Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download PDF, 1.5 MB
Document related concepts
no text concepts found
Transcript
D 1085
OULU 2010
U N I V E R S I T Y O F O U L U P. O. B . 7 5 0 0 F I - 9 0 0 1 4 U N I V E R S I T Y O F O U L U F I N L A N D
U N I V E R S I TAT I S
S E R I E S
SCIENTIAE RERUM NATURALIUM
Professor Mikko Siponen
HUMANIORA
University Lecturer Elise Kärkkäinen
TECHNICA
Professor Hannu Heusala
ACTA
U N I V E R S I T AT I S O U L U E N S I S
Kari Antero Mäkelä
E D I T O R S
Kari Antero Mäkelä
A
B
C
D
E
F
G
O U L U E N S I S
ACTA
A C TA
D 1085
THE ROLES OF OREXINS ON
SLEEP/WAKEFULNESS,
ENERGY HOMEOSTASIS AND
INTESTINAL SECRETION
MEDICA
Professor Olli Vuolteenaho
SCIENTIAE RERUM SOCIALIUM
Senior Researcher Eila Estola
SCRIPTA ACADEMICA
Information officer Tiina Pistokoski
OECONOMICA
University Lecturer Seppo Eriksson
EDITOR IN CHIEF
Professor Olli Vuolteenaho
PUBLICATIONS EDITOR
Publications Editor Kirsti Nurkkala
ISBN 978-951-42-6377-4 (Paperback)
ISBN 978-951-42-6378-1 (PDF)
ISSN 0355-3221 (Print)
ISSN 1796-2234 (Online)
UNIVERSITY OF OULU,
FACULTY OF MEDICINE,
INSTITUTE OF BIOMEDICINE,
DEPARTMENT OF PHYSIOLOGY;
UNIVERSITY OF OULU,
BIOCENTER OULU;
UNIVERSITY OF EASTERN FINLAND,
DEPARTMENT OF BIOTECHNOLOGY AND MOLECULAR MEDICINE,
A. I. VIRTANEN INSTITUTE FOR MOLECULAR SCIENCES
D
MEDICA
ACTA UNIVERSITATIS OULUENSIS
D Medica 1085
KARI ANTERO MÄKELÄ
THE ROLES OF OREXINS ON SLEEP/
WAKEFULNESS, ENERGY
HOMEOSTASIS AND INTESTINAL
SECRETION
Academic dissertation to be presented with the assent of
the Faculty of Medicine of the University of Oulu for
public defence in Auditorium F101 of the Department of
Physiology (Aapistie 7), on 10 December 2010, at 12
noon
U N I VE R S I T Y O F O U L U , O U L U 2 0 1 0
Copyright © 2010
Acta Univ. Oul. D 1085, 2010
Supervised by
Professor Karl-Heinz Herzig
Professor Juhani Leppäluoto
Reviewed by
Professor Barbara Cannon
Professor Pertti Panula
ISBN 978-951-42-6377-4 (Paperback)
ISBN 978-951-42-6378-1 (PDF)
http://herkules.oulu.fi/isbn9789514263781/
ISSN 0355-3221 (Printed)
ISSN 1796-2234 (Online)
http://herkules.oulu.fi/issn03553221/
Cover Design
Raimo Ahonen
JUVENES PRINT
TAMPERE 2010
Mäkelä, Kari Antero, The roles of orexins on sleep/wakefulness, energy
homeostasis and intestinal secretion
University of Oulu, Faculty of Medicine, Institute of Biomedicine, Department of Physiology, P.O.Box
5000, FI-90014 University of Oulu, Finland; University of Oulu, Biocenter Oulu, P.O. Box 5000, FI-90014
University of Oulu, Finland; University of Eastern Finland, Department of Biotechnology and Molecular
Medicine, A. I. Virtanen Institute for Molecular Sciences, P.O.Box 1627, FI-70211 Kuopio, Finland
Acta Univ. Oul. D 1085, 2010
Oulu, Finland
Abstract
Orexins, or hypocretins, are peptides originally found in the hypothalamus, and have been shown
to be involved in the stabilization and maintenance of sleep and wakefulness. In addition, these
peptides are known for their actions on energy homeostasis by increased heat production or
physical activity. Previous results suggest them to be also involved in peripheral actions on the
regulation of intestinal secretion, depending on the subject’s nutritional status (fasted-fed).
Orexin-A and Orexin-B peptides, are derived from the prepro-orexin precursor protein. These
ligands bind to two G-protein-coupled receptors, orexin-1 and -2 -receptors. Despite intensive
research, the role of orexins has not yet been clarified. The aim of the present study was to
investigate the role of orexins and their receptors on sleep and wake patterns, energy homeostasis
and intestinal secretion.
The effects of orexins on sleep and wakefulness, and energy homeostasis were studied in a
novel transgenic mouse line, overexpressing the human prepro-orexin gene. The overexpression
of prepro-orexin and orexin-A was confirmed in the hypothalami of transgenic mice. The
transgenic mice showed a significant reduction in their REM sleep during day and night time, and
differences in their vigilance states in the light/dark transition periods. In addition, the mice
demonstrated a significantly elevated day time food intake at room temperature, and an increased
metabolic heat production independent of uncoupling protein 1 mediated thermogenesis in brown
adipose tissue. Instead, transgenic mice showed increased levels of uncoupling protein 2 in white
adipose tissue. Furthermore, transgenic mice significantly decreased their total locomotor activity
during the first two nights in response to cold exposure (+4°C).
The effect of orexins and their receptors on duodenal HCO3¯ secretion were studied after an
overnight (16 h) food deprivation in an in situ perfused organ. Fasting decreased the expression of
orexin receptors in rat duodenal mucosa and in acutely isolated duodenal enterocytes.
Furthermore, food deprivation abolished OXA induced duodenal mucosal HCO3¯ secretion in
rats, and intracellular calcium signalling in isolated rat and human duodenal enterocytes.
In conclusion, the present thesis demonstrates that orexins inhibit REM sleep. In addition,
peptides affect increasingly on metabolic heat production, independent of uncoupling protein 1
mediated thermogenesis. Furthermore, the orexin system has a significant role in duodenal
bicarbonate secretion, which is regulated by the presence of food in the intestine.
Keywords: bicarbonate secretion, energy homeostasis, fasting, food deprivation,
hypocretins, orexins, orexins receptors, sleep, wakefulness
Acknowledgements
This thesis work was carried out at the Department of Physiology, Institute of
Biomedicine, and Biocenter Oulu, University of Oulu, and at the Department of
Biotechnology and Moleculare Medicine, A.I. Virtanen Insitute, University of
Kuopio.
I wish to express my sincere gratitude to my supervisor Prof. Karl-Heinz
Herzig, M.D., Ph.D. for giving me the opportunity to work in his research group
and opening my eyes to various possibilities in the molecular physiology research
field. My second supervisor emeritus Prof. Juhani Leppäluoto, M.D., Ph.D. is
deeply acknowledged for his guidance and support.
I wish to thank the referees, Prof. Pertti Panula, M.D., Ph.D. and Prof.
Barbara Cannon, B.Sc., Ph.D., D.Sc. for their valuable comments to my thesis.
Many thanks to Bryan Dopp, M.Ed., TESL for the English revision of this work.
I would like to thank all of my co-authors for their invaluable contribution to
my thesis. I owe my thanks to Prof. Takeshi Sakurai, M.D., Ph.D. for providing
the hPPO gene construct, and Prof. Leena Alhonen, Ph.D. for the creation of the
transgenic animal line. I wish to thank Prof. Tarja Porkka-Heiskanen for
successive collaboration in the mouse sleep study. My sincere thanks belong to
Henna-Kaisa Wigren, Ph. D., Janneke Zant and Andrey Kostin, Ph. D., for the
sleep recordings and data analysis, as well as for their professional comments. I´m
deeply grateful to Prof. Gunnar Flemström, M.D., Ph.D. for a unique change of
long-lasting and productive collaboration. Magnus Bengtsson, Ph.D., Markus
Sjöblom, Ph.D. and Gunilla Jedstedt are acknowledged for their invaluable
groundwork for the rat experiments and for calcium measurements. In addition, I
would like to thank Prof. Hans Rudolf Berthoud, Ph.D., Prof. Seppo Saarela,
Ph.D., Prof. Karl Åkerman, M.D., Ph.D, and Vootele Võikar, M.D., Ph.D.
I am very thankful to my co-author Tiia Kettunen for her valuable work at the
beginning of this project. Many thanks for Anniina Markkula for her contribution
to the cold experiments. Special thanks to Anne Huotari and Miia Kovalainen for
their support in animal work and hilarious moments shared with you. I thank
Sanna Oikari, Ph.D. for her contribution as a co-author and for methodological
discussions. Anna-Kaisa Purhonen, Ph.D. is acknowledged for her help and
interesting scientific discussions. I wish to thank Taina Lajunen, Ph.D. for helping
me out with my thesis-related questions. Special thanks to Riitta Kauppinen,
Meeri Kröger, Tuula Taskinen, Anna-Maija Koisti, Eija Kumpulainen and Alpo
Vanhala for their excellent technical assistance. I´m thankful to all present and
5
past members of our research group including Lauri Marin, Miika Heinonen,
Ph.D., Heli Ruotsalainen, Ph.D., Toni Karhu, David Vicente, Alicia Acosta,
Mohan Babu, Shivaprakash Mutt, Katja Klausz, Ph.D., Maria Vlasova, Ph.D.,
Mari Lappalainen and Jenna Pekkinen for their friendship and support through all
of these years.
Many thanks for Marika Hämeenaho, Kaija Pekkarinen, Riitta Laitinen and
Helena Pernu for their secretarial work. I thank Eero Kouvalainen and PekkaAlakuijala for solving several computer-related problems.
I want to thank my parents Helena and Antero Mäkelä for their care and
support. Many thanks to my sisters Heidi Koskela and Merja Törnqvist for
encouraging me to achieve my goal. Finally, I would like to thank my wife Teija
Seppä-Mäkelä and my son Kari Tobias Mäkelä for their love and support through
all of these workloaded years.
This study was supported in part by the Jalmari and Rauha Ahokas
Foundation, the Finnish Cultural Foundation (Central Fund, North Savo Regional
Fund, and North Ostrobothnia Regional Fund (to K.M.), the Finnish Academy
(Grants 108478 and 110525 to K.-H.H.), the Novo Nordisk Foundation (to K.H.H.) and the Swedish Research Council (Grant 3515).
6
Abbreviations
5-HT
α-MSH
Aa
ACTH
ARC
BF
BL
Bp
BP
CAG/Orexin
Serotonin
α-Melanocyte Stimulating Hormone
Amino acid
Adrenocorticotropic hormone, corticotropin
Arcuate nucleus
Basal forebrain
Base line
Base pair
Blood pressure
Mice overexpressing rat PPO under β-actin/cytomegalovirus
hybrid promoter
cAMP
3'-5'-cyclic adenosine monophosphate
CHO
Chinese hamster ovary cell line
CHO-K1
Chinese hamster ovary K1 cell line
CNS
Central nervous system
CRF
Corticotropin-releasing factor (or hormone)
CSF
Cerebrospinal fluid
DMH
Dorsomedial hypothalamic nucleus
DTT
Dithiothreitol
EC
Enteroromaffin cells
EDTA
Ethylene Diamine Tetra-acetic Acid
EEG
Electroencephalography
EMG
Electromyography
ERK
Extracellular signal-regulated
FAA
Food anticipatory activity
GABA
γ-Aminobutyric acid
GIT
Gastrointestinal tract
GPCR
G protein-coupled receptor
HCO3
Bicarbonate ion
HLA-DQB1*0602 Allel associated with human cases of narcolepsy
HPA
Hypothalamus-pituitary-adrenal (axis)
hPPO
Human prepro-orexin
HR
Heart rate
I.c.v.
Intracerebroventricular
I.v.
Intravenous
7
KO
LC
LDT
LH
LHA
MAP
MCH
MMSLT
MRN
NREM
Orexin/ataxin-3
OXA
OXB
OX-KO
OX1R
OX2R
PF-LHA
PLC
PLD
PPO
PPT
p38
REM
RIA
ROC
RSNA
RT-PCR
SB-334867
SD
S.c.
SCN
SOC
STC-1
SWS
Tg
TRH
TMN
8
Knockout
Locus coeruleus
Laterodorsal tegmental nucleus
Lateral hypothalamus
Lateral hypothalamic area
Mean arterial pressure
Melanin-concentrating hormone
Murine multiple sleep latency test
Median raphe nucleus
Non-rapid eye movement
Mice with ablated orexin neurons
Orexin-A
Orexin-B
Orexin knockout
Orexin 1 receptor
Orexin 2 receptor
Perifornical-lateral hypothalamic area
Phospholipase C
Phospholipase D
Prepro-orexin
Peduncolopontine nucleus
Cell signaling pathway
Rapid eye movement
Radioimmunoassay
Receptor-operated Ca2+
Renal sympathetic nerve activity
Reverse transcription-polymerase chain reaction
Selective OX1R antagonist
Sleep deprivation
Subcutaneous
Suprachiasmatic nucleus
Secondary store operated Ca2+
Enteroendocrine cell line derived originally from mouse
Slow wave sleep
Transgenic
Thyrotropin-releasing hormone
Tuberomamillary nucleus
UCP
VIP
VLPO
VTA
Wt
Uncoupling protein
Vasoactive intestinal peptide
Ventrolateral preoptic nucleus
Ventral tegmental area
Wildtype
9
10
List of original articles
This thesis is based on the following articles, which are referred to in the text by
their corresponding Roman numerals:
I
Mäkelä KA*, Wigren HK*, Zant JC, Sakurai T, Alhonen L, Kostin A, PorkkaHeiskanen T & Herzig KH (2010) Characterization of sleep-wake patterns in a novel
transgenic mouse line overexpressing human prepro-orexin/hypocretin. Acta Physiol
198(3): 237–249.
II Mäkelä KA, Kettunen TS, Kovalainen M, Markkula A, Åkerman KEO, Järvelin MR,
Saarela S, Alhonen L & Herzig KH Mice overexpressing human prepro-orexin have
increased heat production and a PPAR gamma dependent upregulation of UCP2 in
WAT. Manuscript.
III Bengtsson MW*, Mäkelä K*, Sjöblom M, Uotila S, Åkerman KEO, Herzig KH &
Flemström G (2007) Food-induced expression of orexin receptors in rat duodenal
mucosa regulates the bicarbonate secretory response to orexin-A. Am J Physiol
Gastrointest Liver Physiol 293(2): G501-G509.
IV Bengtsson MW, Mäkelä K, Herzig KH & Flemström G (2009) Short food deprivation
inhibits orexin receptor 1 expression and orexin-A induced intracellular calcium
signaling in acutely isolated duodenal enterocytes. Am J Physiol Gastrointest Liver
Physiol 296(3): G651-G658.
*Equal contribution as first author
11
12
Contents
Abstract
Acknowledgements
5 Abbreviations
7 List of original articles
11 Contents
13 1 Introduction
17 2 Review of the literature
19 2.1 Orexins .................................................................................................... 19 2.1.1 PPO gene and orexin peptides ...................................................... 19 2.1.2 Orexin receptors ........................................................................... 21 2.1.3 Orexin receptor signal transduction pathway ............................... 21 2.2 Physiological functions of orexins .......................................................... 23 2.2.1 Orexins and their receptors in the central nervous system ........... 23 2.2.2 The actions of orexins and their receptors on
sleep/wakefulness and its pathophysiological conditions............. 25 2.2.3 Feeding behaviour and energy homeostasis ................................. 30 2.2.4 Reward seeking systems and drug addiction ................................ 34 2.2.5 Orexins and their receptors in periphery ...................................... 35 2.2.6 Orexins and their receptors in the gastrointestinal tract ............... 36 2.2.7 Orexins and their receptors in the pancreas .................................. 38 2.2.8 Orexins and their receptors in the adrenal gland .......................... 39 2.2.9 Cardiovascular effects of orexins ................................................. 41 2.2.10 Orexins and their receptors in adipose tissue ............................... 42 2.2.11 Orexins and their receptors in gonads .......................................... 43 2.2.12 Distribution and function of orexins and their receptors in
other tissues .................................................................................. 44 2.2.13 Orexins in the circulation ............................................................. 44 2.3 Sleep and arousal .................................................................................... 45 2.4 Thermoregulation in mammals ............................................................... 49 2.4.1 Uncoupling proteins ..................................................................... 51 2.5 Duodenal bicarbonate secretion .............................................................. 54 2.5.1 Gastroduodenal defense................................................................ 54 2.5.2 Duodenal bicarbonate secretion.................................................... 55 3 Aims of the study
59 4 Materials and methods
61 13
4.1 Generation and characterization of hPPO overexpressing mice ............. 61 4.1.1 Generation and basic characterization of the mice ....................... 61 4.1.2 Surgery for polysomnography ...................................................... 66 4.1.3 EEG/EMG and video recording.................................................... 66 4.1.4 Physiological and behavioral analysis of the hPPO mice ............. 70 4.2 Effects of food deprivation on duodenal mucosal bicarbonate
secretion and orexin receptors’ expression in rat duodenal
mucosa and in acutely isolated duodenal enterocytes ............................. 71 4.2.1 Chemicals and drugs ..................................................................... 71 4.2.2 Animal preparation ....................................................................... 72 4.2.3 Intra-arterial infusions to the duodenum....................................... 73 4.2.4 I.c.v. infusions............................................................................... 74 4.2.5 Isolation of duodenal enterocytes ................................................. 74 4.2.6 Human biopsies and preparation of enterocytes ........................... 75 4.2.7 Calcium imaging .......................................................................... 76 4.2.8 Quantitative real-time PCR .......................................................... 76 4.2.9 Western blotting ............................................................................ 77 4.2.10 Data analyses ................................................................................ 78 5 Results
81 5.1 Generation and characterization of hPPO overexpressing mouse
line ........................................................................................................... 81 5.1.1 Basic characterization of the mice ................................................ 82 5.1.2 The characterization of the sleep-wake patterns in hPPO
overexpressing mice ..................................................................... 86 5.1.3 Physiological and behavioral analysis of the hPPO
overexpressing mice ..................................................................... 89 5.2 Effects of food deprivation on duodenal mucosal bicarbonate
secretion and orexin receptors expression in rat duodenal mucosa
and in acutely isolated duodenal enterocytes .......................................... 91 5.2.1 In situ experiments ....................................................................... 91 5.2.2 In vitro experiments ...................................................................... 96 5.2.3 Quantitative real-time PCR and Western blotting analysis
of orexin receptors ...................................................................... 100 6 Discussion
103 6.1 The generation and characterization of hPPO overexpressing
mice ....................................................................................................... 103 6.1.1 The characterization of the sleep-wake patterns ......................... 103 14
6.1.2 Effects of orexin overexpression on energy homeostasis ........... 105 6.2 Effects of overnight fasting on OXA induced duodenal
bicarbonate secretion..............................................................................110 6.3 Methodological considerations ..............................................................114 6.3.1 hPPO overexpressing mice ......................................................... 114 6.3.2 In situ and in vitro experiments studying the effects of
orexins on duodenal HCO3 secretion ........................................ 116 6.4 Future aspects.........................................................................................119 7 Conclusions
123 References
125 Original publications
155 15
16
1
Introduction
Orexins, or hypocretins, are peptides which were originally found from the
hypothalamus simultaneously by two research groups (de Lecea et al. 1998,
Sakurai et al. 1998). Since the discovery of the peptides, both terms have have
been used in the scientific literature, yet orexin a bit more frequently. During the
16th Acta Physiologica International Symposium on “10 Years of
Hypocretins/Orexins – Physiology and Pathophysiology” held at the University
and Biocenter of Oulu, Finland, from the 13th to 14th of August 2008, with both
primary discoverers present, no agreement could be found (Herzig & Purhonen
2010). Thus, in my thesis, I will use the word orexin to refer to the peptides and
their receptors. Orexins have been shown to be involved in the regulation of sleep
and wakefulness, energy homeostasis and autonomic functions (de Lecea et al.
1998, Sakurai et al. 1998, de Lecea & Sutcliffe 2005, Conti et al. 2006, Heinonen
et al. 2008, Tsujino & Sakurai 2009). Orexin-A (OXA) and Orexin-B (OXB) are
the active peptides, derived from the prepro-orexin (PPO) precursor protein by
proteolytic processing and posttranslational modification (Sakurai et al. 1998).
These peptides are ligands for two orphan G-protein-coupled receptors, the
orexin-1 receptor (OX1R) and orexin-2 receptor (OX2R). In 1999, Lin et al.
discovered that the reason for canine narcolepsy was a mutation in the OX2R
gene (Lin et al. 1999). Subsequent studies in animals and humans have confirmed
the involvement of the orexins and their receptors in narcolepsy, and initiated
research for other roles of the orexin system in the regulation of
sleep/wakefulness (Chemelli et al. 1999, Lin et al. 1999, Nishino et al. 2000,
Peyron et al. 2000, Hara et al. 2001, Tsujino & Sakurai 2009, Bonnavion & de
Lecea 2010). In particular, orexins might function in the maintenance and
stabilization of sleep and wakefulness and the inhibition of REM sleep. Since the
discovery of orexins, several studies have supported their role also in energy
homeostasis (Sakurai et al. 1998, Tsujino & Sakurai 2009). Orexins are known to
acutely promote appetite (Sakurai et al. 1998). Recent studies, however, have
proposed a more important role for them in the homeostasis of energy metabolism
(Tsujino & Sakurai 2009).
Orexins and/or their receptors are widely distributed in several tissues,
including the intestine, pancreas, adrenals, gonads and adipose tissue (Heinonen
et al. 2008). In the intestine, orexins are involved in the regulation of motility and
secretional mechanims. Flemström et al. demonstrated that a close-intra arterial
infusion of OXA induced duodenal bicarbonate ( HCO3 ) secretion in fed rats,
17
while a short overnight fast (16 h) abolished this response (Flemstrom et al. 2003).
Thus, the nutritional status (fasted or fed) might reflect on the expression of
orexin receptors in the duodenum.
The aim of the present thesis was to investigate the role of orexins and their
receptors in 1) sleep/wake patterns, 2) energy homeostasis and 3) intestinal
secretion. The effects of the orexin system on sleep/wakefulness and energy
homeostasis were studied using a newly created mouse line overexpressing
human PPO (hPPO) under its endogenous promoter. The role of orexins and their
receptors in duodenal HCO3 secretion was evaluated by the molecular analysis of
orexin receptors expression, in situ with duodenal perfusion in rats and in vitro
using calcium signaling methods.
18
2
Review of the literature
2.1
Orexins
Orexins, or hypocretins are peptides which were originally isolated from the
lateral hypothalamic area (LHA) simultaneously by two research groups (de
Lecea et al. 1998, Sakurai et al. 1998). De Lecea et al. discovered these two
secretin-like peptides from neuronal cell bodies of the dorsal and lateral
hypothalamic areas using subtractive cDNA cloning (de Lecea et al. 1998). Later
it was demonstrated that orexins are more similar to the bombesin family than to
secretins (Willie et al. 2001). The name hypocretin indicates that peptides are
synthesized in the hypothalamus, and their structure is similar to those of incretins.
Using a reverse pharmacology approach, Sakurai et al. published results from the
identification of OXA and OXB, and their receptors OX1R and OX2R (Sakurai et
al. 1998). When administered centrally, orexins increase food consumption in rats.
Therefore, the name “orexins” was derived from the Greek word orexis, which
means appetite. Amino acid sequences of OXA and hypocretin-1 are identical to
each other, with the exception of five additional amino acids in the N-terminus of
hypocretin-1 (de Lecea et al. 1998, Sakurai et al. 1998). There are no differences
between OXB or hypocretin-2 sequences. OXA and OXB are proteolytically
cleaved from a peptide precursor PPO prior to secretion (Sakurai et al. 1998).
