.
hepatoma cell line. The luciferase constructs tested included ⫺5.9
kb, ⫺3.8 kb, ⫺2.1 kb, and ⫺0.8 kb 5⬘ flanking sequences,
designated fEpoP⫺5.9, fEpoP⫺3.8, fEpoP⫺2.1, and fEpoP⫺0.8,
respectively (Figure 4A). There were 2 more constructs,
fEpoP⫺5.9⫹3⬘IGR and fEpoP⫺3.8⫹3⬘IGR, generated by inserting 1.5 kb of the 3⬘ intergenic region (3⬘IGR) into fEpoP⫺5.9 and
fEpoP⫺3.8 constructs. Whereas the 0.8-kb and 2.1-kb promoters
showed baseline activity (comparable with that of the promoterless
pGL3-basic vector), 3.8-kb and 5.9-kb promoters supported 1.5- to
2-fold higher levels of expression than the baseline activity (Figure
4C). Addition of the 3⬘ intergenic region sequence to 3.8-kb and
5.9-kb promoters increased their expression levels by about 50%
and 28%, respectively (Figure 4C). Transient transfection studies in
the human HepG2 cell line showed that the expression levels of
various Fugu Epo constructs were close to that of the baseline
expression level of the promoterless vector (data not shown). These
results suggest that the Fugu Epo promoter region between ⫺5.9 kb
and ⫺3.8 kb and the 3⬘ intergenic region contain elements that
mediate expression in the fish hepatoma cell line, but not in the
human hepatoma cell line.
To determine if the fEpo flanking sequences contain any
hypoxia-responsive elements, we analyzed constructs fEpoP⫺3.8,
fEpoP⫺3.8⫹3⬘IGR, fEpoP⫺5.9, and fEpoP⫺5.9⫹3⬘IGR in the
fish hepatoma cell line under hypoxic and anaerobic conditions, or
in the presence of CoCl2. Cobalt is known to mimic hypoxic
induction of Epo production in human hepatoma cells by competing with iron for the heme protein.27 Although some of the
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
1502
CHOU et al
constructs (fEpoP⫺3.8, fEpoP⫺5.9, and fEpoP⫺5.9⫹3⬘IGR)
showed 5% to 24% higher levels of expression in the presence of
CoCl2, no marked induction of expression, as reported for the
human EPO flanking sequence, was evident under various hypoxic
conditions (Figure 4D). Inclusion of the first intron of Fugu Epo
into constructs fEpoP⫺5.9 and fEpoP⫺3.8 also did not elicit any
induction (data not shown). We then repeated these transfection
experiments using the human hepatoma cell line. None of the
constructs showed any significant induction of reporter gene
expression under the hypoxic conditions tested (data not shown).
We then transfected fish and human cell lines with the Fugu
cosmid c68C11 DNA or an 11-kb fragment of c68C11, and
subjected the cell lines to various hypoxic conditions to see if the
Epo gene is hypoxia regulated. The expression of Epo was
analyzed by RT-PCR. Our results show that although there was no
apparent increase in the overall abundance of transcripts in fish cell
lines under hypoxic conditions, the levels of spliced products (193
bp) were found to be higher in cells under hypoxic and anaerobic
conditions compared with the control cells, with a concomitant
decrease in the unspliced products (Figure 5A). These results
suggest that hypoxia may induce higher levels of expression of the
Fugu Epo gene in fish cells. In contrast to the fish cell line, there
was no difference in the expression levels of the Epo gene in human
cells cultured under normal and hypoxic conditions (Figure 5B).
To ascertain if the Fugu Epo transcripts in the fish and human
cell lines were generated from appropriate transcription start sites,
we mapped the transcription start sites of the transcripts generated
from the fEpoP⫺3.8⫹3⬘IGR construct and the Fugu cosmid by
5⬘-RACE. In both cell lines, the transcription was initiated from the
proximal transcription site active in the Fugu liver/heart. A
representative chromatogram of the 5⬘-RACE product is shown in
Figure S2. The sequence of the RACE product confirms the
transcription start site as well as indicates that the first intron is also
correctly spliced in the fish cell line. Further, we confirmed that no
transcripts were generated from upstream regions by doing RTPCR using primers located upstream and downstream of the
proximal transcription start site (Figure S2). These results confirm
that the Epo transcripts in the fish and human hepatic cell lines were
generated appropriately from the proximal transcription start site.
To test whether the fish cell line (PLHC-1) used in this study has
the potential to mediate hypoxia response of the human EPO
Figure 5. Expression of Fugu Epo in PLHC-1 and HepG2 cell lines. An 11-kb
genomic fragment of the Fugu Epo was transfected into the PLHC-1 (A) or HepG2 (B)
cell lines that were cultured under normal (Control), hypoxic, or anaerobic conditions,
or in the presence of cobalt chloride (CoCl2). HepG2 cells did not survive under
anaerobic conditions. The expression of Fugu Epo (fEpo) was analyzed by RT-PCR.