Their actions are mediated via the two above mentioned G protein-coupled
receptors (GPCR), OX1R and OX2R. The OX1R mainly binds OXA, whereas
OX2R binds both OXA and OXB with similar affinities acting on both central
and peripheral sites.
2.1.1 PPO gene and orexin peptides
The hPPO gene is located on human chromosome 17q21 (Sakurai et al. 1998). Its
nucleotide sequence is 1432 base pairs (bp) in length and consists of two exons
and one intron (Figure 1) (Sakurai et al. 1999). Exon 1 consists of 143 bp that
covers 5´-untranslated region and first seven residues of secretory signal sequence.
Intron 1, which is located between two exons, is 816 bp long. The exon 2 contains
the rest of the open reading frame and 3´-untranslated region.
19
5´
hPPO gene
3´
Exon
1
Intron1
Exon2
Transcription
Splicing
hPPO mRNA
Cap
poly(A)
Translation
1
34
Signal
sequence
hPPO precursor peptide
66 70
OXA
97
131
OXB
Cleavage
Posttranslational modification(s)
OXA
OXB
<EPLPDCCRQKTCSCRLYELLHGAGNHAAGILTL-NH2
RSGPPGLQGRLQRLLQASGNHAAGILTM-NH2
OX1R
OX2R
PLC
Gi/
G0
Gq
Gq
PLD
Gs
PLC
Fig. 1. The processing of active orexin peptides from hPPO gene and orexin receptor
signaling. Modified from Sakurai et al. 1998, Sakurai et al. 1999, Tsujino & Sakurai 2009.
In addition to the hPPO gene, Sakurai with his colleagues described also a larger
hPPO gene fragment, which contains a 3149 bp 5´-flanking region and a 122 bp
5´-noncoding region (Sakurai et al. 1999). The hPPO gene with its endogenous
promoter directed the expression of the fused Escherichia coli β-galactosidase
(lacZ) gene, with SV40 antigen nuclear localization signal, in the transgenic mice
LHA. This genomic fragment makes possible to study the effects of exogenous
molecules produced in orexin neurons.
Mature PPO mRNA is encoded by exons 1 and 2 and translated into a
precursor polypeptide PPO (Figure 1) (Sakurai et al. 1998). OXA and OXB
peptides are cleaved from 130-residue (rodents) and 131-residue (human) PPO by
proteolytic processing. Mouse PPO is 95% identical to that of the rat sequence,
while human PPO has 83% similarity to both mouse and rat sequences. OXA is a
33-amino-acid long peptide with a molecular mass of 3562 Dalton. It has an Nterminal pyroglutamyl residue, C-terminal amide, and two intrachain disulfide
bonds (Cys6 – Cys12, Cys – Cys14) (Figure 1) resulting an rigid turn between the
Arg8 and Thr11 residues (Sakurai et al. 1998, Kim et al. 2004). Human, mouse,
20
rat and bovine OXA are identical to each other (Sakurai et al. 1998). Rat OXB is
a 28-amino-acid long linear peptide of 2937 Dalton, with a C-terminal amide
(Figure 1). It shares a 46% identity in amino-acid sequence compared with OXA,
so that the C-terminal half of the OXB is highly similar to that of OXA. The
mouse OXB sequence is identical to a rat´s, while human OXB differs from those
by two amino acids (Pro2 and Asn18 are converted to Ser2 and Ser18,
respectively). Both orexins consist of two α-helices. In human OXA, helix 1 is
comprised of the residues Cys14 – His21 and helix 2 Asn 25 – Leu31 (Kim et al.
2004). For human OXB, the α-helices range from the residues Leu7 to Ser18 and
from Ala22 to Met28 (Lee et al. 1999, Miskolzie et al. 2003, Lang et al. 2006).
Both orexin receptors are capable of mediating the action of OXA after a segment
conformation of the peptide between residues 6–14 (Lang et al. 2006). For OXB,
the conformation at position 20 is crucial for selectivity of OX2R over OX1R.
2.1.2 Orexin receptors
Orexins bind and mediate their action through OX1R and OX2R (Figure 1)
(Sakurai et al. 1998, Kukkonen et al. 2002). Human amino acid sequences of the
two orexin receptors show 64% homology. Orexin receptors are also highly
conserved between different species. Human OX1R shares a 94% identity when
compared with rat amino acid sequence, and OX2Rs have a 95% similarity
between these two species. The results from a competitive radioligand binding
assay using Chinese hamster ovary (CHO) cells showed that OX1R mainly binds
OXA, whereas OX2R binds both OXA and OXB, with similar affinities. In a
mouse, OX1R is 416 amino acids (aa) in length, while there are actually two
different splice variants from OX2R; mOX2αR (443 aa) and mOX2ßR (460 aa)
(Chen & Randeva 2004). Since these two variants are differently distributed in
mouse tissues and 24 h food deprivation elevated more hypothalamic mOX2ßR
gene expression when compared with both mOX1R and mOX2αR levels, these
variants have been suggested to possess a different physiological role. However,
no difference was observed between OXA and OXB binding properties for
different splice variants.
2.1.3 Orexin receptor signal transduction pathway
The activation of OXRs, especially OX1Rs, leads to a Ca2+ influx in native
neurons and in the neuroendocrine cell line STC-1 (van den Pol et al. 1998, van
21
den Pol 1999, van den Pol et al. 2001, Uramura et al. 2001, Larsson et al. 2003).
Similar Ca2+ influx was observed in neuron/neuroendocrine cells, as well as CHO
cells which express heterologously OX1Rs (Lund et al. 2000, Holmqvist et al.
2002, Larsson et al. 2005). Zhu et al. demonstrated that OX1R is coupled to the
Gq class of G-proteins as shown in Figure 1 (Zhu et al. 2003). Furthermore, at low
orexin concentrations, OX1Rs activate the receptor-operated Ca2+ (ROC) influx
pathway (Lund et al. 2000, Kukkonen & Akerman 2001). At high orexin
concentrations, OX1R activation induces phospholipase C (PLC) dependent Ca2+
release and secondary store operated Ca2+ (SOC) influx (Mazzocchi et al. 2001a,
Karteris et al. 2004, Karteris et al. 2005). The activation of PLC is observed in
the endocrine cells of adrenal glands and testis. The ROC influx pathway includes
also extracellular signal-regulated kinase (ERK) and the PLC responses, whereas
the SOC influx supports the PLC response (Ammoun et al. 2006a, Johansson et al.
2007). The ERK pathway has also been reported to be protective for the cells,
while the p38 pathway seems to be essential for the induction of cell death
(Ammoun et al. 2006b). Further studies have demonstrated the participation of
phospholipase D (PLD) in orexin receptor activation (Johansson et al. 2008). The
production of 3'-5'-cyclic adenosine monophosphate (cAMP) has been
demonstrated in adrenal cortical cells, CHO cells, and in hypothalamic neurons
(Malendowicz et al. 1999, Mazzocchi et al. 2001a, Holmqvist et al. 2005,
Karteris et al. 2005). Recently, it was also shown that OX1R activation leads to
arachidonic acid release, indicating the importance of an ubiquitous
phospholipase A2 (PLA2) in signal transduction (Turunen et al. 2009).
In human adrenal glands, expressing OX2R as a predominant receptor, the
dependence of G-proteins machinery (Gs, Gq and Gi; Figure 1) in OXA induced
receptor activation has been suggested (Randeva et al. 2001, Karteris et al. 2005).
Binding of the orexins to the OX2R also results in an activation of the PLC
signaling pathway (Zhu et al. 2003). A dose and time dependent increase in
ERK1/2 and p38 pathways, by both OXA and OXB, was observed in HEK-293
cells overexpressing human OX2R (Tang et al. 2008). ERK1/2 seems to be
activated by Gs, Gq/11 and Gi, while the activation of p38 is mediated by Gi
signaling. In addition, in human H295 adrenocortical cells, both orexins mediate
their actions mainly through OX1R, but also through OX2R via ERK1/2 and p38
pathways (Ramanjaneya et al. 2009).
22
2.2
Physiological functions of orexins
The wide distribution of orexins and their receptors suggests that they might play
a role in several physiological systems, including arousal and sleep-wakefulness,
feeding, energy homeostasis, gastrointestinal motility and secretion, glucose
homeostasis, cardiovascular, reward-seeking and addiction (Figure 2) (Heinonen
et al. 2008, Tsujino & Sakurai 2009, Boutrel et al. 2010).
CNS
Wakefulness
Sleep
Food intake
Metabolic rate
Addiction
Heart
Heart rate
Blood pressure
Adrenals
Sympathetic tone
Epinephrine release
Glucocorticoid release
Stomach
HCl secretion
Motility
WAT
PPAR-γ-2
Lipolysis
Orexins
Intestines
Testis
Bicarbonate secretion
Motility
Spermatogenesis
Pancreas
Insulin secretion
Ovaries
Reproduction
Fig. 2. The functions of orexins in central nervous system and periphery. Modified
from Heinonen et al. 2008, Tsujino & Sakurai 2009, Boutrel et al. 2010.
2.2.1 Orexins and their receptors in the central nervous system
In 1998, Sakurai et al. showed that PPO mRNA, as well as OXA protein, are
localized in the neurons of the lateral and posterior hypothalamic areas and in the
perifornical nucleus of the rat brain (Sakurai et al. 1998). Hypothalamic PPO
mRNA levels are increased after 48 h fasting in rats (Sakurai et al. 1998, Cai et al.
1999). Interestingly, OXA peptide levels, when measured by enzyme
immunoassay from lateral hypothalamus homogenate of 48 h fasted rats, were
reduced, instead of the predicted increase (Gallmann et al. 2006). The rate of
23
OXA release and degradation might have increased at the synapses in target
regions. On the other hand, the vesicular storage capacity might have decreased in
the presynaptic terminals. The presence of PPO and orexin-immunoreactivity was
demonstrated also in the dorsomedial hypothalamic nucleus (DMH) (Peyron et al.
1998, Nambu et al. 1999). In addition, both in situ hybridization and
immunohistochemical analyses verified the presence of PPO and OXA also in the
subthalamus, the zona incerta, subincertal, and subthalamic nuclei (Sakurai et al.
1998).
Orexin-immunoreactive axons and terminals were detected in the
hypothalamic arcuate nucleus (ARC) and paraventricular nucleus (PVN) (Peyron
et al. 1998). OXA immunoreactive fibres were detected around the
suprachiasmatic nucleus (SCN) in Syrian and Siberian hamsters, while in rats
OXA immunoreactivity was present in SCN (McGranaghan & Piggins 2001).
Orexin-immunoreactive axons and terminals were detected throughout the rat
brain, including cerebral cortex, circumventricular organs, thalamus
(paraventricular nucleus), limbic system (hippocampus), and locus coeruleus (LC)
and raphe nuclei located in a brain stem (Nambu et al. 1999). The use of OXA
and OXB specific antibodies revealed differential distribution of the peptides in
the rat brain and spinal cord (Cutler et al. 1999). The OXA immunoreactive fibres
were found in the spinal cord, and near ventricles. In addition, orexinimmunoreactive descending axon projections are found in mouse, rat and human
cervical cord (van den Pol 1999). In human brains, OXA has been detected
abundantly in the hypothalamus, thalamus, medulla oblongata, and pons (Arihara
et al. 2000).
OXB immunoreactive cell bodies were found in the LHA and perifornical
nucleus (Cutler et al. 1999, Date et al. 1999). OXB fibres, however, were sparse
in areas receiving projections from OXA. Another study showed more wideranging projections also for OXB fibres in rat brain (Date et al. 1999). OXB had
projections into the hypothalamus, thalamus, cerebral cortex, olfactory bulb, and
brainstem. The differences between the two studies can probably be explained by
differences in the antibodies (Cutler et al. 1999, Date et al. 1999). Both peptides
are expressed also in the human pituitary (Blanco et al. 2003).
Both OX1R and OX2R are present in the rat brain at mRNA level (Sakurai et
al. 1998). Subsequent studies revealed a specific distribution of orexin receptors
(Trivedi et al. 1998, Lu et al. 2000b). OX1R mRNA is mostly expressed in the
ventromedial hypothalamic nucleus while the OX2R mRNA can mostly be found
in the PVN. Both receptors are also present, however, to a lesser extent in DMH.
24
In addition, Lu et al. demonstrated the moderate expression of OX2R mRNA in
the ARC while Trivedi et al. could not detect it (Trivedi et al. 1998, Lu et al.
2000b). OX1R mRNA is highly expressed in tenia tecta, parts of the hippocampal
area, dorsal raphe nucleus, and LC (Trivedi et al. 1998). OX1R as well as OX2R
can also be found in basal forebrain (BF) areas (Trivedi et al. 1998, Lu et al.
2000b). OX2R mRNA can be found in the cerebral cortex, nucleus accumbens,
subthalamic and paraventricular thalamic nucleus as well as in the anterior
pretectal nucleus (Trivedi et al. 1998). The presence of OX2R was verified in the
ventral tegmental area (VTA) (Trivedi et al. 1998, Lu et al. 2000b). Both
receptors have also other projections within the central nervous system (CNS).
Immunohistochemical studies confirmed the expression of OX1R in the rat
brain and spinal cord also at protein level (Trivedi et al. 1998, Lu et al. 2000b,
Hervieu et al. 2001). The highest OX1R levels are detected in hypothalamic and
thalamic nucleus, as well as in the LC. OX1R immunoreactivity can also be found
in rat SCN (Backberg et al. 2002). The distribution of OX1Rs in other brain areas
was generally in line with the existent mRNA data. Both receptors are present in
rat pontine neurons, OX2R however to a lesser extend. In contrast to OX1R, the
expression of OX2R cannot be clearly seen in LC. Results from Blanco et al.
demonstrated the presence of OX1R in somatotrope cells of the pituitary, while
OX2R was expressed in corticotrope cells (Blanco et al. 2001).
Both orexins and their receptors are present in the CNS and they have wide
projections suggesting their involvement in many different physiological
processes (Peyron et al. 1998, Trivedi et al. 1998, Cutler et al. 1999, Date et al.
1999, Nambu et al. 1999, Lu et al. 2000b).
2.2.2 The actions of orexins and their receptors on
sleep/wakefulness and its pathophysiological conditions
The involvement of orexins and their receptors in sleep/wakefulness, especially in
narcolepsy, were found soon after the identification of orexins (Peyron et al. 1998,
Chemelli et al. 1999, Horvath et al. 1999, Lin et al. 1999, Nishino et al. 2000). In
1999, Lin et al. discovered that an autosomal recessive mutation in the OX2R
gene causes narcolepsy in Doberman pinschers (Lin et al. 1999). The mutation is
caused by an insertion of a short interspersed nucleotide element (SINE) into the
third intron of the OX2R gene. As a result, the exon 4 is skipped in the splicing
event and the exon 3 is spliced directly into exon 5. The mutated OX2R gene is
coding for a truncated version of the OXR2 peptide. Labrador retrievers suffering
25
narcolepsy were found to carry a mutation caused by a G to A transition in the 5´
splice junction consensus sequence, leading to a skipping of exon 6, and finally,
to a C-terminally truncated OX2R peptide. Due to the latter mutations, the
receptor does not localize onto the membrane. In the Dachshund, narcolepsy is
caused by a single point mutation in the OX2R gene, which leads to an amino
acid change (E54K) in the N-terminal part of the peptide (Hungs et al. 2001). The
resultant receptor protein product cannot bind orexins. Narcoleptic Dobermans
have significantly elevated levels of OXA at birth, while the levels are decreased
at four weeks of age when the first symptoms are observed and then increased
again (John et al. 2004).
In 1999, Chemelli et al. introduced a PPO knockout (OX-KO) mouse model
(Chemelli et al. 1999). Due to the targeted disruption of the PPO gene, these mice
exhibit a phenotype similar to human and canine narcolepsy. OX-KO mice show
brief periods of ataxia, increased rapid eye movement (REM) sleep, and direct
transitions from wakefulness to REM sleep. During the day time OX-KO mice
show shortened REM sleep latency. However, the greatest differences between
OX-KO and their wild type (wt) littermates were observed during the night time,
when the mice are normally the most active. As with REM sleep time, the REM
episode duration is significantly increased in OX-KO mice. These results are
further supported by the fact, that OX-KO mice exhibit decreased intervals
between successive REM sleep episodes. In addition, these mice showed an
increase in non-rapid eye movement (NREM) sleep time, as well as a decrease in
awake time, and awake episode duration, which indicate a fragmented sleep-wake
cycle. Orexin/ataxin-3 mice express a toxic truncated Machado-Joseph disease
gene product, ataxin-3 in their orexin producing neurons, leading to the ablation
of these neurons within two weeks after birth (Hara et al. 2001). These mice
exhibit a phenotype highly similar to that of human narcolepsy. The results
relating to sleep state patterns are similar to those observed in OX-KO mice.
During the light period, however, orexin/ataxin-3 mice show significant decreases
in time spent in REM sleep, as well as episode duration of wake state when
compared with wt mice. Authors also reported about direct transitions from wake
state to REM sleep in the mice in the light period. Interestingly, orexin/ataxin-3
mice are obese, indicating a decreased metabolic rate. Since the expression of
ataxin-3 eliminates also other co-expressed neurotransmitters, such as dynorphin,
pentraxin (Narp), and precursor-protein convertase (PC1) in the orexin neurons,
the observed results might not reflect only the functions of orexins (Chou et al.
2001, Hara et al. 2001, Reti et al. 2002, Nilaweera et al. 2003, Hara et al. 2005,
26
Zhang et al. 2007). A rat model with an expression of ataxin-3 in its orexin
producing neurons exhibits also a narcoleptic phenotype similar to that of OX-KO
and orexin/ataxin-3 mice (Beuckmann et al. 2004). Similarly, rats with small
interfering RNA (siRNA) mediated knockdown of PPO show an altered diurnal
distribution of REM sleep, cataplexy and sleep-onset REM (Chen et al. 2006).
Interestingly, OX1R knockout mice do not exhibit behavioral arrest at all, and
overall, the narcolepsy phenotype is less severe (Kisanuki et al. 2000, Kisanuki et
al. 2001). In contrast, OX2R knockout mice differ from OX-KO mice by milder
cataplexy-like attacks, and infrequent direct transitions from wakefulness to REM
sleep (Willie et al. 2003). In addition, sleep attacks were not related to REM sleep
transitions or atonia. OX1R/OX2R double receptor knockout mice exhibit a
phenotype similar to that of OX-KO mice (Kisanuki et al. 2000, Kisanuki et al.
2001). Preliminary results from mice overexpressing rat PPO under a βactin/cytomegalovirus hybrid promoter (CAG/orexin) showed a suppression of
REM sleep during the day time and fragmented NREM sleep (Mieda et al. 2004b,
Mieda et al. 2006b).
In humans, narcolepsy results from both genetic and environmental factors
(Mignot et al. 1997, Mignot et al. 2001). Most of the human cases of narcolepsy
are sporadic and they associate with HLA-DQB1*0602. Peyron et al. showed that
only one narcoleptic patient out of 74 was carrying an orexin gene mutation
(Peyron et al. 2000). This further implicates that narcolepsy in humans is not a
simple genetic disease. It should be noted that HLA-DQB1*0602 positivity
decreases among those patients with less severe, or no cataplexy (Mignot et al.
1997). In addition, some of the controls are also HLA-DQB1*0602 positive
(Pelin et al. 1998, Mignot et al. 2001). PPO mRNA is absent in hypothalami of
narcoleptic patients (Peyron et al. 2000). Immunohistochemical studies from
human narcolepsy subjects showed about a 90% reduction in the number of
orexin containing neurons (Thannickal et al. 2000). Both Peyron and Thannickal
demostrated that only orexin neurons are lost in human narcolepsy, while orexin
co-existent melanin-concentrating hormone (MCH) neurons can still be found
(Peyron et al. 2000, Thannickal et al. 2000). Radioimmunoassay (RIA) results
from human narcolepsy-cataplexy patients revealed a total absence of orexin in
cerebrospinal fluid (CSF) in most of the cases (Nishino et al. 2000, Ripley et al.
2001).
Human patients with narcolepsy and animal models with a failure or a loss on
function of the orexin system have problems maintaining wakefulness (Chemelli
et al. 1999, Lin et al. 1999, Nishino et al. 2000, Hara et al. 2001, Beuckmann et
27
al. 2004). Alam et al. studied the activation of all neurons in the perifornicallateral hypothalamic area (PF-LHA) and demonstrated that 53% of neurons were
activated during wakefulness and REM sleep, while in NREM sleep, the firing of
these neurons decreased (Alam et al. 2002). In addition, 38% of the neurons were
activated only in wake state. This indicates the importance of the PF-LHA area in
the regulation of sleep-waking states. Lee et al. recorded the activity of orexin
neurons in rats and demonstrated that these cells discharge during active waking,
which is associated with high postural muscle tone (Lee et al. 2005). In contrast,
neurons stop firing during sleep when the postural muscle tone has decreased or
totally disapeared.
Orexin system neurons have wide projections to various areas both in the
brain and brainstem (Hagan et al. 1999, Brown et al. 2002, Liu et al. 2002,
Yamanaka et al. 2002, de Lecea & Sutcliffe 2005, Tsujino & Sakurai 2009).
These areas include noradrenergic LC neurons, serotonergic dorsal raphe neurons
and histaminergic tuberomammillary nucleus (TMN) neurons. All of these
monoaminergic neurons are activated by orexins. These neurons fire fast during
wakefulness, slow down, and finally even stop in NREM sleep and REM sleep,
respectively (Saper et al. 2001). A microinjection of OXA into the LC increases
wakefulness and suppresses REM sleep in rats (Bourgin et al. 2000). Interestingly,
only OX1Rs can be found in the LC. A local infusion of OXA into the dorsal
raphe nucleus creates an increase of extracellular serotonin, or 5hydroxytryptamine (5-HT) in rats (Tao et al. 2006). OXB, however, causes
increased 5-HT levels, both in the dorsal raphe nucleus as well as the medial
raphe nucleus. Delivery of OXA into the TMN increases also wakefulness, and
decreased the amounts of NREM and REM sleep in rats (Huang et al. 2001).
Furthermore, infusion of OXA into the lateral ventricle of histamine H1 receptor
KO mice did not increase wakefulness, indicating the importance of the
histaminergic system in orexin mediated arousal. A recent study showed that
maintenance of sleep/wake states does not require histamine H1 receptors or
OX1Rs (Hondo et al. 2009). It was speculated that the OXR2 mediated pathway
does not require the histaminergic system in sleep/wake regulation. All of the
latter structures send projections throughout the BF, which is suggested to have an
important role in arousal (Saper et al. 2001, de Lecea & Sutcliffe 2005, Arrigoni
et al. 2009). Orexins show an exitatory action on BF cholinergic neurons
(Eggermann et al. 2001). Intrabasalis delivery of OXA increases acetylcholine
release within the prefrontal cortex in rats (Fadel et al. 2005). Orexin infusion
into the BF increases wakefulness (Espana et al. 2001, Thakkar et al. 2001).
28
Orexin neurons also project to the laterodorsal tegmental nucleus (LDT) and
peduncolopontine nucleus (PPT) (Peyron et al. 1998, Nambu et al. 1999). In
these areas, cholinergic neurons promote either wakefulness or REM sleep (Saper
et al. 2001). Orexins excite cholinergic neurons in LTD (Burlet et al. 2002,
Takahashi et al. 2002). Furthermore, Xi et al. showed that administration of OXA
into cat LDT increases wakefulness and decreases REM sleep (Xi et al. 2001).
Recently, whole cell recordings demonstrated that orexins have an excitatory
effect on PPT neurons (Kim et al. 2009). In addition, it has been proposed that
orexins may have an interplay with other signaling molecules, such as dynorphin,
to promote arousal (Arrigoni et al. 2009, Kantor et al. 2009).
Orexin neurons receive an input from GABAergic neurons of the
ventrolateral preoptic area (VLPO) (Sakurai et al. 2005, Yoshida et al. 2006,
Tsujino & Sakurai 2009). Neurons in the VLPO fire rapidly during sleep, and they
have been proposed to have a role in the initiation of NREM sleep. In addition,
these neurons function in the maintenance of NREM and REM sleep (Sherin et al.
1996, Szymusiak et al. 1998, Lu et al. 2000a). Reverse transcription-polymerase
chain reaction (RT-PCR) analysis demonstrated the presence of gammaaminobutyric acid (GABA) in the latter neurons (Gallopin et al. 2000, Tsujino &
Sakurai 2009). In addition, their action was inhibited by noradrenaline and
acetylcholine. Furthermore, during sleep, when the neurons are active, they
inhibit monoaminergic and cholinergic nuclei. Thus, GABAergic neurons might
send inhibitory projections to orexin neurons during sleep (Tsujino & Sakurai
2009).
Several studies have proposed a role for growth hormone-releasing hormone
(GHRH) as a sleep-promoting substance (Steiger 2007). I.c.v. injection of OXA
decreased GHRH mRNA levels in the paraventricular nucleus in rats (Lopez et al.
2004). Therefore, the authors speculated that the latter could partly be in response
to an inhibitory action of OXA on REM sleep. In addition, i.c.v administration of
OXA significantly decreased the mean growth hormone levels in continuously fed
rats (Seoane et al. 2004).
In vivo photostimulation of orexin neurons increased the probability of
transition to wakefulness from the sleep (Adamantidis et al. 2007). In the
zebrafish model, inconsistent results about insomnia after genetic manipulation of
the orexin system have been reported (Panula 2010). Prober et al. described
increased locomotor activity and an insomnia-like phenotype with orexin
overexpression, whereas Yokogawa reported an insomnia-like phenotype with
orexin receptor mutants (Prober et al. 2006, Yokogawa et al. 2007). Since sleep
29
can be promoted by a pharmacological blockade of both orexin receptors, orexin
receptor antagonists have been tested for the treatment of insomnia (BrisbareRoch et al. 2007, Roecker & Coleman 2008, Hoever et al. 2010). Both promising
and unpromising results have been obtained and orexin receptors antagonists are
still under intensive research (Brisbare-Roch et al. 2007, Cox et al. 2010).
2.2.3 Feeding behaviour and energy homeostasis
Overweight and obesity, physical conditions of people with a body mass index
(BMI) equal or more than 25 kg/m2 and 30 kg/m2, respectively, are defined as
abnormal or excessive fat accumulation that causes a risk to health (WHO 2010).
Increased food intake and reduced physical activity are major factors for the
development of overweight and obesity. According to World Health Organization
estimations for 2010, in Finland, the prevalence for 15–100 year old males and
females having a BMI ≥ 25 kg/m2 are 67.1% and 54.5%, respectively, while the
same numbers for people with BMI ≥ 30 kg/m2 are 20.9% and 19.4%. In the USA,
the numbers are even higher, 80.9% and 76.7% for males and females with BMI ≥
25 kg/m2 and 44.2% and 48.3% for people with BMI ≥ 30 kg/m2, respectively. In
addition to assisting the continuous struggle for healthier diets and increased
physical activity, obesity research has focused on the investigation of obesity
related genes.
In general, two sets of neuronal populations in hypothalamic ARC have a key
role in the regulation of feeding behaviour (Simpson et al. 2009). The first
pathway involves the orexigenic neuropeptide Y/agouti related peptide
(NPY/AgRP) expressing neurons, while the other set consists of the anorexigenic
pro-opiomelanocortin/cocaineand
amphetamineregulated
transcript
(POMC/CART) neurons. These neurons project and/or have projections to/from
other hypothalamic regions or central locations important in the modulation of
feeding. In addition, the CNS receives peripheral satiety and hunger signals
directly or indirectly from hormones and peptides, such as from leptin,
cholecystokinin (CCK) and ghrelin.
Orexins have been shown to be involved in feeding behaviour and energy
homeostasis (Sakurai et al. 1998). In addition, orexins and their receptors have
been shown to localize especially in the LHA, which is commonly known for its
actions on feeding behaviour and energy homeostasis (Sakurai et al. 1998,
Elmquist et al. 1999). At first, it was shown by Sakurai et al. that a single
injection of OXA or OXB into the left lateral ventricle promotes acute daytime
30
feeding in rats (Sakurai et al. 1998). An injection of OXA, but not OXB, into the
third ventricle given during light period induces feeding also in mice (Lubkin &
Stricker-Krongrad 1998). Intracerebroventricular (i.c.v.) administration of OXA
(12 nmol/day) for seven days increased daytime food intake, however with only a
slight decrease in the night time food intake, and with no or only a small increase
in body weight in rats (Yamanaka et al. 1999). In another study, chronic i.c.v.
infusion of OXA (18 nmol/day) increased daytime feeding but also decreased
nocturnal feeding in rats (Haynes et al. 1999). In addition, OXA had no effect on
total body weight. A 6 day intraparaventricular administration of OXA (0.5 nmol)
induced weight loss in rats, with no difference in food intake, but an increase in
physical activity (Novak & Levine 2009). OXA, but not OXB, enhanced the food
intake in rats when injected directly into the LH, PVN, DMN and the perifornical
hypothalamus (Dube et al. 1999). However, direct injections of orexins had no
effect in the ARC, VMN, preoptic area, or in the central nucleus of the amygdala
(CeA). Intraperitoneally (i.p.) administered selective OX1R antagonist, SB334867, with a 50-fold higher selectivity over OX2R, reduced food intake in rats,
even after 18 h fasting (Haynes et al. 2000, Smart et al. 2001). Furthermore,
intracisternally added OXA antibody decreased remarkably food intake in 24 h
fasted rats (Yamada et al. 2000). Surprisingly, in rhesus monkeys, i.c.v. injection
of OXA resulted in decreased food intake, and OXB had no effect at all,
indicating that orexins may not play a role in short-term food intake in primates
(Ramsey et al. 2005). In addition, i.c.v injected OXA has no effect on food intake
in old rats (Takano et al. 2004). Thus, the orexin system might change during
aging. This is in line with the findings that the expressions of PPO mRNA as well
as both orexins on protein level are decreased in 12 month old rat brains (PorkkaHeiskanen et al. 2004). Aging does not have an effect on PPO mRNA levels in
mice (Terao et al. 2002). However, OX1R mRNA levels reduced in the
hippocampus, and OX2R mRNA levels in several different brain areas in aging
mice. In contrast, a recent study showed that also the amount of orexin
immunospecific neurons in mice starts to decline at the age of 400 days (Brownell
& Conti 2010).
LHA contains glucose sensitive neurons, which are activated by
hyperglycemia or hypoglycemia (Tsujino & Sakurai 2009). These cells are
considered to act in the short term-regulation of feeding and energy homeostasis.
They respond to changes in extracellular glucose contents by firing either exciting
(glucose excited) or inhibiting (glucose inhibited) neurons. As mentioned before,
during fasting, mRNA levels of orexins in the LHA are upregulated (Sakurai et al.
31
1998, Cai et al. 1999). It has been proposed that orexin neurons might have a role
as sensors of the whole body’s nutritional status. To support this idea, using
whole-cell patch-clamp recordings, it was shown that isolated orexin neurons are
glucose sensitive, or in other words, glucose inhibited neurons (Yamanaka et al.
2003). The neurons responded to increased glucose concentrations by
hyperpolarization and cessation of action potentials, while the decreased glucose
caused a depolarization and increased the frequency of action potentials. In
addition, leptin was also found to inhibit orexin neurons, while ghrelin activates
them. Later, Burdakov et al. demonstrated the effect of a glucose induced
inhibition of the firing of orexin neurons (Burdakov et al. 2005). Furthermore,
glucose inhibition seems to be mediated by an opening of “leak” K+ (K2P)
channels, sensing changes in fluctuations of glucose (Burdakov et al. 2006).
OX-KO mice are hypophagic, but they gain slightly more weight than their
wt littermates (Chemelli et al. 1999, Hara et al. 2001, Willie et al. 2003). In
addition, these mice show reduced locomotor activity during the night time.
However, the increase in weight is more likely due to a reduced metabolic rate
than reduced activity. In contrast, mice overexpressing rat PPO, under βactin/cytomegalovirus hybrid promoter (CAG/orexin), show a reduced total and
body weight adjusted intake of high fat diet, accompanied with increased energy
expenditure and lowered body weight (Funato et al. 2009). In addition, Lubkin &
Stricker-Krongrad showed that an injection of OXA into the third ventricle of wt
mice increases the metabolic rate (Lubkin & Stricker-Krongrad 1998). Several
studies have shown that orexin deficiency in narcoleptics is by some means
related to obesity (Lammers et al. 1996, Hara et al. 2001, Kok et al. 2003).
Narcoleptics are obese in spite of reduced feeding, suggesting a decreased
metabolic rate. In contrast, rats treated with daily OXA into the paraventricular
nucleus show a lowered body weight with no difference in food intake (Novak &
Levine 2009). Microinjections resulted also in increased physical activity.
In addition to LHA, areas like VMH, DMH and ARC have a role in feeding,
as well as in energy homeostasis (Elmquist et al. 1999, Tsujino & Sakurai 2009).
Orexin neurons send projections to ARC, and they also receive innervation from
NPY and AgRP neurons, which are important for feeding, as well as from αmelanocyte stimulating hormone (α-MSH) fibres, whose product α-MSHs are
cleaved from POMC, and are essential for satiety (Elias et al. 1998, Peyron et al.
1998, Date et al. 1999, Schwartz et al. 2000). I.c.v. administration of OXA causes
an increase in c-Fos expression in rat NPY neurons, suggesting the involvement
of NPY in OXA induced feeding (Yamanaka et al. 2000). Furthermore, treatment
32
of isolated rat ARC NPY neurons with OXA resulted in increased cytosolic Ca2+
concentration (Kohno et al. 2008). Again, OXA does not stimulate food intake in
the rats with impaired NPY system (Moreno et al. 2005). Whole-cell patch-clamp
recordings from rat brain slices showed that orexin, as well as ghrelin, activate
NPY/AgRP neurons, while leptin inhibits orexins (van den Top et al. 2004).
Another study confirmed the latter with recordings from NPY cells showing a
direct excitatory effect of arcuate nucleus NPY neurons in response to OXA (Li &
van den Pol 2006). POMC KO mice have elevated PPO mRNA levels in the LHA,
suggesting a close interaction between α-MSH and the orexin system (Lopez et al.
2007). In addition, OXA and OXB decreased [Ca2+]i levels in POMC-containing
neurons in rats. In addition, glucose-responsive neurons of the VMH responded to
the administration of orexins by decreased [Ca2+]i levels (Muroya et al. 2004).
Furthermore, whole-cell patch-clamp recordings showed that OXA decreases the
action potential firing of mouse POMC neurons (Ma et al. 2007).
Nucleus accumbens also has a role in food intake (Zheng et al. 2003, Tsujino
& Sakurai 2009). In 2003 Zheng et al. demonstrated that injection of the GABAA
agonist muscimol into the nucleus accumbens shell of rats resulted in an increase
in Fos expression in orexin neurons and food intake (Zheng et al. 2003). Similar
results were observed later by Baldo et al. (Baldo et al. 2004). Later, it was shown
that orexin signaling may affect the nucleus accumbens stimulated need for highfat food (Zheng et al. 2007). On the other hand, infusion of OXA into the medial
portion of the accumbens shell increased food intake and locomotor activity in
rats (Thorpe & Kotz 2005). The authors speculated that OXA may act through the
accumbens shell to affect feeding behavior and locomotor activity.
Circadian clocks are important biological timekeeping mechanisms which
enable organisms to predict their customary cycling events (Challet 2010). The
main circadian clock in mammals is located in the suprachiasmatic nuclei (SCN)
of the hypothalamus, from where it coordinates the timing of other local
oscillators located in the brain and periphery. However, another circadian system
is responsible for preparing animals for their ongoing or next meal. When food is
given to rodents at restricted times, i.e. scheduled times, they start to show food
anticipatory activity (FAA) (Mistlberger 2009). The increase in the locomotor
activity begins 1–3 h before the animals have the possibility to access their food.
Since the FAA is not abolished by the lesions of the SCN, it is believed that a
food-entrainable oscillator (FEO) is situated elsewhere than in the SCN (Stephan
2002). Recently, it was shown that Fos expression in orexin neurons, as a marker
of neuronal activation, increased during the food anticipatory period (Mieda et al.
33
2004a). In addition, due to restricted feeding, the Fos expression in OXA
immunoreactive cells from mouse brain shifted from night to day (Akiyama et al.
2004). Furthermore, orexin/ataxin-3 mice display impaired FAA. OX-KO mice
exhibit a similar behaviour, indicating the importance of the orexin system in the
locomotor activity in FAA (Kaur et al. 2008). The mRNA expressions of genes
that are suggested to participate in the regulation of food entrainment of circadian
rhythms, like mNpas2, mPer1 and mBal1, are also reduced in the forebrain of
orexin/ataxin-3 mice (Wakamatsu et al. 2001, Dudley et al. 2003, Akiyama et al.
2004, Fuller et al. 2008). Mieda et al. demonstrated later, that during restricted
feeding, Per genes were oscillated actively in the DMH (Mieda et al. 2006a,
Tsujino & Sakurai 2009). Since DMH neurons project to orexin neurons,
interactions between DMH neurons and orexin neurons might have an important
function in FEO (Sakurai et al. 2005, Mieda et al. 2006a, Tsujino & Sakurai
2009).
2.2.4 Reward seeking systems and drug addiction
Previous publications have implicated a role for orexins also as a target for
substance abuse and eating disorders (Lawrence et al. 2006). LHA is a well
known area for its importance in reward and drug addiction (DiLeone et al. 2003).
In 2003, Georgescu et al. demonstrated that µ-opioid receptors are present in
LHA orexin neurons. These neurons are affected by a chronic morphine
administration and a morphine withdrawal by opioid antagonist naloxone
(Georgescu et al. 2003). In addition, OX-KO mice do not possess normal
behavioral signs of withdrawal from morphine. Two-chamber, nonbiased,
conditioned place-preference studies showed that orexin neurons are Fosactivated also after morphine, cocaine and food rewards in rats (Harris et al.
2005). Thus, it further indicates the role of orexin neurons in reward-seeking and
addiction. In addition, orexin neurons have been shown to innervate the VTA and
nucleus accumbens, which are known for their actions on rewards (Fadel &
Deutch 2002). OXA microinjected into the VTA in rats resulted in a reinstatement
response for morphine (Harris et al. 2005). In addition, microinjection of SB334867 into VTA prevents the morphine-induced place preference in rats (Narita
et al. 2006). Furthermore, injection of OXA or OXB into VTA increased the
levels of dopamine in the nucleus accumbens. These data indicate the role of
orexin neurons in the VTA in the morphine-induced rewarding effect, which is
associated with an activation of the mesolimbic dopamine system. Accordingly,
34
also other studies have shown the importance of the orexin signaling in the VTA
in neural plasticity relevant to addiction, but also the possibility for the
involvement of OXB and OX2R (Borgland et al. 2006, Borgland et al. 2008).
I.c.v. or local VTA infusions of OXA reinstate a previously extinguished
cocaine seeking behaviour in rats (Boutrel et al. 2005, Wang et al. 2009). In
addition, this behavior is completely blockaded by OX1R antagonists. However,
corticotropin-releasing factor (CRF, also known as corticotrophin-releasing
hormone) -dependent footshock-induced reinstatement of cocaine seeking, or the
VTA dopamine or glutamine levels were not were not affected by OX1R
antagonist SB-408124 infusion into the VTA (Wang et al. 2009). Thus, it is
believed that in the VTA, orexins and CRF work independently on the
mesolimbic dopamine mechanism in cocaine seeking (Boutrel et al. 2005, Wang
et al. 2009).
Microinjection of OXA into LHA and PVN stimulates voluntary ethanol
intake in rats trained to drink 10% ethanol, with no difference on water or food
consumption (Schneider et al. 2007). Thus, the feeding stimulatory effect of OXA
was masked by the ethanol consumption. This proposes a function of the orexin
system in ethanol intake. In addition, i.p. administration of SB-334867 resulted in
a decrease in operant self-administration of ethanol in rats (Richards et al. 2008).
Furthermore, i.p. administration of SB-334867 abolished the cue-induced
reinstatement alcohol-seeking behavior (Lawrence et al. 2006). Interestingly, i.c.v.
administration of SB-334867 also decreases nicotine uptake in rats (Hollander et
al. 2008). Furthermore, OXA innervates OX1Rs which are located in the insula of
the cortical brain region, which is proposed to be an important area in the
addiction to smoking (Naqvi et al. 2007, Hollander et al. 2008). Thus, it is
believed that the orexin system may also have a role in maintaining nicotine
addiction (Hollander et al. 2008).
2.2.5 Orexins and their receptors in periphery
In addition to the presence of orexins and their receptors in the CNS, these are
also widely expressed in the various peripheral tissues (Heinonen et al. 2008).
Orexins and/or their receptors are detected in tissues such as the intestine,
pancreas, adrenals, kidney, white and brown adipose tissue (WAT, BAT) and
reproductive tract. In addition, OXA and OXB can be detected also in
plasma/serum.
35
2.2.6 Orexins and their receptors in the gastrointestinal tract
Kirchgessner and Liu showed that PPO, as well as OX1R and OX2R mRNA are
expressed in the rat myenteric plexus (Kirchgessner & Liu 1999). In addition,
PPO, OXA and OXB were found in the myenteric and submucosal plexi and in
cultures of isolated myenteric ganglia of mice, rats, guinea-pigs and humans. In
fetal mouse, OXA was present in neuroendocrine cells of the pyloric region of
both stomach and small intestine (de Miguel & Burrell 2002). In rats, an OXA
like immunoreactivity was detected in varicose nerve fibres in the myenteric and
submucosal ganglia and neurones, and in the interconnecting nerve strands, as
well as in the longitudinal and circular muscle and in the mucosa including
enteroromaffin (EC) cells (Naslund et al. 2002). In the guinea-pig stomach, OXA
like immunoreactivity was present in the endocrine cells, which also show gastrin
immunoreactivity (Kirchgessner & Liu 1999). In humans, PPO mRNA is
expressed in the stomach and ileum, and to a lesser extent in colon and colorectal
epithelial cells (Nakabayashi et al. 2003). No expression of PPO mRNA was
detected in the duodenum. On the protein level, OXA was observed in ganglion
cells of the thoracic sympathetic trunk, and in the ganglion cells of myenteric
plexuses within the gastrointestinal tract (GIT). In the duodenum, OXA was coexpressed with chromogranin-A, thus indicating originate of endocrine cells.
OX1R is found in submucosal neurons and in nerve fibers which surround the
mucosal crypts with extensions to the endings in the subepithelial plexus
(Naslund et al. 2002). OX1R immunoreactivity is displayed also in the myenteric
neurons and its nearby varicosities. Nerve fibers in the circular muscle also
express OX1R. While OX1R seems to be expressed widely, OX2R can only be
found in enteroendocrine cells located in duodenal crypts.
Orexins regulate the gastric and intestinal motility via both central and
peripheral pathways (Heinonen et al. 2008). OXA excites submucosal
secretomotor neurons in a guinea-pig ileum and increases motility in isolated
guinea-pig colon segments. 3 day fasting increases the amount of OXAimmunoreactive guinea-pig submucosal neurons (Kirchgessner & Liu 1999).
Microinjections of orexins into DMN resulted in increased intragastric pressure
and antral motility in anaesthetized rats (Krowicki et al. 2002). However,
intracisternal injection of OXA resulted in relaxation of the rat proximal stomach,
in addition to the increased motility of the distal stomach (Kobashi et al. 2002).
Intravenous (i.v.) infusion of SB-334867 decreased the emptying of a liquid
nutrient from the stomach in rats (Smart et al. 2001, Ehrstrom et al. 2005b). In
36
addition, an i.v. infusion of OXA decreased the rate of gastric emptying of a
99m
Tc-labeled omelet in humans fasted overnight (Ehrstrom et al. 2005a).
OXA seems to have a dual role in the regulation of intestinal motility
(Heinonen et al. 2008). Administration of OXA into mouse small intestine
segments induced a contraction of the longitudinal muscle, possible via activation
of cholinergic neurons and muscarinic receptors (Satoh et al. 2001). In the
presence of atropine and guanethidine, however, exogenously added OXA
induced a relaxation of the small intestine. In mouse jejunal segments, this
relaxation was mediated via a nitric oxide pathway (Satoh et al. 2006b). In
contrast, an i.v. infusion of both orexins inhibited fasting motility in the rat
duodenum (Naslund et al. 2002). In addition, the inhibitory effect of OXA is most
probably mediated by OX1R, and is dependent on the L-arginine/nitric oxide
pathway (Ehrstrom et al. 2003). Furthermore, bilateral subdiaphragmatic
vagotomy did not abolish the response to OXA.
Intracisternal administration of OXA, but not OXB, resulted in a stimulation
of gastric acid secretion in 24 h fasted, conscious rats, while i.p. injection of OXA
had no effect (Takahashi et al. 1999). Since the stimulation was blocked by
atropine or surgical vagotomy, it was proposed that the OXA stimulated gastric
acid secretion is mediated by a vagus-dependent cholinergic mechanism. In
addition, this effect is likely to be mediated via the OX1Rs (Okumura et al. 2001).
An i.v. infusion of OXA had no effect on basal or pentagastrin-stimulated gastric
acid secretion in rats that were food deprived for 18 h (Ehrstrom et al. 2005b).
However, i.v. administration of SB-334867 inhibited the previously mentioned
secretions, thus suggesting the role of endogenous OXA on gastric acid secretion
independently of gastrin. A close intra-arterial infusion of OXA stimulated HCO3
secretion in fed, but not in overnight fasted (16 h) rats (Flemstrom et al. 2003).
Orexins have been suggested to have an affect on cholecystokinin (CCK)
release from intestinal neuroendocrine cells (Larsson et al. 2003). This peptide is
secreted from I-cells of the duodenum and jejunum and it stimulates the release of
digestive enzymes from the pancreas and bile acid from the gallbladder
(Heinonen et al. 2008). Both orexin receptors are expressed in the intestinal
neuroendocrine cell line, STC-1, and OXA causes a dose dependent stimulation
of CCK release via an activation of L-type voltage-gated Ca2+-channels (Larsson
et al. 2003). CCK mediates its satiety signal via CCK1 receptors which are
located in afferent vagal fibers. In addition, OX1R mRNA was present in both rat
and human nodose ganglia, and OX2R mRNA was detected in human nodose
ganglia (Burdyga et al. 2003). I.v. injection of OXA just before CCK-8
37
administration leads to inhibition of jejunal afferent discharge in anesthetized rats.
Thus, orexin might affect the CCK signaling from gut to brain. Administration of
CCK-8 into mice brain slices activated orexin neurons (Tsujino et al. 2005). The
activation was mediated through the CCK1 receptor. In addition, an i.c.v.
injection of OXA reversed the i.p. administered CCK-8 induced reduction in
feeding in mice (Asakawa et al. 2002). I.p. injection of CCK-8 resulted in
increased OXA levels in the posterior brainstem in 48 h fasted rats, but not in the
LHA (Gallmann et al. 2006). Thus, it was speculated that CCK-8 induced
inhibition of food intake after long fasting might be due to inhibition of orexin
neurons in the brainstem.