PCR was also done with an aliquot of the RNA treated with DNAse that was used to
synthesize cDNA (fEpo(-RT)) to check for residual genomic DNA in the cDNA
preparations. The larger fEpo band (290 bp) represents unspliced transcript and the
smaller band (193 bp) the spliced transcript. Endogenous actin or human glyceraldehyde-3-phosphate dehydrogenase (hG3PDH) fragment was amplified as an internal
control. Both were found to be efficiently spliced. The following primers were used to
amplify hG3PDH: 5⬘ACCACAGTCCATGCCATCAC3⬘ and 5⬘TCCACCACCCTGTTGCTGTA3⬘.
BLOOD, 1 SEPTEMBER 2004 䡠 VOLUME 104, NUMBER 5
enhancer, we transfected the fish cell line and the human cell line
with the human EPO promoter-enhancer construct and cultured
them under various hypoxic conditions. Whereas the human EPO
construct showed up to a 13-fold increase in expression levels in
human cells subjected to hypoxic conditions, no significant increase in the expression levels was observed in the fish cell line
(data not shown). Thus, the fish cell line used in this study does not
appear to have the potential to mediate the hypoxia response of the
human EPO enhancer. This could be due to either the inability of
the transcription factors in the fish cells to bind to human enhancer
(presumably due to their divergent sequences) or to the lack of
some transcription factors in this fish cell line.
Discussion
In this paper we report the cloning and characterization of the Epo
gene from the pufferfish. This is the first nonmammalian Epo gene
cloned to date. Several lines of evidence, such as the identical
exon-intron structure, conserved synteny, similar primary structure
of the protein, and the conserved residues, show that the gene
cloned by us is the Fugu ortholog of the human EPO gene. The
predicted Fugu Epo sequence exhibits an overall identity of only
32% to the human EPO. The Epo from different mammals also
appears to be quite divergent, with the identity of human EPO to
Epo from other mammals ranging from 80% to 91%.14,15 Thus, the
coding sequence of Epo appears to be evolving rapidly. Residues
that are evolutionarily conserved in such a rapidly evolving gene
are likely to be important for the function of the protein. In the
present study, we have identified several stretches of residues that
are conserved between the Fugu and human Epo. Further characterization of these residues should help to provide new insights into
the functions of Epo in vertebrates.
An unexpected finding of our study is that, unlike in mammals
in which the kidney is the primary Epo-synthesizing organ in
adults,1 the main Epo-producing organ in adult Fugu is the heart. In
primitive vertebrates such as fish, which lack bone marrow,
erythropoiesis occurs predominantly in the kidney. It may be that in
higher vertebrates, with the invention of the bone marrow as a
specialized erythropoietic tissue, shifting of the site of erythropoiesis from kidney to bone marrow was accompanied by a shift in the
site of Epo production from the heart to the kidney. The evolutionary pressure(s) that led to such a shift in the site of Epo production
is not clear. Cloning and characterization of Epo genes from
vertebrates such as amphibians and birds that are intermediary to
fish and mammals should help to shed light on this evolutionary
shift in the site of Epo production.
In mammals, besides the kidney, Epo is synthesized in the adult
liver and brain. Fugu Epo also expresses in the adult liver and brain,
indicating that the production of Epo in these organs has been
conserved during the evolution of vertebrates, despite a shift in the
major Epo-producing organ. Recent studies in mammals show that
Epo plays nonerythropoietic functions in the central nervous
system (eg, causing the persistence of pluripotent stem cells during
neurogenesis of the adult brain and protecting neurons from
ischemia-induced apoptosis).28,29 It is possible that in fish, Epo
plays a similar nonerythropoietic function in the brain. Interestingly, the Epo transcripts in the Fugu brain are transcribed from an
alternative transcription site and include an alternate first exon. No
such brain-specific alternative promoter and transcript have been
reported in mammals, although multiple transcription start sites
have been identified in the human EPO that are used differentially
in the liver, kidney, and brain in response to anemia.30 These
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
BLOOD, 1 SEPTEMBER 2004 䡠 VOLUME 104, NUMBER 5
alternative transcription start sites are located within a region of
250 bp to 630 bp upstream of the first coding exon, and the
transcripts generated from these sites contain the same first coding
exon. It remains to be seen if the brain-specific alternative promoter
and first exon identified in Fugu is specific to fish, and whether the
sequence of the alternate first exon confers a different function to
Epo in the brain.