2.2.7 Orexins and their receptors in the pancreas
Both orexin receptors are expressed on the mRNA level in the rat pancreas
(Kirchgessner & Liu 1999). In addition, OXA- and orexin receptor-like
immunoreactivity was found in insulin secreting β-cells, nerve fibers in pancreatic
ganglia and in paravascular nerve bundles. In rats, the presence of OXA and
OX1R was shown also in glucagon secreting α-cells (Ouedraogo et al. 2003). The
presence of both orexin receptors in mRNA level has been demonstrated in rat
pancreatic islets (Nowak et al. 2005). In humans, PPO mRNA was observed in
the pancreas, and OXA peptide was detected in pancreatic islets, as well as in
somatostatin and glucagon positive cells (Nakabayashi et al. 2003). However,
Ehrström et al. demonstrated the presence of OXA only in insulin positive islet
cells and not in somatostatin or glucagon positive cells (Ehrstrom et al. 2005a).
Low glucose levels stimulated the release of OXA from isolated rat
pancreatic islets (Ouedraogo et al. 2003). In the presence of low glucose,
administration of OXA on islets increased glucagon secretion. In the presence of
high glucose, OXA decreased glucose-stimulated insulin secretion. Plasma
concentration of OXA increased during 18 h fasting. In contrast, in another study,
both OXA and OXB stimulated insulin secretion at low and high glucose
concentrations in rat pancreatic islets (Nowak et al. 2005). Orexins stimulated
insulin secretion also in the perfused rat pancreas. Afterwards, the same group
reported that OXA stimulated insulin secretion in the perfused rat pancreas only
in the presence of high glucose (Goncz et al. 2008). Similarly, a subcutaneous
(s.c.) injection of OXA or OXB stimulated insulin secretion in female rats for up
to 120 minutes and 60 minutes, respectively (Nowak et al. 2000). However, only
the administration of OXA resulted in an increase of blood glucose, while OXB
38
had no effect. A daily s.c. administration of OXA or OXB for 7 days increased
both insulin and leptin plasma levels in female rats (Switonska et al. 2002).
However, Ehrstrom et al. demonstrated that an i.v. infusion of OXA did not affect
the levels of plasma insulin in the rats (Ehrstrom et al. 2004). An i.v. infusion of
OXA or SB-33486 during a liquid nutrient meal decreased plasma insulin levels
in rats fasted for 18 h (Ehrstrom et al. 2005b). Furthermore, SB-334867, but not
OXA, with the meal increased plasma glucose levels. In humans fasted overnight,
an i.v. infusion of OXA increased postprandial plasma insulin levels, while there
was no change in plasma glucacon or glucose (Ehrstrom et al. 2005a).
The administration of OXA resulted in reduced glucagon secretion in
perfused rat pancreas, isolated rat pancreatic islets, and clonal pancreatic A-cells
(InR1-G9) (Goncz et al. 2008). Similarly, an i.v. infusion of OXA decreased
plasma glucacon levels in rats (Ehrstrom et al. 2004). Infusion of OXA through
the jugular vein increased plasma glucagon levels in rats food deprived for 18 h
(Ouedraogo et al. 2003). However, in humans fasted overnight, an i.v. infusion of
OXA did not affect plasma glucacon or glucose levels (Ehrstrom et al. 2005a).
Recently, Funato et al. studied the effects of orexin overexpression and/or
orexin receptor deficiency on glucose metabolism and insulin sensitivity, using
transgenic/KO mice approaches (Funato et al. 2009). The overexpression of
orexins attenuated diet-induced obesity and improved insulin insensitivity due to
increased energy metabolism and decreased diet comsumption. The authors
speculated that improvements in insulin sensitivity resulted from an OX2Rmediated reduction of adiposity.
2.2.8 Orexins and their receptors in the adrenal gland
PPO mRNA was weakly expressed in the human adrenal gland (Nakabayashi et al.
2003). Western blot analysis confirmed also the presence of PPO and OXA
peptides in fetal and adult human adrenal gland (Karteris et al. 2001, Randeva et
al. 2001). However, other studies have failed to demonstrate the presence of PPO
or OXA in the human or rat adrenal gland, pheochromocytomas, cortisolproducing adenomas or aldosterone-producing adenomas (Lopez et al. 1999,
Arihara et al. 2000, Johren et al. 2001, Nakabayashi et al. 2003). Spinazzi et al.
found that cortisol-secreting adenomas expressed PPO mRNA and OXA peptide,
whereas nothing could be detected in the human adrenal cortex (Spinazzi et al.
2005).
39
Using in situ hybridization, Johren et al. demonstrated the presence of OX2R
mRNA in a rat zona glomerulosa and zona reticularis (Johren et al. 2001). RTPCR and Western blott analysis demonstrated the presence of OX2R in fetal and
adult human adrenal gland and membrane, respectively (Karteris et al. 2001,
Randeva et al. 2001). Mazzocchi et al. demonstrated the presence of both orexin
receptors on mRNA level in zona fasciculate, zona reticularis and medulla, and
OX1R in zona glomerulosa in humans (Mazzocchi et al. 2001b). OX1R mRNA is
highly expressed in the porcine adrenal cortex, while expression is low in the
medulla (Nanmoku et al. 2002). The expression of both receptors on mRNA level
has been demonstrated also in cultured rat and human adrenocortical cells
(Ziolkowska et al. 2005). The presence of both orexin receptors on mRNA level
in adrenal medulla was demonstrated in rats (Lopez et al. 1999). In human
pheochromocytomas, only OX2R mRNA was detected by RT-PCR (Mazzocchi et
al. 2001a). However, immunohistochemical studies demonstrated the presence of
both OX1R and OX2R in the human adrenal cortex and medulla, respectively
(Blanco et al. 2002).
The effects of orexins on the hypothalamus-pituitary-adrenal (HPA) axis have
been widely evidenced (Heinonen et al. 2008). An i.c.v. injection of OXA
increased the mRNA expression of CRF and AVP in parvocellular neurones of the
PVN in rats (Al-Barazanji et al. 2001). In addition, i.c.v. administration of OXA
and/or OXB increased plasma adrenocorticotropic hormone (ACTH) and/or dose
dependently corticosterone levels in rats (Hagan et al. 1999, Jaszberenyi et al.
2000, Kuru et al. 2000). The i.c.v administed corticotrophin-releasing hormone
(CRH) antagonist, α-helical CRH9−41, inhibited OXA and OXB induced
corticosterone secretion (Jaszberenyi et al. 2000). Furthermore, administration of
the selective OX2R antagonist abolished OXA induced plasma ACTH release in
rats, indicating that OX2R may have a role in a stress-induced ACTH release
(Chang et al. 2007).
Orexins might exert their effect on glucocorticoid secretion also without the
intervention of the HPA-axis (Heinonen et al. 2008). Administration of OXA and
OXB increased a basal corticosterone secretion in rat zona fasciculate and fona
reticularis cells (Malendowicz et al. 1999). In another study, OXA increased
cortisol, but also aldosterone secretion in cultured porcine adrenal cortex cells
(Nanmoku et al. 2002). In rat or human dispersed or cultured adrenocortical, as
well as adenomatous cells, OXA, but not OXB, dose dependently increased
corticosterone or cortisol secretion (Mazzocchi et al. 2001b, Spinazzi et al. 2005,
Ziolkowska et al. 2005). Administration of OXA in a human adrenocortical cell
40
line H295R increased production of enzymes associated in cortisol production
(Wenzel et al. 2009). S.c. injections of both orexins, with OXA as a more potent
stimulator, elevated corticosterone, but not aldosterone plasma levels in rats
(Malendowicz et al. 1999). A one week systemic administration of orexins
increased both corticosterone and aldosterone levels in female rat plasma
(Malendowicz et al. 2001).
An i.c.v. injection of OXA elevated plasma epinephrine and norepinephrine
levels, while OXB affected only norepinephrine secretion in conscious rats
(Shirasaka et al. 1999). In human pheochromocytoma slices, the administration of
OXA or OXB resulted in an increase of epinephrine and norepinephrine secretion
(Mazzocchi et al. 2001a). Similarly, OXA increased the release of epinephrine
and norepinephrine from cultured porcine adrenal medullary cells (Nanmoku et al.
2002). In contrast, OXA and OXB inhibited dopamine release in cultured rat
pheochromocytoma PC12 cells via the cAMP/protein kinase A pathway
(Nanmoku et al. 2000). Recently, using carbon-fiber amperometry, OXA was
shown to stimulate catecholamine release from cultured rat chromaffin cells and
mouse adrenal medullary slices mainly through OX1R (Chen et al. 2008).
However, orexins did not have any effect on catecholamine release in human
adrenal slices (Mazzocchi et al. 2001b).
2.2.9 Cardiovascular effects of orexins
Johren et al. detected PPO mRNA in rat heart (Johren et al. 2001). No expression
of orexin receptors, however, was detected. Samson et al. provided the first
evidence that orexins affect cardiovascular functions (Samson et al. 1999). An
i.c.v. injection of OXA and OXB increased dose dependently mean arterial
pressure (MAP) in conscious rats. Another study showed that an i.c.v. injection of
both orexins dose dependently elevated MAP, as well as heart rate (HR) in
conscious rats, OXA being more efficant than OXB (Shirasaka et al. 1999). In
addition, plasma levels of norepinephrine rose after the administration of a high
3.0 nmol concentration of OXA or OXB, while only OXA affected plasma
epinephrine levels in conscious rats. Similarly, intracisternal injections of both
orexins at various doses and microinjection of OXA into rostral ventrolateral
medulla resulted in increased MAP and HR in urethan-anesthetized rats
(Shirasaka et al. 1999). Furthermore, a local administration of OXA into a
nucleus tractus solitarius (NTS) increased blood pressure (BP) and HR (Smith et
al. 2002). The rats were anesthetized with urethane. Using the same injection site,
41
de Oliveira et al. demonstrated a decrease in MAP and HR after an injection of a
smaller dose of OXA in α-chloralose or urethane-anesthetized rats (de Oliveira et
al. 2003). And again, Ciriello et al. demonstrated that a microinjection of OXA
into the rostal ventromedial medulla led to an increase only in HR, but not in
MAP in sodium pentobarbital anaesthetized rats (Ciriello et al. 2003).
Interestingly, an i.c.v. injection of OXA (0.003 pmol) decreased renal sympathetic
nerve activity (RSNA) and BP, while a higher dose of OXA (0.003 nmol)
increased both RSNA and BP in urethane-anesthetized rats (Tanida et al. 2006).
Similarly, a 0.5–500 fmol administration of OXA in a rat subfornical organ
decreased the HR and BP in urethane-anaesthetised rats (Smith et al. 2007).
Taken together, the differences observed in the effects of orexins on the
cardiovascular tone might be related to the different injection sites and dosages
used (Ciriello et al. 2003, de Oliveira et al. 2003, Tanida et al. 2006, Smith et al.
2007). OX-KO mice show lowered basal arterial pressure (Kayaba et al. 2003).
Thus orexins might contribute to a maintaining of basal blood pressure.
The effects of peripherally injected orexins on the cardiovascular system are
less prominent. A low dose of i.v. administered OXA (0.003 nmol) decreased, and
a high dose (0.3 nmol) significantly increased RSNA and BP in urethaneanesthetized rats (Tanida et al. 2006). In contrast, an i.v. injection of OXA or
OXB (11 nmol/kg) did not affect MAP or HR in urethane-anesthetized rats (Chen
et al. 2000). Similarly, an i.v. injection of OXA (100 pmol) did not alter the
arterial pressure, HR or RSNA in conscious rabbits (Matsumura et al. 2001).
2.2.10 Orexins and their receptors in adipose tissue
In the past few years, some reports have indicated a role for orexins also in
adipose tissue. Digby et al. demonstrated the presence of OX1R and OX2R at the
mRNA level in human adipose tissue and in isolated human s.c. and omental
adipocytes, as well as at the protein level in s.c. and omental adipose tissue
lysates and tissue sections (Digby et al. 2006). The authors demonstrated also that
after an administration of OXA or OXB (100 nM, 24 h) into s.c. adipocyte
explants, the mRNA levels of peroxisome proliferator-activated receptors (PPAR)
-2 in samples were significantly increased. The orphan nuclear hormone receptor
PPAR affects adipogenesis expressions of adipocytes-specific genes (Kintscher
& Law 2005). Thus, it was speculated that orexins might have an important
function in adipocyte metabolism (Digby et al. 2006). The tracing of the
retrograde neuronal tracer pseudorabies virus (PRV) in OX–GFP mice revealed a
42
PRV infection of OX–GFP neurons in the LHA after the injection of virus into the
right epididymal fat pat, indicating that these neurons form a circuit to integrate
epididymal adipose sympathetic outflow (Stanley et al. 2010). This data suggests
that orexin and MCH neurons in the LHA project into the adipose tissue
polysynaptically.
OX1R mRNA has been detected also in the BAT of ob/ob mice (Haynes et al.
2002). However, no other publications have shown the expression of orexins or
orexin receptors in BAT.
2.2.11 Orexins and their receptors in gonads
PPO and/or OX1R mRNA were detected in rat testis (Sakurai et al. 1998, Johren
et al. 2001). RIAs for OXA and OXB have identified the presence of both
peptides in rat testis (Mitsuma et al. 2000a, Mitsuma et al. 2000b). Barreiro et al.
showed that OX1R, but not OX2R, mRNA is expressed especially in
seminiferous tubules throughout postnatal development (Barreiro et al. 2004).
Expression levels of PPO mRNA in the rat testis and OXA peptide in Leydig cells
and spermatocytes were found to increase along with aging (Barreiro et al. 2005).
In humans, the presence of OX1R and OX2R mRNA was demonstrated in the
testis, epididymis, penis, and seminal vesicle (Karteris et al. 2004). In addition,
using an immunofluorescence approach, both receptors were detected in Leydig
cells, myoid cells of the seminiferous tubules and Sertoli cells. In testis, orexins
have been speculated to play a role in several physiological functions, such as
steroidogenesis, Sertoli cell gene expression and spermatogonial DNA synthesis
(Karteris et al. 2004, Barreiro et al. 2005). However, further studies are required
to fully understand the exact roles of orexins in the male reproductive tract.
In the first study looking for orexins and their receptors in ovaries, only
OX1R mRNA was detected in rats (Johren et al. 2001). Recently, both orexin
receptors, however, have been detected in mRNA and the protein level in rat
ovaries during the estrous cycle (Silveyra et al. 2007). The expression levels were
increased during the proestrus afternoon. In addition, i.p. injection of SB-334867
and/or JNJ-10397049, a selective OX2R antagonist, decreased serum
gonadotropin levels and ovulation. The expression of OX1R is affected by sex
hormones in both male and female rats (Silveyra et al. 2009).
43
2.2.12 Distribution and function of orexins and their receptors in
other tissues
PPO mRNA, but not OXA was expressed in the human kidney, and the
expression of OX1R mRNA was observed in the rat kidney (Johren et al. 2001,
Nakabayashi et al. 2003). However, later it was shown that OXA protein, as well
as both orexin receptors at both the mRNA and protein level, can be found in the
human kidney (Takahashi et al. 2006). In addition, OXA-like immunoreactivity
was detected in human urine. It was proposed that OXA may have a role as a
mediator ensuring the proper function of the kidney. Plasma OXA levels are
elevated in hemodialysis patients, suggesting that the kidney functions in the
clearance of orexins (Sugimoto et al. 2002). PPO, as well as both orexin receptors,
were detected in the Merkel cells in the skin of the porcine snout (BeirasFernandez et al. 2004). The authors raised a possibility for a role of the orexin
system in sensation modulation (van den Pol 1999, Beiras-Fernandez et al. 2004).
However, more studies need to be conducted in the future in this context (BeirasFernandez et al. 2004). OX2R mRNA has been detected also in the rat lung
(Johren et al. 2001).
2.2.13 Orexins in the circulation
OXA can be detected in mouse, rat and human plasma after solid phase extraction
by immunoassays (Arihara et al. 2001, Ouedraogo et al. 2003, Surendran et al.
2003). In addition, serum and plasma levels of OXA are increased during fasting
in rats and in humans (Komaki et al. 2001, Ouedraogo et al. 2003). In 0–18 year
old humans, plasma OXA and OXB levels are at their highest in neonates and in
children during puberty (Tomasik et al. 2004). In obese children, plasma OXA
levels correlated negatively with BMI and increased during body weight loss
(Bronsky et al. 2007). In adults, plasma OXA concentrations were significantly
lower in obese and morbidly obese subjects when compared to healthy normal
weight individuals (Adam et al. 2002). In addition, a negative correlation was
observed between OXA plasma levels and BMI. Similarly, plasma OXA was
significantly decreased in obese women with no difference in plasma OXB levels
(Baranowska et al. 2005). In contrast, a weak positive correlation between BMI
and plasma OXA levels was observed in morbidly obese patients before gastric
banding surgery when compared with normal weighted subjects (Heinonen et al.
2005). No difference was observed in plasma OXA levels before and after the
44
operation. Differences in assay conditions, antibody and handling of the samples
might account for these differences. For example, in the measurements from
Adams et al., normal weighted individuals and overweighted individuals had
almost the same levels of OXA in their plasma (Adam et al. 2002, Heinonen et al.
2005). Obese and morbidly obese subjects showed significantly lowered OXA
levels compared with healthy normal weighted individuals. In spite of the
observed negative correlatation with BMI, the overall changes in the OXA values
were fairly modest (52–56 pg/ml). The first study investigating the plasma OXA
levels in narcoleptic patients reported insignificant differences between patients
and normal subjects (Dalal et al. 2001). However, Higuchi et al. demonstrated
later reduced plasma OXA levels in narcoleptic patients (Higuchi et al. 2002).
OXA, but not OXB, can cross the blood brain barrier by diffusion in mice
(Kastin & Akerstrom 1999). In addition, orexins have been widely detected also
in the periphery, for example in the intestine and testis (Arihara et al. 2001,
Heinonen et al. 2008). However, despite the intensive research done in orexin
field, the source of orexins present in the circulation is still unknown.
2.3
Sleep and arousal
Sleep is a natural state of behaviour for all mammals and birds, which is
characterized by a reduction in voluntary motor activity, a decreased reaction to
external stimulation and stereotypic posture (Fuller et al. 2006). Conventionally,
wakefulness is characterized by beta waves, which in the cortical EEG appear as
desynchronized high-frequency and low-amplitude waves in the 14- to 30-Hz
range. These waves are believed to represent the differences in the timing of
processing regulatory functions of the brain, including cognitive, motor and
perceptual functions. When eyes are closed, beta waves are replaced by 8- to 12Hz alpha waves. Sleep itself may be divided into two phases, namely a slow wave
sleep (SWS), or NREM sleep, and REM sleep. SWS is usually associated with
reduced neuronal activity. In humans, SWS is divided in 4 different stages.
During the first state, the EEG frequency slows and EEG oscillations center in the
4- to 7-Hz theta range. In this state, conscious awareness starts to decrease, while
in stage 2 the awareness is completely gone. The EEG stage 2 is characterized by
patterns of waveforms called “sleep spindles” and “K-complexes”. In deep sleep,
which covers both the stages 3 and 4, EEG oscillations predominate in the 1–3 Hz.
This is also known as slow-wave activity (SWA) in the EEG. The delta waves are
45
proposed to reflect synchronized oscillations of thalamocortical circuit activity.
Delta waves or slow oscillations (0.5–1.0 Hz) originate from the neocortex.
In sleep, the periods of SWS and REM are cyclical (McCarley 2007). All
mammals and birds have REM sleep, although the birds show briefer bouts. In
REM sleep, brains are working more actively, and in humans, this state is usually
associated with dreams. Neuronal activity changes before the EEG signs of REM
sleep can be observed. During REM sleep, the cortical EEG displays a highfrequency and low amplitude activity, which is similar to those seen in stage 1
sleep and wakefulness (Fuller et al. 2006, McCarley 2007). In addition, REM
sleep is characterized with the presence of rapid eye movements and suppression
of muscle tone. In humans, the first REM period is short and it usually begins
about 70 minutes after falling asleep (McCarley 2007). From then on, the REM
sleep cycles at about every 90 minutes, so that the duration of each REM spout is
approximately 30 minutes. Depending on the size of the animal, REM sleep
cycles show differences in duration. In mice, this cycle is about 7 minutes
(Steiger 2002). Rodents show a typical hippocampal theta activity (4–8 Hz) in
EEG for REM sleep (Fuller et al. 2006, McCarley 2007). Since the human
hippocampus is located far from the scalp surface, EEG recordings do not usually
detect hippocampal theta.
Recently, Lu et al. proposed a model flip-flop switch controlling REM sleep
(Fuller et al. 2006, Lu et al. 2006). The sublaterodorsal nucleus and precoeruleus
area consist of REM-on cells, while ventrolateral periaqueductal grey matter and
lateral pontine tegmentum form REM-off areas. These areas inhibit themselves
with innervations of GABAergic neurons, and help in the producing of sharp
transitions between REM and SWS sleep. Orexin neurons have been proposed to
excite REM-off neurons, when they are active. In addition, the extended part of
the VLPO, as well as the MCH, is believed to inhibit the REM-off area. REM-on
cells project into the BF area and regulate EEG oscillatios, while sublaterodorsal
nucleus projects to the medulla and spinal cord and controls atonia during REM
sleep. The REM-on neurons are modulated by cholinergic neurons to make
possible the initiation and coordination of REM sleep (McCarley 2007).
Acetylcholine excites brainstem reticular formation neurons to produce the signs
of REM. The REM-off neurons are modulated by noradrenergic and
serotoninergic neurons by 5-HT and norepinephrine.
Arousal is mediated through discrete neuronal populations which project to
the thalamus and BF (Saper et al. 2001, Fuller et al. 2006). It is produced by a
complicated system, including projecting cholinergic neurons, monoaminergic
46
neurons and LHA orexin neurons. The first branch of this “ascending reticular
activating system” consists of cholinergic neurons in the pedunculopontine nuclei
(PPT) and laterodorsal tegmental nuclei (LTD) located in the mesopontine
tegmentum. These neurons fire rapidly during wakefulness and REM sleep, while
they are almost silent during SWS, when cortical activity is slow. They send
excitatory cholinergic projections to thalamocortical nucleus, and reticular
nucleus, which act as a gatekeeper between the thalamus and cerebral cortex. BF
contains cholinergic and noncholinergic neurons that project to the cortex and the
thalamus, and play a role in waking and EEG desynchronization. A group of
monoaminergic neurons project to the BF, cerebral cortex, thalamus, as well as to
LHA, which contains orexin neurons (de Lecea et al. 1998, Sakurai et al. 1998,
Saper et al. 2001). This system consists of the noradrenergic LC, histaminergic
tuberomammillary neurons and the dopaminergic ventral periaqueductal grey
matter, as well as the serotoninergic dorsal and median raphe nuclei (Fuller et al.
2006). Neurons in these areas fire actively during wakefulness and less during
SWS, while they cease firing during REM. LHA have projections to the BF, the
cerebral cortex and the brain stem, which also projects back. Orexin neurons are
active during wakefulness and increase the firing rate of the TMN, the LC and the
dorsal raphe (de Lecea et al. 1998, Sakurai et al. 1998, Saper et al. 2001). In
contrast, neurons containing MCH probably inhibit the ascending monoaminergic
system, and are active during REM sleep (Fuller et al. 2006).
VLPO inhibits the monoaminergic and cholinergic nuclei in order to produce
sleep (Sherin et al. 1996, Szymusiak et al. 1998, Lu et al. 2000a). This area
consists of 2 sets of neurons (Fuller et al. 2006). The core neurons have
projections to the TMN and the extended neurons to the LC and the dorsal, as
well as raphe nucleus. Neurons in VLPO are active during sleep, and they have a
proposed role in the initiation of SWS, as well as in SWS and REM sleep (Sherin
et al. 1996, Szymusiak et al. 1998, Lu et al. 2000a). These neurons contain
gamma-aminobutyric acid (GABA) and they are inhibited by noradrenaline and
acetylcholine. VLPO and the arousal system interact via a mutually inhibitory
flip-flop system (Saper et al. 2001). Since orexin neurons also receive input also
from the GABAergic neurons of VLPO, and they are inhibited by GABA receptor
agonists, it is possible that inhibitory GABAergic projections turn off orexin
neurons (Yamanaka et al. 2003, Sakurai et al. 2005, Xie et al. 2006, Tsujino &
Sakurai 2009). Orexins may also have a stabilizing role in maintaining the
behavioural state by a “flip-flop” switch (Saper et al. 2001). It has been proposed
47
that orexin neurons might “press” the switch into the “wakeful” position, and
prevent switching into the “sleep” position during wakefulness.
Sleep and wakefulness are under homeostatic and circadian control (Fuller et
al. 2006, McCarley 2007). Nowadays, it is a commonly accepted fact that the
“sleep drive” results from a homeostatic pressure that increases due to prolonged
wakefulness and is dissipated by sleep. Recent data indicates that the purine
nucleoside adenosine has a role as a mediator of this homeostatic control of sleep.
I.p. administration of adenosine analogs promote sleep and increase slow wave
sleep in rats (Radulovacki et al. 1984). Caffeine, an adenosine antagonist,
suppresses sleep in humans (Landolt et al. 1995). Porkka-Heiskanen et al.
showed that extracellular adenosine concentration in the BF of cat increases both
during spontaneous and prolonged wakefulness, while it decreases during sleep,
especially in SWS (Porkka-Heiskanen et al. 1997). Adenosine mediates its sleepinducing effects via the action of A1 and A2 adenosine receptors (McCarley
2007). Thakkar et al. showed that orexin neurons express adenosine A1 receptors
(Thakkar et al. 2002). Adenosine might promote sleep by inhibiting LHA orexin
neurons activity (Liu & Gao 2007). Furthermore, a blockade of A1Rs in the LHA
by the local microinjection of the selective A1R antagonist DPX induces a
significant increase in wakefulness, and a reduction in the following sleep,
indicating that adenosine reduces the activity of orexin neurons (Thakkar et al.
2008). A perfusion of CGS21680, an adenosine A2A receptor agonist, into the
ventral striatum of rats promotes sleep and diminishes orexin neuron activity
(Satoh et al. 2006a). Interestingly, it was recently reported that rats with lesions of
the LHA do not increase their adenosine levels in the BF with prolonged waking
(Murillo-Rodriguez et al. 2008). It was speculated that adenosine in the BF is
stimulated especially by the activity of orexin neurons in the LHA.
In mammals, most of their physiological and behavioral events, including the
sleep-wake cycle, follow daily oscillations, which are controlled by different
environmental cues, a circadian timing system, and complex interactions between
these two factors (Dibner et al. 2010). The circadian timing system consists of a
central pacemaker in the SCN and circadian clocks in other areas of the brain, as
well as in peripheral tissues and organs. The SCN circadian clock needs
environmental cues or zeitgebers for synchronization. These include the important
photic stimuli, light, or non-photic cues, such as manipulation of arousal or
locomotor activity (Mrosovsky 1996, Mistlberger & Skene 2005). Photic
information activates the retinohypothalamic tract, while nonphotic stimuli use
the geniculohypothalamic tract, as well as the dorsal raphe nucleus and median
48
raphe nucleus (MRN) (Dibner et al. 2010). Circadian rhythms normally follow a
24 h cycle, but in the absence of these stimuli, they will differ slightly from this
cycle. A SCN ablation in rats leads to the elimination of sleep-wake rhythm with
no change in the total amount of sleep (Mistlberger et al. 1987). However, studies
from Edgar et al. revealed that SCN-lesioned squirrel monkeys exhibit eliminated
sleep-wake and sleep stage rhythms, but also increased total sleep time (Edgar et
al. 1993). Similarly, SCN-lesioned C57Bl/6j mice showed an increased amount of
NREM sleep (Easton et al. 2004). However, using SCN-ablated balb/c mice, no
differences were found in the total amount of SWS or REM sleep, when
compared with control mice (Ibuka et al. 1980). The observed differences
between these two studies might relate to different strains (Mistlberger 2005).
PPO peptide or OXA immunoreactivite fibres were detected around the SCN
in rats or the Syrian and the Siberian hamster (Peyron et al. 1998, McGranaghan
& Piggins 2001). OX1R is present in the rat SCN (Backberg et al. 2002). OXA
and/or OXB caused either an excitatory or inhibitory response in the rodents’
SCN cells and/or brain slices in vitro (Farkas et al. 2002, Brown et al. 2008,
Klisch et al. 2009). In addition, OXA is able to elicit phase advances and/or
delays in cultured SCN primary cells as well as organotypic in brain slices
(Klisch et al. 2009). Orexin fluctuations measured from the rat CSF lose their
rhythm in consequence of SCN ablation, suggesting the control of SCN in orexins
release (Zhang et al. 2004). Mice exposed to a 6 h dark pulse stimulus during
subjective day show orexin neuronal activation in the medial and the lateral
hypothalamus, as well as the activation of neurons in the MRN (Marston et al.
2008). In contrast, the pulse suppressed SCN activity. These results suggest that
activation of OXA neurons might reset the SCN circadian clock via a MRN route.
Recent results suggest that orexin neurons have a role in the circadian suppression
of REM sleep (Kantor et al. 2009).
2.4
Thermoregulation in mammals
Thermogenesis is a process in which an organism produces heat (Morrison et al.
2008). Commonly, the inefficiency of mitochondrial ATP production and
utilization results in thermogenesis, and it occurs in almost all living tissues.
Basal metabolic rate (BMR) describes the minimal cost of living and it can be
measured in adult animals when they are in a postabsorptive state, and rest in a
thermoneutral environment (Hulbert & Else 2004). Usually, it is measured as the
rate of oxygen consumption. However, normally animals need to regulate their
49
body temperature due to the challenge of low ambient temperature (Nedergaard et
al. 2007, Morrison et al. 2008). This regulatory thermogenesis includes the CNS
network’s stimulated increase in heart rate, shivering thermogenesis occurring in
skeletal muscle, and non-shivering thermogenesis by mitochondrial oxidation
occurring in BAT. In rodents, but not in adult humans, cold exposure stimulates
the secretion of thyroid-stimulating hormone, leading to increased heat production
(Leppaluoto et al. 2005). In addition, exercise and feeding can also increase heat
production, and thus compensate the shivering and non-shivering thermogenesis
in cold (Fogelholm & Kukkonen-Harjula 2000, Nedergaard et al. 2007, Morrison
et al. 2008).
Contractive activity of the skeletal muscles produces heat as a byproduct
(Morrison et al. 2008). Voluntary muscle contractions originate from the CNS,
from which the nerve impulses through α-motoneurons innervate muscle fibers.
Of note, regular physical activity associates with successful weight management.
In the muscle, the heat produced comes from the additional energy of ATP
(Morrison et al. 2008). In the lack of voluntary physical activity, however, other
mechanisms may also take part in heat production.
A thermoneutral zone is a range of environmental temperature where warmblooded mammals do not need to produce any extra heat to cover their heat loss
(Cannon & Nedergaard 2004). In naked humans, and in most experimental
animals such as mice, this temperature is near +30 °C. Rodents show a nearly
two- to fourfold increase in their oxygen consumption after an acute or chronic
cold exposure to +4 °C (Lowell & Spiegelman 2000, Cannon & Nedergaard
2004). In acute cold, the heat produced is mainly due to shivering (Cannon &
Nedergaard 2004). In cold, the core body temperature falls down resulting in
repeated fast skeletal muscles contractions, shivering (Morrison et al. 2008). As in
voluntary muscle contractions, the increase in α-motoneuron activity initiates the
shivering.
In experimental rodents moved from their thermoneutral zone to
approximately +20 °C, shivering-derived thermogenesis interchanges almost
completely with brown fat-derived thermogenesis in about 4 weeks (Cannon &
Nedergaard 2004). Of note, during the interchange, characteristics of muscle
training can also be seen. It is commonly accepted that the non-shivering
thermogenesis occurs in BAT via uncoupling protein 1 (UCP1) mediated heat
production. BAT is innervated by sympathetic nerves. A norepinephrine signaling
through ß3-receptors follows activation of lipases, which stimulate lipolysis of
50
triglyceride droplets. The increased levels of free fatty acids activate UCP1 and
initiate the heat production.
Feeding increases the metabolic rate, while fasting decreases it (Lowell &
Spiegelman 2000). In addition, the content of food influences greatly in dietinduced thermogenesis (Westerterp-Plantenga 2008). A protein rich diet seems to
induce a greater thermic response than for that of a high-fat diet.
2.4.1 Uncoupling proteins
Uncoupling proteins (UCPs) are located in the inner mitochondrial membrane
(Cannon & Nedergaard 2004). UCP1 is able to bypass or uncouple the oxidative
phosphorylation pathway by dissipating the proton gradient as a form of heat. It is
exclusively expressed in BAT, mediating the cold-induced non-shivering
thermogenesis in rodents. UCP1 knockout mice are cold-sensitive, indicating the
importance of UCP1 in cold-induced thermogenesis (Enerback et al. 1997). In
addition, UCP1 KO mice of C57BL/6J genetic background show a resistance to
diet-induced obesity (Liu et al. 2003). This resistance was temperature dependent.
However, recently it was shown that the defect of UCP induces obesity in
C57BL/6 mice kept at thermoneutrality (Feldmann et al. 2009). Thus, it is
evidenced that only UCP1 can mediate diet-induced adrenergic thermogenesis.
In humans, the presence of BAT was originally postulated to exist only in
infants and young children (Hany et al. 2002, Cohade et al. 2003a, Cohade et al.
2003b, Yeung et al. 2003, Nedergaard et al. 2007). However, results from
combined positron-emission tomography and computed tomography (PET-CT)
demonstrated a high rate of uptake of 18F-fluorodeoxyglucose (18F-FDG) in BAT,
thus identifying the existence of BAT in adult humans. The amount of BAT is
inversely correlated with BMI and age, thus indicating the importance of human
BAT in energy metabolism (Cypess et al. 2009, Zingaretti et al. 2009). The
presence of UCP1 in human adipose tissue samples from a region extending from
the anterior neck to the thorax identified by PET-CT, and perithyroid adipose
tissue confirmed the existence of metabolically active BAT in humans. Thus, BAT
UCP1 acts as the main effector of non-shivering thermogenesis in rodents and
possible also in humans (Cannon & Nedergaard 2004, Cypess et al. 2009,
Zingaretti et al. 2009).
UCP1 is involved in diet-induced adaptive thermogenesis (Cannon &
Nedergaard 2004). Administration of leptin stimulates the production BAT UCP1
mRNA (Scarpace et al. 1997, Cusin et al. 1998, Satoh et al. 1998). On the
51
contrary, fasting for 2 days decreases the UCP1 mRNA levels in rat BAT and
refeeding increases the levels rapidly (Champigny & Ricquier 1990). Of note,
mRNA levels of the other UCPs, namely UCP2 and UCP3, in muscle are
increased during starvation (Gong et al. 1997, Cadenas et al. 1999).
Also four other UCPs have been identified (Borecky et al. 2001). Human
UCP2 and UCP3 have about a 70% homology to each other, and show 59% and
57% amino-acid identity to UCP1, respectively (Boss et al. 1997b, Fleury et al.
1997, Gimeno et al. 1997, Gong et al. 1997, Vidal-Puig et al. 1997). The two
remaining UCPs, UCP4 and UCP5, or brain mitochondrial carrier protein 1
(BMCP1), can also be found from mammals (Sanchis et al. 1998, Mao et al. 1999,
Yu et al. 2000, Borecky et al. 2001). However, UCP4 and UCP5 show only a low
degree of homology to the other UCPs. Therefore it could be speculated whether
these two proteins even belong to the same phylogenetic tree together with the
first three UCPs (Borecky et al. 2001).
The roles of other UCPs, except UCP1, in heat production are unclear
(Nedergaard & Cannon 2003, Cannon et al. 2006, Jia et al. 2009). UCP2 mRNA
is widely expressed in different organs, and the protein can be detected in tissues
such as pancreatic islets, stomach, spleen and WAT (Fleury et al. 1997, Pecqueur
et al. 2001). The amount of UCP2 mRNA in different tissues might not reflect the
total amount of UCP2 protein (Pecqueur et al. 2001). Even though the spleen and
stomach mitochondrias contain approximately the same amount of UCP2 mRNA,
they show a difference of 10 times in their protein levels. In addition, the UCP1
protein level in BAT mitochondria is about 160 times higher compared with the
amount of UCP2 protein in spleen mitochondria. It should also be noted that
UCP2 protein is absent in BAT of UCP1 KO mice, despite the increase in UCP2
mRNA levels (Enerback et al. 1997, Pecqueur et al. 2001). Cold exposure at +4Cº
for 10 days did not affect UCP2 mRNA levels in BAT, WAT, thigh muscle or liver
in Swiss mice (Fleury et al. 1997). However, UCP2 mRNA levels in WAT were
elevated in C57Ksj mice exposured to +4Cº for 24 h (Masaki et al. 2000).
Furthermore, another study shows an increased expression of UCP2 mRNA in
BAT, heart and soleus muscle in rats cold exposured at +6Cº for 48 h (Boss et al.
1997a). UCP2 or UCP3 knockout mice are not obese or cold-sensitive, suggesting
that these proteins do not possess a function in cold or diet-induced thermogenesis
(Arsenijevic et al. 2000, Vidal-Puig et al. 2000). In contrast, mice overexpressing
UCP2 are leaner when compared with their wt littermates (Horvath et al. 2003).
In addition, transgenic mice overexpressing UCP2 in orexin neurons (Hcrt-UCP2),
have an elevated hypothalamic temperature that results in a reduction in core
52
body temperature (Conti et al. 2006). Furthermore, atherosclerotic plaques and
mammalian macrophages overexpressing UCP2 showed increased heat
production (van De Parre et al. 2008). Both UCP2 and UCP3 have been proposed
to act as mitochondrial uncouplers (Jaburek et al. 1999). However, measurements
of proton conductance in a yeast heterologous expression system showed that
high UCP2 protein expression might cause non-specific uncoupling (Stuart et al.
2001). The observed overexpression artifact is due to mitochondrial membrane
damage and is not related to UCP2 protein activity itself.
Several studies have proposed a role for UCP2, as well as for UCP3, in
resting metabolic rate, fat metabolism and obesity in humans (Bouchard et al.
1997, Walder et al. 1998, Jia et al. 2009, Salopuro et al. 2009, Srivastava et al.
2010). UCP1 acts as a mediator of adaptive nonadrenergic nonshivering
thermogenesis (Golozoubova et al. 2006). Recently it was shown that coldacclimated UCP1 KO mice increase their oxygen consumption in general, and
also in inguinal fat pads, indicating UCP1 independent thermogenesis in WAT
(Ukropec et al. 2006). White adipocytes have the ability to transdifferentiate into
brown adipocytes under cold stress. Due to the defective function of UCP1 in
UCP1 KO mice, the sympathetic outflow might be overdriven, causing
nonadaptive thermogenesis (Golozoubova et al. 2006, Ukropec et al. 2006). Even
though the amount of mitochondria in WAT is lower than in BAT, some recent
studies demonstrate that some obesity-related genes have an important function in
WAT mitochondria (Semple et al. 2004, Dahlman et al. 2006).
The possible role of UCP3 in thermogenesis is also under debate. UCP3
mRNA is expressed in BAT and muscle (Boss et al. 1997b, Gong et al. 1997,
Vidal-Puig et al. 1997). Even though mice overexpressing UCP3 show reduced
weight gain, this effect has been proven to be an artifact (Cadenas et al. 2002,
Horvath et al. 2003). Interestingly, wt mice treated with MDMA (3,4methylenedioxymethamphetamine), or better known as ecstasy, show
significantly increased rectal and muscle temperatures, when compared with
UCP3 KO mice (Mills et al. 2003). However, the authors did not study the
uncoupling effects of ecstacy. Hamsters lacking UCP3 in brown adipose tissue
show a reduced cold tolerance limit, indicating the importance of the protein in
brown adipose tissue metabolism (Nau et al. 2008).
Both UCP2 and UCP3 possess other potential actions, in addition to their
possible role in energy metabolism (Echtay 2007, Bouillaud 2009). These include
functions such as cell protection against reactive oxygen species, mediation of
53
insulin secretion, and regulation of fatty acid metabolism. However, more studies
will be required for a proper evaluation of the functions of these proteins.
Previous studies have demonstrated that the effects of OXA on core body
temperature are independent of UCP1 (Yoshimichi et al. 2001, Russell et al.
2002). A third cerebroventricle infusion of OXA increased body temperature in a
dose-responsive manner in rats (Yoshimichi et al. 2001). UCP3 mRNA levels in
muscle were significantly increased, while no difference was observed in BAT
UCP1 or WAT UCP2 mRNA levels. Similarly, no difference was observed in BAT
UCP1 levels after a chronic intraparaventricular infusion of OXA in rats (Russell
et al. 2002). Interestingly, an i.c.v. infusion of SB-334867 elevated significantly
BAT temperature in rats in addition to raised UCP1 levels (Verty et al. 2010). The
authors suggested that orexins are involved in the maintenance of body weight
through elevated food intake and affect thermogenesis.
2.5
Duodenal bicarbonate secretion
2.5.1 Gastroduodenal defense
GIT is continuously exposed to several intrinsic and/or extrinsic factors that arise
from different chemical, physical or biological sources (Flemstrom & Isenberg
2001). These factors include acid produced by gastric parietal cells, pepsin, bile
acid and noxious agents, such as ethanol and nonsteroidal anti-inflammatory
drugs, as well as Helicobacter pylori (Flemstrom & Isenberg 2001, Binder 2005,
Ganong 2005). However, the GI-tract is endowed with multiple distinct protective
mechanisms against possible factors of injury (Flemstrom & Isenberg 2001,
Binder 2005). Gastroduodenal mucosal defense is divided into three elements,
namely the pre-epithelial, epithelial, and subepithelial. The pre-epithelial element
consists of a mucus HCO3 layer. In addition, the epithelial cells are connected to
each other with intercellular tight junctions. Moreover, the subepithelial element
covers different factors such as blood flow, cytokines and acid/base transporters.
Together these components form an effective defense system against possible
mucosal injuries.
The gastric and duodenal mucosa is covered by an adherent mucus-gel layer
(Flemstrom & Isenberg 2001). In the stomach, this layer is firm and continuous,
while in the duodenum, it is thinner and patchy (Allen & Flemstrom 2005).
Mucus is secreted by neck cells of the gastric glands and surface mucosal cells
54
(Ganong 2005). In addition, the mucus-gel layer is made up of mucin
(glycoproteins), phospholipids, electrolytes and water (Binder 2005). The two
main mechanisms to stimulate mucus secretion are acetylcholine induced vagal
stimulation and the physical as well as chemical effects of ingested food. In
addition, mucus secretion is stimulated by prostaglandins (Ganong 2005). The
presence of acid in the lumen results in the stimulation of both gastric and
duodenal HCO3 secretion (Allen & Flemstrom 2005). Together, the mucus-gel
layer and the HCO3 secreted by mucosal cells form the mucosal barrier. The
stable mucus-gel layer is important in the surface neutralization of the gastric acid
and forms a physical barrier against pepsin. The mucosal HCO3 secretion has a
remarkable role in neutralizing the acid diffusing into the mucus-gel layer.
Furthermore, the role of HCO3 secretion becomes important in maintaining a
near-neutral pH gradient between the surfaces of mucus and the mucosa.
2.5.2 Duodenal bicarbonate secretion
The duodenum spontaneously secretes HCO3 at steady basal rates, and this
secretory action likely involves the release of endogenous prostaglandins and
ENS activity (Smedfors & Johansson 1986, Flemstrom et al. 2010). The entry of
gastric acid into the duodenum induces HCO3 secretion from the mucosal surface
enterocytes (Flemstrom & Isenberg 2001, Allen & Flemstrom 2005). The
secretion has a role as a primary defense mechanism against the acid discharged
from the stomach. Importantly, the duodenal mucosal HCO3 secretion occurs at
very high rates (per unit surface area) when compared to that observed in the
stomach. In addition, HCO3 is secreted to the small intestine also from the
pancreas and the liver (Flemstrom & Isenberg 2001, Binder 2005). The hormone
secretin is released from S cells in the duodenum in response to gastric acid load
(Flemstrom & Isenberg 2001, Binder 2005, Ganong 2005). This triggers both
pancreatic and the bile duct HCO3 secretion. Secretin has no effect on duodenal
HCO3 secretion (Flemstrom & Isenberg 2001).
The mucus pH gradient forms an effective barrier against H+ (Flemstrom &
Isenberg 2001). Acid sensitive neural receptors or cell filaments pierce thought
the mucus-gel layer to sense the luminal pH. Holm et al. suggested that CO2 may
have a role as a messenger mediating the effect between the introcuded luminal
acid and the following secretory response (Holm et al. 1998). Several different
pathways that mediate the response to acid have been identified (Allen &
Flemstrom 2005). Numerous studies have proved prostaglandins to be important
55
stimulators in the local control of duodenal HCO3 secretion (Flemstrom 1980,
Flemstrom & Nylander 1981, Isenberg et al. 1986, Takeuchi et al. 1997, Takeuchi
et al. 1999). Both duodenal prostaglandin E receptor subtypes, EP3 and EP4,
seem to be involved in the duodenal HCO3 response (Takeuchi et al. 1997,
Takeuchi et al. 1999, Aoi et al. 2004). In addition, neurotransmitters such as
vasoactive intestinal peptide (VIP) and acetylcholine, among many others, have
also been identified to act as mediators of the neural response (Allen &
Flemstrom 2005).
The influence of the CNS on duodenal HCO3 secretion has been widely
studied (Allen & Flemstrom 2005). Sham feeding stimulated duodenal HCO3
secretion in humans (Ballesteros et al. 1991). In addition, duodenal HCO3
secretion is stimulated via vagal nerves or with a close-intra-arterial
administration, a procedure that minimizes the central nervous actions of the
cholinergic agonist bethanechol (Jonson et al. 1986, Ballesteros et al. 1991,
Flemstrom et al. 2003). The effects of different neuropeptides from the CNS on
duodenal secretion are also well demonstrated (Flemstrom & Jedstedt 1989, Lenz
1989, Allen & Flemstrom 2005). Hypothalamic CRF released during stress
stimulates duodenal bicarbonate secretion (Lenz 1989). In addition, an i.c.v.
infusion of thyrotropin-releasing hormone (TRH), bombesin, gastrin-releasing
peptide, or CRF increased bicarbonate secretion in anesthetized or freely moving
rats (Flemstrom & Jedstedt 1989, Lenz et al. 1989). An i.c.v. administration of
benzodiazepines or alpha 1-selective adrenoceptor agonist, phenylephrine, leads
also to the stimulation of HCO3 secretion in anesthetized rats, while the alpha 2adrenoceptor agonist, clonidine, decreased the secretion (Safsten et al. 1991,
Larson et al. 1996).