Epo plays an important role in mammals in the supply of oxygen to
tissues during exposure to hypoxic conditions such as that encountered
at high altitudes and in caves. Hypoxia induces Epo production, which
in turn stimulates erythropoiesis. Our transient transfection studies of
Fugu Epo promoter constructs in the fish cell line suggest that the Fugu
Epo promoter and the 3⬘ flanking region may not respond to hypoxia.
However, when the Fugu Epo cosmid was transfected into the fish cell
line, higher levels of spliced transcripts were found in cells subjected to
hypoxic and anaerobic conditions. These results suggest that although
the Epo promoter is not inducible by hypoxia, the Epo gene may be
regulated by hypoxia. However, it should be noted that we were unable
to unequivocally demonstrate the hypoxia-response potential of the fish
cell line used in this study. Therefore, further in vitro studies using fish
cell lines with proven potential for hypoxia response, and in vivo studies
using small experimental fish, will be required to confirm if hypoxia
induces Epo gene expression and erythropoiesis in fish. Previous studies
in gar, a primitive ray-finned fish, showed that erythropoiesis is induced
by experimental anemia but not by hypoxia.31 This is surprising
ERYTHROPOIETIN GENE FROM PUFFERFISH
1503
considering that fish are more frequently exposed to extreme levels of
oxygen in the aquatic environment than mammals in the terrestrial
environment. The solubility of oxygen in water is just 1/30 of that in the
air, and the rate of oxygen diffusion in water is only 1/10 000 of that in
air. Thus, oxidation of organic materials and respiration by aquatic
organisms can drastically lower the oxygen levels in water, particularly
during the night. Therefore, fish would be expected to possess a sensitive
and rapid mechanism to regulate the level of erythrocytes. Fish have
indeed been shown to maximize oxygen uptake and economize oxygen
expenditure under hypoxic conditions by a variety of measures such as
increased ventilation, the bradycardia of hypoxia, cardiorespiratory
synchrony, constriction of peripheral blood vessels, and increased
release of catecholamines from the chromaffin tissue.32 These measures
are probably much more efficient in coping with hypoxic conditions in
water than an increased synthesis of erythrocytes, given that the oxygen
level in water (⬃ 0.0005%) is much lower than that in the atmosphere
(21%), and is lower still under hypoxic conditions.
Acknowledgments
We thank the UK-HGMP Resource Center for providing the Fugu
cosmid and the IMCB DNA Sequencing Facility for its help in
sequencing. B.V. is an adjunct staff of the Department of Paediatrics, National University of Singapore.
References
1. Jelkmann, W. Erythropoietin: structure, control of
production, and function. Physiol Rev. 1992;72:
449-489.
2. Dame C, Fahnenstich H, Freitag P, et al. Erythropoietin mRNA expression in human fetal and neonatal tissue. Blood. 1998;92:3218-3225.
3. Juul SE, Yachnis AT, Christensen RD. Tissue distribution of erythropoietin and erythropoietin receptor in the developing human fetus. Early Hum
Dev. 1998;52:235-249.
4. Yasuda Y, Masuda S, Chikuma M, Inoue K, Nagao M, Sasaki R. Estrogen-dependent production
of erythropoietin in uterus and its implication in
uterine angiogenesis. J Biol Chem. 1998;273:
25381-25387.
5. Dame C, Bartmann P, Wolber E, Fahnenstich H,
Hofmann D, Fandrey J. Erythropoietin gene expression in different areas of the developing human central nervous system. Dev Brain Res.
2000;125:69-74.
6. Acs G, Acs P, Beckwith SM, et al. Erythropoietin
and erythropoietin receptor expression in human
cancer. Cancer Res. 2001;61:3561-3565.
7. Magnanti M, Gandini O, Giuliani L, et al. Erythropoietin expression in primary rat sertoli and peritubular myoid cells. Blood. 2001;98:2872-2874.
8. Masuda S, Okano M, Yamagishi K, Nagao M,
Ueda M, Sasaki R. A novel site of erythropoietin
production. J Biol Chem. 1994;269:19488-19493.
9. Marti HH, Wenger RH, Rivas LA, et al. Erythropoietin gene expression in human, monkey and
murine brain. Eur J Neurosci. 1996;8:666-676.
10. Jacobs K, Schoemaker C, Rudersdorf R, et al.
Isolation and characterization of genomic and
cDNA clones of human erythropoietin. Nature.
1985;313:806-810.
11. Lin F, Suggs S, Lin C, et al. Cloning and expression of the human erythropoietin gene. Proc Natl
Acad Sci U S A. 1985:82:7580-7584.
12. Lin FK, Lin CH, Lai PH, et al. Monkey erthropoietin gene: cloning, expression and comparison
with the human erythropoietin gene. Gene. 1986;
44:201-209.
13. McDonald JD, Lin KF, Goldwasser E. Cloning,
sequencing and evolutionary analysis of the
mouse erythropoietin gene. Mol Cell Biol. 1986;6:
842-848.