Duodenal HCO3 secretion is also affected by a variety of peripherally acting
agents (Allen & Flemstrom 2005). Duodenal luminal acid stimulates 5-HT release
from mouse duodenal mucosa (Smith et al. 2006). Administration of 5-HT on the
serosal side of stripped mouse mucosal tissue lead to stimulation of HCO3
secretion (Tuo & Isenberg 2003). Similarly, in situ close intra-arterial infusion of
5-HT stimulated duodenal HCO3 secretion in anaesthetized fed or overnight
fasted rats (Safsten et al. 2006). In addition, acid or 5-HT stimulated response in
duodenal HCO3 secretion was abolished by the 5-HT4 receptor antagonist SB
204070 (Safsten et al. 2006, Smith et al. 2006). Tetrodotoxin or the muscarinic
receptor antagonist, atropine, reduced 5-HT induced secretion in animals,
indicating that the stimulation by 5-HT is mainly mediated via a cholinergic
neural pathway (Tuo & Isenberg 2003, Tuo et al. 2004, Smith et al. 2006). 5-HT
56
is suggested to act also directly upon the 5-HT4 receptors of duodenocytes (Smith
et al. 2006).
Melatonin is released, in addition from the pineal gland, also from the
enterochromaffin cells of the intestinal epithelium (Vakkuri et al. 1985, Allen &
Flemstrom 2005). In addition, as compared with CNS production, it is produced
in huge amounts in the intestine (Allen & Flemstrom 2005). Melatonin increased
duodenal HCO3 secretion when administered by a close intra-arterial infusion in
anaesthetized rats (Sjoblom et al. 2001). The secretion response was inhibited by
the i.v. injection of MT2-receptor antagonist luzindole. An i.c.v. infused
adrenoceptor agonist, phenylephrine, induced secretion which was also
diminished by the luzindole. Since melatonin induced clear calcium signaling in
rat and human duodenal enterocytes, free from enteric neurons, melatonin may
have an effect directly on enterocyte membrane receptors (Sjoblom et al. 2003).
The nicotinic receptor antagonist, hexamethonium affected luminal melatonin
stimulated secretion decreasingly (Sjoblom & Flemstrom 2003).
Both intra-artelial and luminal administration of guanylin or uroguanylin
dose-dependently stimulated duodenal HCO3 secretion in anaesthetized rats
(Bengtsson et al. 2007). It was speculated that the response to luminal guanylins
was mediated via a direct action on apical membrane-bound guanylyl cyclase C,
and the intra-arterial stimulus was affected by the cholinergic system with the
interaction of mucosal melatonin from enteroendocrine cells. In addition,
luminally added Escherichia coli heat-stable enterotoxin, which binds the same
receptor as guanylins, induced the stimulation of HCO3 in female rat duodenal
preparation (Guba et al. 1996).
Other peripherally acting agents are also potent stimuli of duodenal secretion,
such as glucagon, CCK-8 and many more (Flemstrom et al. 1999, Sjoblom et al.
2003, Allen & Flemstrom 2005). A close intra-arterial infusion of OXA resulted
in a significant and dose-dependent increase of duodenal HCO3 secretion in fed
anesthetized rats (Flemstrom et al. 2003). However, OXA was without an effect
in overnight food deprived (16 h) rats, suggesting that the presence of different
nutrients in the intestinal lumen causes the stimulation of orexin receptors’
expression.
Duodenal mucosal HCO3 secretion is inhibited with several agents or
mechanisms (Lenz 1989). An i.c.v. administration of CRF and a physical strain, a
stress stimulus, stimulated duodenal HCO3 secretion in rats. In addition, patients
with duodenal ulcer disease show increased plasma levels of noradrenalin (Allen
& Flemstrom 2005). In patients with duodenal ulcer disease, the eradication of
57
Helicobacter pylori leads to normalization of proximal duodenal HCO3 secretion
(Hogan et al. 1996). Furthermore, the administration of α-adrenoceptor ligands
affects HCO3 secretion (Flemstrom & Isenberg 2001, Allen & Flemstrom 2005).
Moreover, α2-Adrenoceptors, and neuropeptide Y1 receptors, inhibit mucosal
HCO3 secretion via the action of sympathetic nervous system.
58
3
Aims of the study
The aim of the study was to elucidate the roles of the orexin system in regard to
its actions on sleep/wake patterns, energy homeostasis and intestinal HCO3
secretion. The specific aims were:
1.
2.
3.
4.
To create a novel mouse line overexpressing hPPO under its endogenous
promoter in order to study the effects of orexins on sleep-wake patterns. This
was important since no detailed analysis of sleep/wake patterns in
endogenously orexin-overexpressing animal models had been done.
To study the effects of orexins on energy metabolism in hPPO tg mice. Since
the orexins have been shown to affect heat production, and UCP1 is generally
believed to mediate cold and diet induced thermogenesis, we further
investigated the action of orexins and UCPs on heat production.
To study the effects of short overnight fasting on rat duodenal orexin
receptors’ expression and OXA induced duodenal HCO3 secretion.
To complete the results of sub-investigation 3, we aimed to study the effects
of short overnight fasting on orexin receptors’ expression in acutely isolated
rat duodenal enterocytes, and OXA induced intracellular calcium signaling in
rat and human acutely isolated duodenal enterocytes.
59
60
4
Materials and methods
4.1
Generation and characterization of hPPO overexpressing mice
4.1.1 Generation and basic characterization of the mice
The isolated hPPO gene with its endogenous promoter was microinjected into the
pronuclei of zygotes derived from Balb/c × DBA/2 (CD2) mice using standard
techniques (Sakurai et al. 1999). Male adult (2–4 month-old) heterozygous CD2
transgenic (tg) mice and their wt littermates were used in this study, unless
otherwise stated. If the number of mice in one litter was not large enough to fill
study groups, age-matched mice from different litters were mixed together.
Transgene analysis was made from tail or ear biopsies by PCR (5'-ATG TAA
TGC CCT CTA TCC C-3', antisense primer 5'-CTA CTG TGC CTG ACC AAA
C-3') and confirmed by Southern blotting. All mice were housed in cages under a
controlled environment (temperature 20 ± 1 °C, humidity 40–60%, lights on
between 07:00 a.m. - 07:00 p.m.). Mice were given free access to tap water and
fed ad libitum with Lactamin R36 standard chow diet (4% fat, 18.5% protein,
55.7% carbohydrates, and 3.5% fibers; calories from protein 24.4%, calories from
fat 14.8%, calories from carbohydrate 60.6%; Lactamin AB, Södertälje, Sweden)
or with 2018 Teklad Global 18% Protein Rodent Diet (18.6% of crude protein,
6.2% of fat [ether extract] 3.5% of crude fiber; calories from protein 24%,
calories from fat 18%, calories from carbohydrate 58%; Harlan Laboratories,
Indianapolis, Indiana, USA) unless otherwise stated. The diets did not contain any
animal protein or fish meal. The main fat source in the diets was soybean oil. The
experiments were approved by the Institutional Animal Care and Use Committee
of the University of Kuopio and by the Provincial Government. The procedures
were conducted in accordance with the guidelines set by the European
Community Council Directives 86/609/EEC.
Southern blotting
To confirm the PCR results and to identify the tg mice bearing the hPPO
transgene, genomic DNA from tail biopsies was isolated, digested with EcoRI,
separated on a 0.8% agarose gel and transferred to a nylon membrane (Nylon
Membranes, positively charged; Roche Diagnostics GmbH, Mannheim,
61
Germany). Blots were air-dried and DNA was crosslinked using UV light.
Hybridization was performed with a randomly primed 32P-labelled hPPO gene
probe (Ready-To-Go DNA Labelling beads; GE Healthcare, Little Chalfont, UK)
using ULTRAhyb® Ultrasensitive Hybridization Buffer (Ambion®; Applied
Biosystems INC, Foster City, CA, USA) according to the manufacturer's
specifications and scanned with a Typhoon 9410 imaging system (GE Healthcare).
Western blotting
Tissues from overnight fasted (16 h) mice were homogenized and lysed for
30 min with a solubilizing solution [25 mM tris (pH 7.4), 0.1 mM EDTA, 1 mM
dithiothreitol (DTT), 15µl/ml protease inhibitor cocktail (Sigma, St Louis, MO,
USA)] on ice. For the analysis of UCPs and PPARs expression in the peripheral
tissues or orexin receptors’ expression in the brains, the mice were allowed to eat
freely. The extracts were cleared by centrifugation (15000 × g, 15 min, +4 °C).
Protein concentrations were determined using the Bradford method (Bio-Rad
protein assay; Bio-Rad Laboratories GmbH, Munich, Germany). A total of 40 μg
protein per lane from the hypothalamus, pancreas, duodenum, and spleen was
electrophoresed on a 10% Tricine-SDS-PAGE gel (for OXA) or on a 12.5% SDSpolyacrylamide gel (for OX1R and OX2R), and then electrophoretically
transferred to a nitrocellulose membrane [Bio-Rad, Trans-Blot® Transfer Medium,
Pure Nitrocellulose Membrane (0.2 μm); Bio-Rad Laboratories, Hercules, CA,
USA] (Schagger 2006). OXA Western blot was performed using a commercial kit
[orexin-A (Human, Mouse, Rat) Western Blot Kit, WBK-003-30; Phoenix
Pharmaceuticals, Burlingame, CA, USA]. Synthetic orexin A peptide (0.2 μg,
human, bovine, rat, mouse, SC1337; NeoMPS, Strasbourg, France) was used in
this study as a positive control. After blocking overnight at +4 °C in 1 × TBS
Tween 20 (pH 7.6) with 5% BSA, membranes were incubated with orexinA/hypocretin-1 (human, rat, mouse, bovine; WBK-003-30; Phoenix
Pharmaceuticals) primary antibody (1:1000, at +4 °C overnight), and finally
incubated with the horseradish peroxidase-conjugated secondary antibody
(1:10000, 1 h at room temperature). In the orexin receptors’ western blots, the
blotting was done overnight at +4 °C in 1 × TBS Tween 20 (pH 7.6) with 5% lowfat milk-powder. The incubation with OX1R and OX2R antibody (1:1000 antirat/human orexin 1, cat no. OX1R11-A, anti-rat orexin 2, cat no. OX2R21-A,
Alpha Diagnostic International, San Antonio, TX) was performed overnight at
+4 °C. Since the antigens used to produce OX1R and OX2R antibodies were 100%
62
and 94% homologous, respectively, to mouse orexin receptors, a high
crossreactivity was expected. Membranes were then washed and incubated with a
secondary antibody [1:10000, Zymax goat anti-rabbit IgG(H+L) horseradish
peroxidase conjugate, Zymed, San Francisco, CA] for 1 h. Afterwards, both OXA
and orexin receptors’ blots were washed and chemiluminescence detected either
with the ECL developing reagent included in the kit for OXA (Orexin A (Human,
Mouse, Rat) Western Blot Kit, WBK-003-30, Phoenix Pharmaceuticals, Inc., CA,
USA), or with ECL Plus for orexin receptors (GE Healthcare, Amersham, UK)
according to the manufacturer's instructions. Blots were visualized with a
Typhoon 9400 Imager (GE Healthcare, UK).
Immunohistochemistry
Overnight fasted mice were anaesthetized and perfused with 4%
paraformaldehyde in 0.1 mM PBS (pH 7.4). The brains were removed and postfixed for 12 h. Tissues were sectioned at 20 μm with a vibratome, and processed
for immunohistochemistry. Sections were washed in PBS, incubated with 0.5%
NaBH4 in PBS and washed three times with PBS for 45 min. The sections were
incubated for 1 h with blocking solution containing 5% normal donkey serum in
PBST (0.5% Triton X-100 in PBS) and treated with goat polyclonal orexin-A
antibody, which detects total OXA from humans, mice and rats [orexin-A (C-19):
sc-8070, goat polyclonal IgG; Santa Cruz Biotechnology®, Santa Cruz, CA, USA]
at a dilution of 1:500. Before adding the secondary antibody, the sections were
washed for 45 min in PBS. Primary antibody binding was detected by 1 h
incubation with Cy3-labelled donkey anti-goat antibody (1:600, Cy-3-conjugated
donkey anti goat; Jackson ImmunoResearch, West Grove, PA, USA). After
45 min of additional washing in PBS, sections were covered with cover slips. The
slides were observed under a confocal microscope for red fluorescence.
RIA for orexin, leptin and ghrelin
Blood was collected from the tail vein of anesthetized overnight fasted mice
(~200 µl) into the heparinized capillary tubes or from vena cava inferior (~500 µl)
into the syringe with a needle containing 20 µl of 0.5 M EDTA. Heparinized
blood was centrifuged (12.500 rpm, 2 min, +4ºC); the plasma was decanted and
stored at −70 °C. Plasma OXA levels were measured after solid phase extraction
with a mouse orexin RIA kit (Orexin A (Human, Rat, Mouse), RIA Kit, 100%
63
cross-reactivity with mouse orexin-A, Phoenix Pharmaceuticals, Inc., CA, USA).
For OXA assay, plasmas from 5 tg or 5 wt mice were pooled together. Plasma
leptin and ghrelin levels were determined with RIAs (Ghrelin (Rat, Mouse) – RIA
Kit, RK-031-31, Phoenix Pharmaceuticals, Inc., CA, USA and Linco Mouse
Leptin RIA, ML-82K, Millipore, MA, USA).
Plasma cholesterol and triglyceride levels
Blood samples were taken from the tail vein of overnight fasted mice, and total
plasma cholesterol and triglyseride levels were determined using the Ecoline S+:
Cholesterol 12 × 25 ml and Ecoline S+: Triglycerides 12 × 25 ml according to the
manufacturer’s (VWR International, PA, USA) instructions.
Glucose tolerance test
1.5 month and 5 month old mice (5 tg + 5 wt) fasted overnight (16 h) were given
an intraperitoneal injection of glucose (2 mg/g body weight). Blood samples for
both glucose and insulin analysis were collected from the tail vein at different
time points (0, 10, 20, 60 and 120 min for glucose and 0, 20, 60 and 120 min for
insulin) and plasma glucose was measured with an automated clinical analyzer
(EPOS 5060, Eppendorf, Hamburg, Germany). Plasma insulin was measured
using the ELISA kit (Crystal Chem Inc., IL, USA) according to the
manufacturer’s instructions.
Quantitative real-time PCR
Overnight fasted or fed mice were killed by cervical dislocation between 7:00–
10:00 a.m. Mice were fasted for the analysis of mouse endogenous PPO (mmPPO)
and hPPO. For other analyses, the mice were given free access to their food.
Tissues were collected from the following organs: hypothalamus, cortex,
hippocampus, BF, pancreas, duodenum, muscle, BAT, WAT and spleen. Tissues
were treated immediately with RNAlater (Qiagen, Hilden, Germany) or snap
frozen into liquid nitrogen, and stored for further analysis. Total RNA was
extracted with the RNAeasy kit (Qiagen). Genomic DNA was digested by
treatment with Dnase I (Qiagen). cDNA was synthesized from 1 μg of RNA using
either the ThermoScript RT-PCR System for First-Strand cDNA Synthesis
(Invitrogen, Carlsbad, CA, USA) with random hexamers as primers or iScript
64
cDNA Synthesis Kit (Bio-Rad Laboratories) with both oligo(dt) and random
hexamers as primers. hPPO, as well as mmPPO, OX1R and OX2R, mRNA levels
were measured using commercial assays (Taqman® Gene Expression Assays,
Applied Biosystems INC) following the manufacturer´s instructions. Reactions,
in total volume of 30 μL, contained 1 × TaqMan® Universal PCR Master Mix
(Applied Biosystems INC), 20 ng (for OX1R and OX2R) and 100 ng (for hPPO),
and 50 ng (for mmPPO) of sample and 1 × of primers mix. All samples were
normalized to eukaryotic 18s rRNA (Taqman Pre-Developed Assay Reagents
Eukaryotic 18 s rRNA). Specific primers were designed with the eprimer3
program or taken from the literature (Schmittgen & Zakrajsek 2000, Huang et al.
2006). Reactions contained 2 µl of sample (6–40 ng of cDNA), 1 × SYBR Green
master mix (Applied Biosystems INC) and forward and reverse primers (15 pmol
of forward primer and 30 pmol of reverse primer for UCP1, 15 pmol of both
UCP2 primers, 7.5 pmol of both UCP3 primers and 6 pmol of both 18s primers).
All samples were done as duplicates in the following conditions: 2 min at 50 °C
and 10 min at 95 °C followed by 40–42 cycles of 15 s at 95 °C and 1 min at 62 °C.
Each assay included a relative standard curve of three serial dilutions of cDNA
from wt mouse and no template controls. The cycle threshold (Ct) values below
35 were considered as positive and the others negative. The results were
calculated according to the manufacturer's descriptions (ABI PRISM 7700 or ABI
PRISM 7300 Sequence Detection System; Applied Biosystems INC). The
samples from the hPPO run were loaded afterwards into 1.0% agarose gel (in 1 ×
TBE [Tris-borate buffer]) and visualized with ethidiumbromide staining.
Table 1. Primers used in quantitative real-time PCR for characterization of hPPO tg
mice.
Gene
Forward
Reverse
Eukaryotic 18s rRNA
GTAACCCGTTGAACCCCATT
CCATCCAATCGGTAGTAGCG
Mouse PPAR
AGTGACCTGGCGCTCTTCAT
CGCAGAATGGTGTCCTGGAT
Mouse PPAR
CGCTGATGCACTGCCTATGA
AGAGGTCCACAGAGCTGATTCC
Mouse UCP1
GGCCAGGCTTCCAGTACCATTAG GTTTCCGAGAGAGGCAGGTGTTTC
Mouse UCP2
TGGTGGTGGTCGGAGATA
GAGGTTGGCTTTCAGGAGAG
Mouse UCP3
CCAGGGAGGAAGGAGTCA
GGAAGTTGTCAGTAAACAGGTG
65
4.1.2 Surgery for polysomnography
All procedures were approved by the University of Helsinki Ethical Committee
for Animal Experiments and by the Regional Committee of the State Provincial
Office and performed according to applicable national and EU legislation (the
European Community Council Directives 86/609/EEC). Two to three-month-old
male mice were group housed on a 12 h light/dark cycle (lights on at 08:30 a.m.,
intensity 100–150 lx at the level of the cages) at constant temperature +22 ± 1 °C.
The cage floor was covered with wood chips, and paper shreds were given to the
mice for nesting material. Mice were given standard rodent pellets and water ad
libitum. 3- to 4-weeks before operation, mice were allowed to adapt to their new
conditions. During the period the mice were familiarized with the experimenter to
avoid stress.
The protocol for mouse sleep recording was adapted from Stenberg et al.
(Stenberg et al. 2003). Mice were anaesthetized using ~1 mg kg−1 medetomidine
(Domitor®, Orion Oyj, Espoo, Finland) and 75 mg kg−1 ketamine (Ketalar®,
Pfizer AB, Sollentuna, Sweden) administered as an i.p.. Lidocain (Orion Oyj) was
used as a local anaesthetic. The mice were implanted with two gold-plated
miniature skull screw electrodes for unilateral bipolar electroencephalographic
(EEG) recording. The frontoparietal electrodes were placed 1 mm rostral and
1 mm lateral to the bregma, and 2 mm rostral and 2 mm lateral to the lambda. A
third screw for fixation to the skull was placed on the contralateral side. For
electromyographic recording, two Teflon-coated silver wires ( = 0.0055 inches;
A-M Systems, Carlsberg, WA, USA) were implanted into the neck musculature.
All electrodes were connected to a miniature connector, which was fixed to the
bared skull with cyanoacrylate glue and then embedded with dental cement. This
construct allowed the recording of mice for months. After the surgery mice (wt,
n = 11, tg, n = 8) were single housed in clear plastic Macrolon boxes (length 26
cm, width 20 cm, height 39 cm) with an opening on top allowing the connection
and movement of EEG/EMG leads as well as video recording. Mice were allowed
to recover from the operation at least for one week.
4.1.3 EEG/EMG and video recording
Flexible lightweight recording leads were counterbalanced with a weight on a
string, supported by roller-bearing pulleys, and attached to the connector. The
system allowed using the simultaneous and continuous recording of eight mice
66
for 3–4 weeks. The EEG/EMG signals were amplified (gain 5 K for EEG and 1 K
for EMG) in a 16-channel AC amplifier (A-M Systems), analogically filtered
(high pass: 1 Hz for EEG and 10 Hz for EMG, low pass: 30 Hz for both, notch
filters to avoid mains power 50 Hz artefacts), digitized (241.5 Hz for EEG and
72.6 for EMG) with a 1401 unit (Cambridge Electronic Devices, Cambridge, UK),
monitored online during the experiments and saved on a computer using the
Spike2 software (version 6.07; Cambridge Electronic Devices) for further off-line
analysis. The age of the mice during the recordings was 5–7 months. In addition
to polysomnography, the behavior of the mice was continuously followed with
standard infrared surveillance miniature video cameras using Digital Video
Surveillance System version 8.0.0 (GeoVision Inc., Buckinghamshire, UK)
throughout the third and fourth recording weeks. To exclude the possibility that
orexin-overexpressing mice had symptoms of narcolepsy such as cataplexy, as
has been reported for OX-KO mice with a disrupted orexin system (Mochizuki et
al. 2004), the video recordings were inspected together with the EMG/EEG
recordings of the sleep deprivation (SD) periods, the handling periods of the
Murine Multiple Sleep Latency Test (MMSLT) and a part of the natural activity
period of the mice after lights off (20:30–00:00 h). The mice exhibited no signs of
sudden attacks of inactivity or loss of muscle tone together with prominent EEG
theta activity.
Experimental design
To allow the mice enough time for habituation to their new conditions, the final
experiments were performed only during the last two weeks of recording. A
schematic presentation of the experimental schedule is shown in Figure 3A.
67
Fig. 3. Experimental schedule and Murine Multiple Sleep Latency Test (MMSLT). A)
Experimental schedule. Mice were housed in a 12 h light–dark cycle with lights on at
08:30 hours. After a 24 h baseline recording of EEG/EMG, mice were sleep deprived
with a gentle handling method for 6 h, after which they were allowed 18 h of
undisturbed recovery sleep. The MMSLT protocol was performed for a minimum
2 days after SD (sleep deprivation). Sleep latencies were first measured in baseline
conditions, and 1 day later at the same circadian time points after 6 h of SD. B) MMSLT.
Sleep latencies (seconds to first sleep episode) were repeatedly measured during four
consecutive 20 min nap opportunities separated by 10 min handling periods. During
the handling periods, the mice were kept awake as in SD by introducing novel objects
into their cages. I, published by permission of Acta Physiol (Oxf.)
SD was performed in order to study sleep homeostasis, a process in which
prolonged waking results in a consequent recovery sleep characterized by
increased duration, and intensity of slow wave sleep (SWS) (Borbely 1982). SD
increases sleep propensity and it leads to an increase in the amount, consolidation
(as measured by brief awakenings) and intensity [as defined by increased SWS
EEG delta (1–4 Hz power)] of the subsequent SWS. Also, the amount of REM
sleep is increased due to SD. After a 24 h baseline (BL) recording, the mice were
sleep deprived for 6 h starting at light onset (08:30 a.m.). SD was performed by
using a gentle handling method consisting of an introduction of new bedding
material and wooden blocks into the mice cages (Huber et al. 2000). If the mice
appeared sleepy or slow waves were visible in the EEG, the objects were replaced
and/or the cage was gently tapped. To avoid stress, touching of the mice was
avoided. At the end of SD, foreign objects were removed from the cage and the
mice were allowed to have an undisturbed recovery sleep for the next 18 h. Data
68
from the SD day were normalized to corresponding time points of the baseline
day within each individual animal before calculating group means, in order to
minimize circadian factors and to reduce the inter-individual variation in the
homeostatic sleep response.
The MMSLT was used to measure sleep propensity/sleepiness during BL and
after 6 h SD. The MMSLT was performed no less than 2 days after the initial SD.
The protocol was adjusted from a publication by Veasey et al. and described in
detail in Figure 3b (Veasey et al. 2004). Sleep latencies were measured during
four consecutive 20 min nap opportunities, which were each separated by 10 min
handling periods (as in SD) during BL conditions and following 6 h of SD.
Vigilance state scoring and EEG power spectra
EEG/EMG recordings of the 24 h baseline period, the SD day (24 h) and the
MMSLT treatment periods (2 h 10 min) were visually scored into three vigilance
states: wake, SWS and REM sleep in 30 s sliding windows divided into 2 s
epochs using the Spike2 script Sleepscore v1.01 (Cambridge Electronic Devices).
Sleep consolidation was quantified from data divided into 2 s epochs in order to
automatically count brief awakenings from SWS (waking episodes between 2 and
12 s). Brief awakenings were approved as a count only when both muscle
activation in the EMG and a clear arousal (desynchronization/amplitude decrease)
in the EEG was observed. Vigilance states were scored according to standard
criteria: waking as low amplitude, high frequency EEG with high voltage EMG;
SWS as high amplitude EEG associated with low voltage EMG and the presence
of slow delta (1–4 Hz) oscillations in the EEG; REM sleep as low amplitude, high
frequency EEG with the absence of EMG and presence of prominent EEG theta
(5–9 Hz) oscillations. Epochs with mixed states or artefacts were marked and
excluded from further analysis.
The scores and the EEG/EMG recordings were further processed in MatLab
(The MathWorks, Natic, MA, USA). Brief awakenings were counted as wake
bouts of 2–12 s in between SWS bouts (MatLab). EEG power spectra in 1 Hz
frequency bins were generated for each scored epoch using a Fast Fourier
transformation routine. EEG power spectra are shown for each vigilance state
separately. From the scored data, the percentage of time spent in each vigilance
state and their mean bout duration (in seconds) was calculated. To investigate
sleep continuity or fragmentation, the number of wake transitions either from
SWS or REM was calculated. Data are shown as group mean (±SEM), analysed
69
in 1 h time bins and organized into time periods of different lengths (1, 6, 12 or
24 h) for the BL day and the SD day (08:30 a.m. – 08:30 p.m., the 12 h light
period, 08:30 p.m. – 08:30 a.m., the 12 h dark period).
4.1.4 Physiological and behavioral analysis of the hPPO mice
Growth
Tg and wt mice were weighed the same day every week, starting from weaning (4
weeks old) until they were 21 weeks old. The groups (n = 6) were combined from
two separate litters.
Physiological and behavioural analysis of the mice in room temperature or
under acute cold exposure
Mice were housed in singular cages with bedding inside. Metabolic performance,
home cage activity, and drinking and feeding behavior of the 8 tg + 8 wt mice
over 24 h was measured with an automated metabolic analyzing system for small
animals (TSE Systems GmbH, Bad Homburg, Germany). With this system, 8
mice could be measured simultaneously. The data was measured continuously for
3–4 days in a room with a 12–12 h light/dark cycle (lights on between 7:00 a.m. –
7:00 p.m.). The general conditions for the experiments done at room temperature
were as follows: temperature +20 ± 1 °C, humidity 40–60%, lights on between
07:00 a.m. – 07:00 p.m. For the acute cold (+4ºC) exposure studies, the cages
were placed in a climate chamber, where 3 mice could be measured
simultaneously. All mice were given free access to tap water and fed ad libitum.
Mice were killed immediately after 4 days of cold exposure (between 8:00 –
10:00 am) and the tissues were collected and either treated with RNA later
(Qiagen) or snap frozen in liquid nitrogen.
Temperature telemetry
Mice (n = 4) were implanted with temperature transmitters (PhysioTel® TA-F20
Mouse Transmitter, Data Sciences International (DSI), St. Paul, MN, U.S.A.) in
the abdominal cavity. Two weeks after the operation, the mice were transferred to
individual cages and allowed to adjust to their new environment for a week. A
70
telemetry system for recording body temperature was used for continuous
recordings for 3 days. Body temperature was collected for 20 seconds at 5
minutes intervals. The data were collected, stored, and analyzed by using
Dataquest A.R.T. software (Data Sciences International, DSI, St. Paul, MN, USA).
Data analysis and statistics
All values are shown as a group (wt or tg) mean ± SEM. Statistical analyses for
EEG/EMG and video recordings were performed with SigmaStat 3.1 (SPSS
Science Software, Chicago, IL, USA). Otherwise the GraphPad Prism 4
(GraphPad Software, San Diego, CA, USA) was used. When two groups were
compared, we used two-tailed, unpaired Student's t-test. For analysis of circadian
distribution of vigilance states or frequencies in power spectra, we used two-way
repeated-measures anova (independent Factor A: genotype; dependent Factor B:
time or frequency) with Holm-Sidak as a post hoc test. In case the data were not
normally distributed, equivalent nonparametric statistical tests were used (twoway repeated-measures anova on Ranks, with Dunn's test as a post hoc). p < 0.05
was considered significant; n represents the number of animals used per group.
For analysis of metabolic performance, home cage activity, drinking and feeding
behavior and core body temperature, we used Two Way Repeated Measures of
ANOVA with Bonferroni as a post hoc test. p < 0.05 was considered significant; n
represents the number of animals used per group.
4.2
Effects of food deprivation on duodenal mucosal bicarbonate
secretion and orexin receptors’ expression in rat duodenal
mucosa and in acutely isolated duodenal enterocytes
4.2.1 Chemicals and drugs
Atropine sulfate, bethanechol (carbamyl-methylcholine chloride), OXA (human,
bovine, rat), prostaglandin E2, thyrotropin-releasing hormone (TRH), the
anesthetic 5-ethyl-5-(1'-methyl-propyl)-2-thiobarbiturate (Inactin), carbachol
(carbamylcholine chloride), collagenase type H, Dulbecco's modified Eagle's
medium with Ham’s nutrient mixture F-12 (DME-F12), and gentamicin were
purchased from Sigma-Aldrich (St. Louis, MO). The OX1R antagonist SB334867 [1-(2-methylbenzoxanzol-6-yl)-3-[1,5]naphthyridin-4-yl-urea hydrochloride]
71
and the OX2R agonist (Ala11,D-Leu15)-orexin-B were obtained from Tocris
Bioscience (Ellisville, MO). Membrane filters (polycarbonate, diameter 25 mm,
thickness 25 µm, 3 × 106 pores/cm2, pore diameter 3 µm) were obtained from
Osmonics, Livermore, CA. Dispase II was purchased from Boehringer-Mannheim
(Mannheim, Germany) and Pluronic F-127 and the fura 2 calibration imaging kit
(F-6774) were from Molecular Probes. Fura 2-AM was obtained from
Calbiochem (La Jolla, CA), and fetal calf serum (Svanocolone, FBS Super) was
from The National Veterinary Institute (Håtunaholm, Sweden). Atropine sulfate
was dissolved in isotonic saline and stored in stock solution protected from light
at +4 °C for a maximum of 4 days. OXA was stored at −20 °C in stock solution
containing 0.5 mg/ml bovine serum albumin. SB-334867 was dissolved in
isotonic saline and stored at –20 °C for a maximum of 6 days. Prostaglandin E2
was added as a small amount from an ethanol stock solution stored at –20 °C.
4.2.2 Animal preparation
Male F1-hybrids of Lewis × Dark Agouti rats (230–280 g, 7–9 wk old; Animal
Department, Biomedical Center, Uppsala, Sweden) were group-housed in
standard Macrolon cages (59 × 38 × 20 cm) containing wood-chip bedding
material. The animals were kept under standardized temperature and humidity
conditions (+20 °C ± 1 and 50 ± 10%, respectively) on a 12-h light-dark cycle.
All rats had free access to water and, unless deprived of food overnight (16 h),
free access to food pellets (Labfor, Kimstad, Sweden). All experiments were
approved by the Uppsala Ethics Committee for Experiments with Animals.
The rats were anesthetized at 9 a.m. with an i.p. injection of Inactin (120
mg/kg body weight). The anesthetic was given by the person who had previously
handled the animals, thus minimizing any post-operative stress. Rats were
tracheotomized and they were placed on a heating pad to maintain their body
temperature between +37–38 °C. The temperature was controlled by a rectal
thermistor probe. The surgical and experimental protocols were adapted from
protocols fully described previously (Flemstrom et al. 1982, Flemstrom et al.
1999, Sjoblom et al. 2001). The protocol with some modifications is described
briefly here. A femoral artery and vein were catheterized by installation of PE-50
polyethylene catheters (Becton-Dickinson, Franklin Lakes, NJ). The arterial
catheter, containing 20 IU/ml heparin isotonic saline, was connected to a
transducer operating a PowerLab system (AD Instruments, Hastings, UK) to
measure continuously the mean arterial blood pressure. Ringer-bicarbonate
72
solution (Na+ 145, Cl− 124, K+ 2.5, Ca2+ 0.75, and HCO3 25 mM) was infused
through the vein at a rate of 1.0 ml/h to compensate for fluid loss and to minimize
changes in body acid-base balance during experiments. 40 µl arterial blood
samples were taken at the start and the end of all experiments for measurements
of acid-base status by a blood gas-analyzer (AVL Compact 3, Graz, Austria). The
vein was also used for i.v. administration of atropine.
The abdomen was carefully opened by a midline incision. The common bile
duct was catheterized with PE-10 polyethylene tubing (Becton-Dickinson) in
order to avoid bile and pancreatic secretions into the intestine. For measurement
of duodenal mucosal HCO3 secretion, a 12-mm segment of duodenum, together
with its complete blood supply, starting at 10 mm distal to the pylorus, thus
without the effect of Brunner's glands, was cannulated in situ between two glass
tubes connected to a reservoir (Study III, Fig. 1). The glass tubes were entered
through two precise and small antemesenterial incisions, made with an electrical
high-temperature cautery loop tip (Bovie/Aaron Medical, St. Petersburg, FL),
thus avoiding any major damage of the duodenal wall. 10 ml of isotonic saline
fluid was maintained at +37 °C by a water jacket and rapidly circulated by a gas
lift of 100% nitrogen. HCO3 secretion into the luminal perfusate was
continuously titrated with 50 mM HCl at pH 7.4 using an automated pH stat
system (Radiometer, Copenhagen, Denmark). After the operation and cannulation
of the hepatic artery, the abdomen was closed with sutures. The rat was allowed to
rest for 1 h in order to stabilize cardiovascular, respiratory, and gastrointestinal
functions.
4.2.3 Intra-arterial infusions to the duodenum
In this study, OXA was administered to the duodenum by a close intra-arterial
infusion, a technique allowing the use of very small amounts of the substance,
thus minimizing any effect of the CNS (Sjoblom et al. 2001). A cannula was
placed in the hepatic artery, 3–4 mm proximal to its entrance into the liver. The
perfusion was done in the retrograde direction at a rate of 17 µl/min. Thus, the
perfusate was mainly distributed to the duodenum (via the cranial
pancreaticoduodenal artery) and the pancreas. The distribution of the perfusate to
the duodenal segment was verified visually at the start of each experiment by
intra-arterial injection of Ringer solution (<0.1 ml). The solution changed briefly
the brightness of the segment, thus verifying the proper installation of the cannula.
73
4.2.4 I.c.v. infusions
A metal cannula was implanted into the right cerebral ventricle of a rat brain
using a stereotaxic instrument (model 900, Kopf Instruments, Tujunga, CA). A
right parietal bone was exposed by a skin incision and a 1-mm hole was drilled
through the bone, 0.8 mm posterior to the bregma and 1.5 mm lateral to the
midsagittal suture. The cannula was fixed to the skull by dental cement (Fuji type
II, GC, Tokyo, Japan). All drugs infused were dissolved in the artificial
cerebrospinal fluid (in mM: 151.5 Na+, 3.0 K+, 1.2 Ca2+, 0.8 Mg2+, 132.8 Cl−, 25
HCO3 , and 0.5 phosphate; pH 7.4). The fluid was infused through the cannula at
a rate of 30 µl/h. The cannula placement within the cerebral ventricle space was
verified after the end of each experiment by adding Evans blue solution to the
infusate and then dissecting the brain.
4.2.5 Isolation of duodenal enterocytes
The protocol for isolation of clusters of duodenal enterocytes has been described
earlier by Sjöblom et al. and used elsewhere (Sjoblom et al. 2003, Safsten et al.
2006). Rats were euthanized at about 09:30 a.m.. A ~3-cm-long segment of the
duodenum, starting 2–3 mm distal to the pylorus, was preparated via an
abdominal midline incision. The segment was separated from mesenteric tissue
and opened along the antemesenterial axis. The luminal content was rinsed off
from the surface with a normal respiratory medium (NRM) solution (in mM:
114.4 Na+, 5.4 K+, 1.0 Ca2+, 1.2 Mg2+, 121.8 Cl−, 1.2 SO 24 , 6.0 phosphate, 15.0
HEPES, 1.0 pyruvate, and 10.0 glucose, plus 10 mg/l phenol red, 0.1 mg/ml
gentamicin, and 2.0% fetal calf serum). The pH was adjusted to 7.4 immediately
before use and the temperature was maintained at +37 °C. The segment was
mounted on a precleaned glass slide (luminal side facing up) and the mucosa was
gently scraped off. The scraping procedure was adapted from Sjoblom et al.
(Sjoblom et al. 2003). The duodenal remnant was evaluated by morphological
examination, and cells originating from submucosal Brunner's glands were
excluded from the preparations. The scraped-off mucosa was cut into small pieces
of 0.3–0.8 mm in diameter. The pieces were then scattered and briefly shaken in
NRM solution with 0.5 mM DTT. After 2–3 min sedimentation, the supernatant
was removed and the tissue fragments remaining in the sediment were washed
three times in DTT-free NRM solution. The tissue fragments were gassed with
100% O2 and portions (15–20 µl) were digested for 2–3 min by inoculation in 10
74
ml NRM solution containing 0.1 mg/ml collagenase type H and 0.1 mg/ml
dispase II. After digestion at +37 °C in a horizontal shaking water bath, the
reaction was quenched by adding DTT to a final concentration of 0.3 mM. The
solution was centrifuged for 3 min at 1000 × g. The resulting pellet was washed
three times by suspension in 10 ml DMEM/F-12 with 15 mM HEPES and 2.5
mM glutamine (3 min at 1000 × g). In addition, DMEM/F-12 always included
HCO3 (1 mM), gentamicin (0.01 mg/ml), and fetal calf serum (2.0%). In addition,
the pH of the solutions were adjusted to 7.40. Finally, the resulting pellet was
suspended in ~1 ml of DMEM/F-12 and put on ice. Cooling of the sample
increases the viability of the enterocyte clusters (Sjoblom et al. 2003). The
viability of the enterocytes was tested by Trypan blue. The final sample included
clusters of interconnected duodenal enterocytes as well as a few single cells. The
majority of the cluster cells showed morphological characteristics typical of crypt
cells (Chew et al. 1998). In the present experiments, submucosal tissue was not
included. In addition, no enteric neurons were detected under a visual inspection
with light microscopy, and fluorescence microscopy with fura 2-AM, a substance
staining the enteric neurons, loaded preparations. Clusters of 10–50
interconnected cells were chosen for further imaging analysis and up to 50
enterocytes were selected (caged) prior to administration of orexin receptor
ligands or atropine. Calcium signaling of each caged enterocyte was saved to a
computer and analyzed at the end of experiments.
4.2.6 Human biopsies and preparation of enterocytes
Human duodenal biopsy samples were obtained from patients undergoing upper
endoscopy at the Gastroenterology Unit, Uppsala University Hospital and they
showed endoscopically normal duodenal and gastric mucosa. The patients did not
eat any food in the morning before the endoscopy. Biopsy samples were taken
between 09:00–10:00 a.m. with a single-use biopsy forceps (Boston Scientific,
Natick, MA) and were immediately placed into 20 ml of sterile DMEM/F-12
medium (15 mM HEPES, L-glutamine, and 1 mM HCO3 , 2.0% fetal calf serum
and 0.01 mg/ml gentamicin) and transported to the laboratory. The samples were
cut into fine pieces at room temperature within 20–40 min after removal. Clusters
of duodenal enterocytes were prepared and the Trypan blue exclusion test of cell
viability was used as described above. The project was approved by the Ethics
Committee of the Medical Faculty at Uppsala University, and all subjects
provided written, informed consent.
75
4.2.7 Calcium imaging
70 µl of the cell cluster suspension was loaded with fura 2-AM (2 µM) for 20–30
min in an electrolyte solution (in mM: 141.2 Na+; 5.4 K+; 1.0 Ca2+; 1.2 Mg2+;
146.4 Cl−; 0.4 phosphate; 20.0 TES and 10.0 glucose; pH 7.40). The loading took
place at +37 °C. This solution had been previously used for studies of cell
aggregates (Shariatmadari et al. 2001, Sjoblom et al. 2003). Probenecid (1 mM),
pluronic F-127 (0.02%), and fetal calf serum (2.0%) were also included in the
loading procedure. The suspension was gently centrifuged and the resultant
concentrated pool of clusters was placed on an uncoated and precleaned circular
glass coverslip (diameter 25 mm; Knittel, Braunschweig, Germany) at the bottom
of a temperature-controlled (+37 °C) perfusion chamber. The coverslip was
covered by a uniformly sized pore polycarbonate membrane filter. The covering
filter and the cell preparation were superfused (1 ml/min) with the electrolyte
solution and receptor ligands to be tested by inclusion in the perfusate.
Calibration of the fluorescence data was performed in vitro according to the
method introduced by Grynkiewicz et al. (Grynkiewicz et al. 1985). The
fluorescence ratio calibration curve was made using the fura 2 calcium imaging
calibration kit (F-6774; Molecular Probes, Eugene, OR). Changes in [Ca2+]i in the
fura 2-AM-loaded cells were measured by the dual-wavelength excitation ratio
technique by exposure to alternating 340- and 380-nm light with the use of a filter
changer under the control of an InCytIM-2 system (Intracellular Imaging,
Cincinnati, OH) and a diachronic mirror (DM430; Nikon, Tokyo, Japan).
Emission was measured through a 510-nm barrier filter with an integrating
charge-coupled device camera (Cohu, San Diego, CA), and measurements were
performed 30 times per minute. The relative increase in [Ca2+]i was expressed as
the ratio of the fluorescence intensity at 340 nm to that at 380 nm (340 nm/380
nm) and converted to [Ca2+]i.
4.2.8 Quantitative real-time PCR
Continuously fed and overnight-fasted rats were killed by decapitation between
9:00 and 10:00 a.m.. A 10–15 mm segment of duodenum, starting 5 mm distal to
the pylorus was promptly excised via an abdominal midline incision and freed
from mesentery. The segment was then opened along the antemesenterial axis,
mounted as a sheet and cut into 2-mm-thick slices. Slices were treated with
RNAlater for pending analysis (Qiagen, Hilden, Germany). In contrast, clusters of
76
enterocytes devoid of duodenal submucosa were promptly frozen in liquid
nitrogen and then kept at −78 °C before further experiments. The extraction of
total RNA and the digestion of genomic DNA was done like previously described.
cDNA was synthesized from 1 µg RNA by using the TaqMan reverse
transcription reagents (Applied Biosystems INC) with random hexamers as
primers. Specific primers (Table 2) for orexin receptors, rat β-actin mRNA (for
duodenal slices) and 18s rRNA endogenous control (for clusters of enterocytes)
were designed with the eprimer3 program or taken from the literature (Schmittgen
& Zakrajsek 2000, Beck et al. 2001). Primers were synthesized either at the A. I.
Virtanen Institute, Kuopio, Finland, or at the TAG Copenhagen A/S, Denmark.
PCR reactions were performed with the ABI-PRISM 7700 or ABI PRISM 7300
sequence detection system (Applied Biosystems) in total volume of 30 µl.
Reactions contained a 2-µl sample (400 ng), 1× SYBRgreen master mix (Applied
Biosystems) and forward and reverse primers (15 pmol forward and 30 pmol
reverse for OX1 primers, 15 pmol of both OX2 primers and 6 pmol of both rat βactin primers or 5pmol of both 18s primers). All samples were done as duplicates
in the following conditions: 2 min at 50 °C and 10 min at 95 °C, followed by 42
cycles of 15 s at 95 °C and 1 min at 62 °C. Each assay included a relative
standard curve of three serial dilutions of cDNA from fasted rats and no template
controls. The cycle threshold (Ct) values below 35 were considered as positive
and the others negative. Results were calculated according to the manufacturer's
descriptions (ABI PRISM 7700 or ABI PRISM 7300 Sequence Detection System,
Applied Biosystems).
Table 2. Primers used in quantitative real-time PCR for analysis of orexin receptors.
Gene
Forward
Reverse
Eukaryotic 18s rRNA
GTAACCCGTTGAACCCCATT
CCATCCAATCGGTAGTAGCG
Rat β-actin
CAACCGTGAAAAGATGACCCAGA ACGACCAGAGGCATACAGGGAC
Rat OX1R
GCGCGATTATCTCTATCCGAA
AAGGCTATGAGAAACACGGCC
Rat OX2R
GGAGTGCCATCTTCACTCCTG
GATTCCATAAGGATGCTCGGG
4.2.9 Western blotting
Samples of duodenal mucosa from four fed and four overnight-fasted rats were
homogenized in 60 µl of solubilizing solution [25 mM Tris pH 7.4, 0.1 mM
EDTA, 1 mM DTT, 15µl/ml protease inhibitor cocktail (Sigma-Aldrich, St. Louis,
MO)] by sonication at +4 °C for 15 min. After centrifugation (12,500 rpm, 15 min,
77
+4 °C), total protein concentrations were measured by the Bradford method (BioRad protein assay, Bio-Rad Laboratories, Munich, Germany). Equal amounts of
protein (100 µg protein/lane) were electrophoresed on a 12.5% SDSpolyacrylamide gel and then transferred to a nitrocellulose membrane [Bio-Rad,
Trans-Blot transfer medium, Pure Nitrocellulose Membrane (0.2 µm), Bio-Rad
Laboratories, CA]. Blocking was done with 5% nonfat milk powder in TBS
containing 0.01% Tween 20 at room temperature for 1 h. Incubation with OX1
antibody (1:1000, anti-rat/human orexin 1, cat no. OX1R11-A, Alpha Diagnostic
International, San Antonio, TX, USA) was performed overnight at +4 °C. β-Actin
antibody (1:2000, no. 4967, Cell Signaling Technology, Danvers, MA) was used
as a loading control. Membranes were then washed and incubated with a
secondary antibody [1:10000, Zymax goat anti-rabbit IgG(H+L) horseradish
peroxidase conjugate, Zymed, San Francisco, CA] for 1 h. Afterward, blots were
washed and chemiluminescence detected with an ECL Plus (GE Healthcare,
Amersham, UK) according to the manufacturer's instructions. Detection was
made with the Typhoon 9400 Imager (GE Healthcare) and band densities were
analyzed with the ImageQuant TL program (GE Healthcare).
4.2.10 Data analyses
The descriptive statistics are expressed as ratio of proportions and a 95%
confidence interval for categorical data and otherwise as means ± SE, except for
quantitative real-time PCR, where results are expressed as ± SEM. Rates of
alkaline secretion by the duodenum are expressed as microequivalents of base
( HCO3 ) per centimeter of intestine per hour. The secretion and the mean arterial
blood pressure were recorded continuously and registered at 10-min intervals.