14. Wen D, Boissel JP, Tracy TE, et al. Erythropoietin
structure-function relationships: high degree of
sequence homology among mammals. Blood.
1993;82:1507-1516.
15. Suliman HB, Majiwa PA, Feldman BF, et al. Cloning of a cDNA encoding bovine erythropoietin and
analysis of its transcription in selected tissues.
Gene. 1996;171:275-280.
16. Semenza GL, Koury ST, Nejfelt MK, Gearhart JD,
Antonarakis SE. Cell-type-specific and hypoxiainducible expression of the human erythropoietin
gene in transgenic mice. Proc Natl Acad Sci U S A.
1991:88:8725-8729.
17. Blanchard KL, Acquaviva AM, Galson DL, Bunn
HF. Hypoxic induction of the human erythropoietin gene: cooperation between the promoter and
enhanceer, each of which contains steroid receptor response elements. Mol Cell Biol. 1991;12:
5373-5385.
18. Beck I, Ramirez S, Weinmann R, Caro J. Enhancer element at the 3⬘-flanking region controls
transcriptional response to hypoxia in human
erythropoietin gene. J Biol Chem. 1991;266:
15563-15566.
19. Wickramasinghe SN, Shiels S, Wickramasinghe
PS. Immunoreactive erythropoietin in teleosts,
amphibians, reptiles, birds: evidence that the teleost kidney is both an erythropoietic and erythropoietin-producing organ. Ann N Y Acad Sci. 1994;
718:366-370.
20. Wickramasinghe SN. Erythropoietin and the human kidney: evidence for an evolutionary link
from studies of Salmo gairdneri. Comp Biochem
Physiol Comp Physiol. 1993;104:63-65.
21. Aparicio S, Chapman J, Stupka E, et al. Wholegenome shotgun assembly and analysis of the
genome of Fugu rubripes. Science 2002;297:
1301-1310.
22. Venkatesh B. Evolution and diversity of fish genomes. Curr Opin Genet Dev. 2003;13:588-592.
23. Christoffels A, Koh EL, Chia J, Brenner S, Aparicio S, Venkatesh B. Fugu genome analysis provides evidence for a whole-genome duplication
early during the evolution of ray-finned fishes.
Mol Biol Evol. 2004;21:1146-1151.
24. Wang FF, Kung CK-H, Goldwasser E. Some
chemical properties of human erythropoietin. Endocrinology. 1985;116:2286-2292.
25. Boissel JP, Lee WR, Presnell SR, Cohen FE,
Bunn HF. Erythropoietin structure-function relationships: mutant proteins that test a model of
tertiary structure. J Biol Chem. 1993;268:1598315993.
26. Darling RJ, Kuchibhotla U, Glaesner W, Micanovic R, Witcher DR, Beals JM. Glycosylation
of erythropoietin affects receptor binding kinetics:
role of electrostatic interactions. Biochemistry.
2002;41:14524-14531.
27. Porwol T, Ehleben W, Zierold K, Fandrey J, Acker
H. The influence of nickel and cobalt on putative
members of the oxygen-sensing pathway of
erythropoietin-producing HepG2 cells. Eur J Biochem. 1998;256:16-23.
28. Sakanaka M, Wen TC, Matsuda S, et al. In vivo
evidence that erythropoietin protects neurons
from ischaemic damage. Proc Natl Acad Sci U S A.
1998;95:4635-4640.
29. Scheffler B, Horn M, Blumcke I, et al. Marrowmindedness: a perspective on neuropoiesis.
Trends Neurosci. 1999;2:348-357.
30. Semenza GL, Dureza RC, Traystman MD, Gearhart JD, Antonarakis SE. Human erythropoietin
gene expression in transgenic mice: multiple transcription initiation sites and cis-acting regulatory
elements. Mol Cell Biol. 1990;10:930-938.
31. McLeod TV, Sigel MM, Yunis AA. Regulation of
erythropoiesis in Florida gar, Lepisosteus
platyrhinus. Comp Biochem Physiol. 1978;60A:
145-150.
32. Satchell GH. Physiology and form of fish circulation. Cambridge, United Kingdom: Cambridge
University Press; 1991.
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
2004 104: 1498-1503
doi:10.1182/blood-2003-10-3404 originally published online
May 13, 2004
Erythropoietin gene from a teleost fish, Fugu rubripes
Chih-Fong Chou, Sumanty Tohari, Sydney Brenner and Byrappa Venkatesh
Updated information and services can be found at:
http://www.bloodjournal.org/content/104/5/1498.full.html
Articles on similar topics can be found in the following Blood collections
Free Research Articles (4527 articles)
Hematopoiesis and Stem Cells (3430 articles)
Red Cells (1159 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.