The statistical significance of data was tested by repeated-measures ANOVA. To
test the difference within a group, a one-factor repeated-measure ANOVA was
used, followed by Tukey's multiple comparison post hoc test. Between groups,
comparison was made by two-factor repeated-measures ANOVA, followed by a
one-way ANOVA at each time point. If the ANOVA was significant at a given
time point, a Tukey's multiple comparison post hoc analysis was used. When
appropriate, the statistical significance of data was calculated and tested by
Fisher's exact test. Linear trend between doses was tested by the 2 test for trend.
Some cells spontaneously increase [Ca2+]i during the experimental period,
probably reflecting the presence of cell-to-cell signaling within the cluster
preparations. The figures display the ratio of proportions between orexin78
responding cells and spontaneously responding controls. A ratio larger than 1,
indicated by a dashed line in figures, thus indicates the OXA-induced stimulation
of calcium signaling. Orexin receptor expression data between groups were
compared by the Student's nonpaired t-test. p values of <0.05 were considered
significant. All statistical analyses were performed on an IBM-compatible
computer using GraphPad Prism 4.0 (GraphPad Software, San Diego, CA).
79
80
5
Results
5.1
Generation and characterization of hPPO overexpressing
mouse line
Analysis of the offspring by genomic PCR and Southern blot analysis of tail
DNAs digested with EcoRI and hybridized with a cDNA corresponding to the
hPPO gene identified two potential founders. The mouse line UKU351F was
chosen for further studies for its higher hPPO transgene expression levels. The tg
mice were viable and fertile. Southern blot analysis confirmed the integration of
the hPPO transgene in the mouse genome (Figure 4A). The transgene was
transmitted to all founders in a Mendelian fashion. Those offspring that did not
inherit the transgene were considered as wt littermates and used in our studies as
control animals. Transgene expression was analysed by quantitative real-time
PCR. Transgene expression was observed in the hypothalamus (Figure 4B),
duodenum and pancreas (data not shown) with the highest expression in the
hypothalamus (Figure 4C). The cycle threshold (Ct) values for hPPO in tg mice
hypothalamus samples were between 26.84–27.63. The transgene was not
detected in any of the tissues of the wt mice. In addition, hPPO transgene
expression did not affect endogenous mouse PPO levels in tg mice (data not
shown).
81
Fig. 4. A) The genomic Southern blot analysis of the hPPO gene in tg and wt mice.
Analysis showed that tg mice have one integration site for hPPO genes in the genome
while nothing was detected in wt mice. B) Quantitative real-time analysis of hPPO in
the hypothalamus. The samples were run on 1.0% agarose gel. hPPO is expressed in
the hypothalamus (third lane) of tg mice. No expression was detected in the no
template control (Ntc, second lane) or wt mice hypothalamus (fourth lane). C)
Human/mouse OXA Western blot analysis in the hypothalami of tg and wt mice. Tg
mice showed a remarkably increased amount of OXA in the hypothalamus while
nothing was detected in wt mice. I, published by permission of Acta Physiol (Oxf.)
5.1.1 Basic characterization of the mice
Quantitative real-time PCR
Mouse endogenous mRNA expression levels for OX1R and OX2R were studied
as possible physiological adaptation in response to hPPO overexpression. The
mRNA levels of mouse OX1R were slightly, although not significantly, decreased
in the hypothalami of tg mice (data not shown) compared with their wt littermates,
while the expression of hypothalamic mouse OX2R mRNA was significantly
(wt = 1.790 ± 0.2208, tg = 1.036 ± 0.1234, p = 0.0177, mean ± SEM, n = 5)
down-regulated in tg mice compared with wt mice.
We found no statistically significant differences in the expression levels of
OX1R or OX2R in the BF, cortex or hippocampus (data not shown) between wt
and tg mice. Only minor trends towards lower OX1R expression levels in tg mice
hippocampus and OX2R expression levels in the cortex were observed,
82
suggesting that hPPO transgene expression has no significant effect on mouse
endogenous OX1R or OX2R receptor expression in the brain except lowered
OX2R expression in the hypothalamus.
The expression of OX1R mRNA was detected in the hypothalamus of wt
mouse as a positive control, but also in WAT (Study II, Fig. 1A). The cycle
threshold (Ct) values for OX1R in wt mice hypothalamus and WAT samples were
between 26.34–26.87 and 30.08–32.3, respectively. No OX2R mRNA expression
was detected in WAT of wt mouse (data not shown).
Western blot analysis
Western blot analysis of human and mouse endogenous OXA was performed to
detect the differences between wt and tg mice. Expression of OXA protein (~ 3.5
kDa) in the hypothalamus is shown in Figure 4C. OXA was overexpressed in the
hypothalamus of tg mice, compared with wt littermates (Figure 4C). Mouse
endogenous OXA was below the detection limit in the hypothalamus of wt mice
(Figure 4C). In addition to the hypothalamus, OXA was expressed also in the
pancreas and duodenum (data not shown), which have also been demonstrated by
others previously (Kirchgessner & Liu 1999). OXA was not detectable in the
spleen of transgenic mice, indicating that there is no ectopic expression
(Figure 4C).
Protein levels of OX1R in the wt mice hypothalamus (positive control) and
WAT samples were determined by Western blotting. OX1R was detected in the
hypothalamus and the WAT of wt mice with an apparent molecular mass of about
48 kDa, while nothing was detected in the muscle tissue (negative control) (Study
II, Fig. 1B). No OX2R was detected in WAT or muscle of wt mice (data not
shown).
Immunohistochemical analysis
Immunohistochemical analysis of human and mouse endogenous OXA was
carried out for the brain sections of wt and tg mice to compare protein expression
levels in perifornical LHA where orexins are mainly expressed. OXA-producing
cells were detected in the perifornical LHA in wt and tg mice (Figure 5, left and
right, respectively). However, in tg mice, OXA immunofluorescence intensity, but
not the number of immunopositive neurons, was increased in comparison with
their wt littermates.
83
Fig. 5. Immunohistochemical analysis of OXA in brains from wt (left figure) and tg
(right figure) mice. Brain sections were treated with human/mouse OXA antibody, and
OXA-producing cells were detected in the perifornical LHA in both wt and tg mice. The
neuronal expression of hPPO (visualized as intensity of immunofluorescence) was
increased in tg mice compared with their wild type littermates. I, published by
permission of Acta Physiol (Oxf.)
RIA for orexin, leptin and ghrelin
Tg mice had slightly, but not significantly, increased (16%) amount of OXA
immunoreactivity in their pooled (n = 5) plasma sample, compared with their wt
littermates (28.8 pg/ml vs. 24.2 pg/ml), respectively. No significant differences
were observed in the plasma ghrelin (n = 4) or leptin (n = 4 for wt mice and 3 for
tg mice) levels between wt and tg animals. The ghrelin levels were as follows: wt
mice 572.8 ± 82.2 pmol/ml and tg mice 701.1 ± 144.1 pmol/ml. Plasma leptin
levels were 5.5 ng/ml ± 1.1 for wt mice and 4.4 ng/ml ± 1.5 for tg mice. The
mRNA levels of leptin in WAT were significantly decreased in tg male mice
compared with their wild type littermates (p = 0.0191).
Plasma cholesterol and triglyceride levels
hPPO transgene expression did not affect plasma cholesterol and triglyceride
levels. The plasma cholesterol levels were 2.25 ± 0.04 mmol/l in wt mice and
2.43 ± 0.1 mmol/l in tg mice, whereas triglyceride levels were 0.8 ± 0.14 mmol/l
and 0.86 ± 0.12 mmol/l in wild type and tg mice, respectively (n = 5 in both
groups).
84
Glucose tolerance test
No significant difference was observed in plasma glucose or insulin levels
between wt or tg mice at any given time point, neither in anaesthetized (n = 5,
data not shown) or non-anaesthetized (n = 5, data not shown) animals, during the
glucose tolerance test.
Growth
A trend towards smaller body weight was observed in tg male mice compared to
wt mice. Tg mice were smaller since the start of the measurement until the 20th
week (Study II, Fig 2). However, the differences were not statistically significant.
mRNA expression of UCPs and PPARs (delta and gamma)
Total RNA was extracted from the hypothalamus, WAT, BAT and skeletal muscle
from both wt and tg mice and reverse transcribed to cDNA. Gene expression
analysis of UCPs 1, 2 and 3 were performed by quantitative real-time PCR.
Expression level of UCP2 in WAT was significantly increased in RT housed tg
mice compared with their wt littermates (two-tailed, unpaired Student’s t test,
p = 0.0181; Table 3; Study II, Fig. 7), while the expression of UCP1 and UCP3
did not significantly differ in any of the given tissues (Table 3). The mRNA levels
of UCP2 in WAT of tg mice were increased by 53% compared with wt littermates.
After 4 days of cold exposure at +4ºC, no significant differences were observed in
BAT, WAT or muscle UCPs mRNA levels between genotypes (data not shown).
mRNA expression of PPARdelta and PPARgamma in WAT were significantly
elevated in RT housed tg mice when compared with their wt littermates
(p = 0.0141, p = 0.0220, respectively) (Study II, Figs 8A,B). The mRNA levels of
PPARdelta (Study II, Fig. 8A) and PPARgamma (Study II, Fig. 8B) in tg animals
were increased by 67% and 45%, respectively.
85
Table 3. UCP1, 2 and 3 mRNA expression levels in hPPO wt and tg mice tissues.
Tissue and analyte
mRNA expression level (wt)
mRNA expression level (tg)
(Analyte mRNA/18s rRNA)
(Analyte mRNA/18s rRNA)
BAT UCP1 (1)
1.086 ± 0.1159
0.7296 ± 0.2347
WAT UCP1 (1)
0.5350 ± 0.1776
0.4790 ± 0.1687
WAT UCP2 (1)
1.195 ± 0.1847
Muscle UCP3 (1)
1.450 ± 0.3436
1.410 ± 0.3168
BAT UCP1 (2)
1.397 ± 0.2208
1.267 ± 0.1385
WAT UCP1 (2)
0.3291 ± 0.1886
0.4901 ± 0.09019
WAT UCP2 (2)
0.8917 ± 0.1348
0.9771 ± 0.1166
1.053 ± 0.1847
1.634 ± 0.5222
Muscle UCP3 (2)
2.548 ± 0.3772*
* p < 0.05 (two-tailed, unpaired Student's t test), wt = wild type, tg = transgenic, (1) Measurements made in
RT (+20ºC), (2) Measurements made in cold (+4 °).
5.1.2 The characterization of the sleep-wake patterns in hPPO
overexpressing mice
Vigilance states and EEG power during baseline recordings
Vigilance state scores of the 24 h baseline recording were analysed in 1 h time
bins and averaged into 24 or 12 h (light or dark) periods. No statistically
significant differences between genotypes were found in the percentage of time
spent in each vigilance state, in vigilance state bout durations or in the number of
state transitions (brief awakenings, SWS to wake or REM to wake transitions)
(Study I, Table 1).
An hour by hour analysis of the circadian distribution of vigilance states
(Figures 6A,B,C) revealed statistically significant differences (two-way repeatedmeasures ANOVA with Holm-Sidak, p < 0.05) between genotypes in the light–
dark transition periods: tg mice spent less time awake and more time in SWS
during the early hours of the dark period while during the late hours of the dark
period they spent more time awake and less time in SWS. REM sleep was
reduced in tg mice compared with wt mice at a few time points during both the
light and dark periods (Figure 6C).
The mean EEG power spectra between 1 and 35 Hz in 1 Hz bins were
calculated separately for WAKE, SWS and REM sleep by averaging the EEG
power of the scored epochs over the 24 h BL period. No major differences
between the genotypes were found (Study I, Figs 4B,D,F).
86
Fig. 6. Vigilance states during baseline. Percentage of time spent in each vigilance
state (A: Wake; B: SWS; C: REM) during the 24 h baseline recording in consecutive 1 h
time bins. The light and dark periods are indicated below the X-axis with horizontal
white and black bars respectively. Individual bins in which a statistically significant
(two-way repeated-measures ANOVA with Holm-Sidak, p < 0.05) difference between
genotypes was present are indicated with asterisks. The arrows point to the direction
of change in which the tg mice differ from their wt mice. Genotypes are indicated as
follows: tg (•; n = 10), wt (○; n = 5). I, published by permission of Acta Physiol (Oxf.)
Vigilance states and EEG during SD and recovery sleep
Vigilance state scores of the SD, and the following recovery sleep period were
analysed in 1 h time bins and averaged into 6 h SD, 6 h lights on recovery period
87
(immediately following the SD), 12 h lights off recovery period and into the total
18h recovery period. SD was effective in keeping the animals awake as mice were
awake on average 93.7 ± 1.7% of the time (wt: 95.6 ± 1.5%, n = 6; tg:
92.9 ± 2.5%, n = 9, Study I, Fig. 5A). Transgenic mice had more EEG power in
the low (1 Hz) delta frequency range (1 Hz, p < 0,05) in the WAKE state
compared with wt during SD (two-way repeated-measures anova with HolmSidak, p < 0.05; Study I, Fig. 5B). EEG data are shown as normalized to
corresponding spectra of the BL day (% of BL power).
No significant differences between genotypes were found during recovery
sleep in the amount of SWS, number of brief awakenings or latency to SWS (as
investigated by the MMSLT) (Study I, Table 2, Fig. 5C). The amount of REM
sleep, however, was reduced in tg mice compared with wt mice at several time
points during both the light and dark periods (Study I, Table 2; Figure 7).
Fig. 7. Percentage of time spent in REM state during the 24 h recording period in
consecutive 1 h time bins. Sleep deprivation was performed during the first 6 h of light
period and in the following 18 h, undisturbed recovery sleep was allowed. The light
and dark periods are indicated below the X-axis with horizontal white and black bars,
respectively. Individual time bins in which a statistically significant (two-way repeatedmeasures ANOVA with Holm-Sidak, p < 0.05) difference between genotypes was
present are indicated with asterisks. The arrows point to the direction of change in
which the tg mice differ from their wt mice. Genotypes are indicated as follows: tg (•;
n = 10), wt (○; n = 5). I, published by permission of Acta Physiol (Oxf.)
88
To investigate the actual recovery sleep response, sleep amounts and the EEG
power spectra were compared to corresponding circadian time points of the
baseline day within each individual animal. The amounts of SWS and REM sleep
compared to baseline increased in both groups (Study I, Table 2), thus both
groups showed a recovery sleep response. After baseline normalization, no
statistically significant differences between genotypes were found (Study I,
Table 2). Sleep intensity as defined by increased SWS EEG delta (1–4 Hz) power
increased in both groups (Study I, Fig. 5D). A statistically significant (two-way
repeated-measures ANOVA with Holm-Sidak, p < 0.05) attenuation in SWS EEG
power increase in the low delta range (1–2 Hz) was found in tg mice, compared
with wt mice during the first 2 h of recovery sleep (Study I, Fig. 5B).
5.1.3 Physiological and behavioral analysis of the hPPO
overexpressing mice
Physiological and behavioural analysis with the automated animal monitoring
system documented a similar total food and water intake in tg mice and their wt
littermates, housed in RT (data not shown). However, body weight adjusted food
intake and food intake per mouse were significantly increased in tg mice
compared with wt mice when only the daytime food intake (12 h) from 3 days
was analyzed (Study II, Figs 3A,B, (two-tailed, unpaired Student's t test,
p = 0.0282 and 0.0293, respectively). The body weight adjusted food intake levels
were 0.1967 ± 0.03785 g/g body weight in wt mice and 0.3548 ± 0.03987 g/g
body weight tg mice, whereas food intake levels per mouse were 5.030 ± 0.8101
g and 8.153 ± 0.7397 g in wt and tg mice, respectively (n = 4 in both groups).
However, no significant difference was observed in the night time food intake
(data not shown). In addition, tg mice showed increased heat production during
the whole testing period (Figure 8). No significant differences were observed in
the total locomotor activity between wt and tg mice (Study II, Fig. 5A).
89
Fig. 8. Heat production in tg and wt mice housed in RT. First 48 hours of the
measurement are shown in this figure. Wt mice are marked with solid line and tg mice
with dashed line. Vertical dashed lines separate the day time (the beginning of the
measurement) and the night time. Tg mice showed increased heat production
compared with wt mice. Values are represented as mean ± SEM.
After acute cold exposure, no differences were observed in total water or food
intake between wt and tg mice (data not shown). Neither was any difference
observed in metabolic heat production between wt or tg mice (Study II, Fig. 4B).
However, a difference was observed in total motor activity. Tg mice showed
decreased activity due to cold exposure compared with wt mice (Figure 9). When
the night time activity was calculated cumulatively (1st and 2nd night periods), the
total activity of tg mice was significantly decreased compared with wt mice
(Study II, Fig. 6, two-tailed, unpaired Student's t test, p = 0.0494, wt; n = 7, tg;
n = 8). The values for wt mice were 6256 ± 623.8 counts, while for tg they were
4305 ± 416.9 counts. In general, both genotypes showed a notable decrease in
their total activity due to acute cold exposure when compared with mice placed in
RT.
90
Fig. 9. Total locomotor activity of tg and wt mice housed in +4ºC. First 48 hours of the
measurement are shown in this figure. Wt mice are marked with solid line and tg mice
with dashed line. Vertical dashed lines separate the day time (the beginning of the
measurement) and the night time. Tg mice showed reduced activity compared with wt
mice. Values are represented as mean ± SEM.
Temperature telemetry
Temperature telemetry analysis showed no significant difference in the core body
temperature of tg mice when compared with wt littermates in RT (data not shown).
All mice showed a clear circadian rhythmicity in core body temperature (data not
shown).
5.2
Effects of food deprivation on duodenal mucosal bicarbonate
secretion and orexin receptors expression in rat duodenal
mucosa and in acutely isolated duodenal enterocytes
5.2.1 In situ experiments
Experimental related factors
In all cases, the in situ isolated perfused rat duodenum spontaneously secreted
HCO3 at a steady basal rate, and neither this secretion nor the mean arterial blood
pressure was influenced by the intra-arterial or luminal administration of vehicle
91
(isotonic saline) alone. The i.c.v. infusion of vehicle (artificial cerebrospinal fluid)
alone did cause a slight and continuous rise in duodenal alkaline secretion, but did
not affect the arterial blood pressure. In some experimental groups, there was a
slight decline in the mean arterial blood pressure during the (up to) 240 min-time
period of the experiments. However, the blood pressure remained ≥ 90 mmHg in
all animals studied. Animals were continuously infused intravenously with
Ringer-bicarbonate solution, and blood acid-base balance was measured in all
experimental groups. Mean blood pH was 7.36 ± 0.01 at the start of the first
control period and 7.38 ± 0.01 at the end of experiments (n = 110). Blood HCO3
concentrations were 30.7 ± 0.3 and 28.7 ± 0.3 mM, respectively. The slight
decrease in blood HCO3 concentration attained statistical significance (p < 0.05),
but no significant differences between experimental groups were observed.
Intra-arterial administration of OXA and SB-334867
Close intra-arterial infusion of OXA (60, 240 and 600 pmol·kg−1·h−1) caused a
dose-dependent increase (p < 0.05 with 60 and p < 0.01 with 240 and 600
pmol·kg−1·h−1) in mucosal HCO3 secretion in fed rats (Figure 10). Infusion of the
lowest dose (60 pmol·kg−1·h−1) alone for extended period of time (150 min, n = 8)
caused an initial (40 min) rise in secretion from 15.0 ± 2.4 to 17.8.5 ± 2.4
µeq·cm−1·h−1. The rate of HCO3 secretion then remained at the latter plateau
throughout the experimental period. In contrast to the stimulation in fed rats, no
response was observed to the infusion of OXA at any given dose in overnightfasted rats (n = 6, data not shown), confirming a previous study (Flemstrom &
Sjoblom 2005).
92
OXA pmol/kg, h
−1
−1
Fig. 10. Close intra-arterial infusion of OXA (60–600 pmol·kg ·h ) in continuously fed
rats. Pretreatment with the OX1R antagonist SB-334867 (6 nmol/kg, intra-arterial bolus
dose) inhibited orexin-induced secretion. Muscarinic antagonist atropine (0.75
−1
µmol/kg iv followed by 0.15 µmol·kg ·h
−1
iv) had no effect on the stimulation induced
by OXA. SB-334867 (SB) was injected and administration of atropine (Atr) started as
indicated. Means ± SE of HCO 3 secretion and mean arterial blood pressure (BP) in
OXA-infused animals and in control animals receiving vehicle alone are shown (n ≥ 7
in all groups). III, published by permission of Am J Physiol Gastrointest Liver Physiol.
Pretreatment with the OX1R antagonist SB-334867 (6 nmol/kg intra-arterial
bolus dose) inhibited the secretory response to OXA (Figure 10). Even the highest
93
rate of OXA infusion (600 pmol·kg−1·h−1) did not cause a rise in secretion in
animals pretreated with SB-334867 (p > 0.05). Intra-arterial bolus injection of
SB-334867 alone (6 nmol/kg) tended to increase basal HCO3 secretion (Figure
10; Study III, Fig. 4), but the slight rise in secretion did not attain statistical
significance (p > 0.05). In contrast, intra-arterial bolus injection of a tenfold
higher dose of SB-334867 (60 nmol/kg) caused a significant (p < 0.05) rise in
secretion (n = 5, not shown). The lower dose of 6 nmol/kg was thus selected for
studies of the antagonist action of SB-334867 (Figure 10; Study III, Fig. 4).
A partial agonist action of SB-334867 was confirmed by continuous intraarterial infusion of the compound at consecutively increasing rates (Study III, Fig.
3). In fed animals, there was a rise in HCO3 secretion that attained significance (p
< 0.05) with the highest dose infused (6 nmol·kg−1·h−1). Effects of continuous
infusion of SB-334867 were tested also in overnight food-deprived animals
(Study III, Fig. 3). No significant increase in secretion was observed in the fooddeprived group, indicating a partial agonist action of SB-334867, appearing only
in fed animals and at infusion of higher doses of the compound.
Blood glucose concentration was 8.3 ± 0.8 mM at the start of the initial
control period, preceding infusion of OXA alone, and 6.7 ± 0.7 mM at the end of
these experiments. There was a decline in blood glucose of very similar
magnitude in control animals infused with vehicle (isotonic NaCl) alone, from 9.5
± 0.3 to 6.5 ± 0.5 mM (n = 6). A decline in blood glucose concentration of similar
magnitude occurred also in animals pretreated with SB-334867.
Effects of muscarinic receptor ligands
The muscarinic antagonist atropine (0.75 µmol/kg bolus dose followed by 0.15
µmol·kg−1·h−1, both i.v.) did not affect the orexin-induced rise in mucosal HCO3
secretion (Figure 10). Basal secretion as well as secretion stimulated by infusion
of 60 and 240 pmol·kg−1·h−1 of OXA appeared higher in the atropine-treated
group than in animals infused with OXA alone, but differences between groups
did not attain statistical significance (p > 0.05). In contrast, atropine abolished
stimulation induced by the muscarinic agonist bethanechol and also prevented the
bethanechol-induced decline in mean arterial blood pressure (Study III, Fig. 4).
Bethanechol alone significantly (p < 0.05) stimulated secretion at a dose of 5
µmol·kg−1·h−1. Higher doses of bethanechol caused a marked decline in the mean
arterial blood pressure and were therefore not used.
94
Bethanechol-induced secretion was studied in some further experiments. The
intra-arterial bolus dose of SB-334867 (6 nmol/kg), inhibiting stimulation by
OXA (Figure 10), did not prevent the rise (p > 0.05) in secretion induced by
bethanechol (Study III, Fig. 4). Nor did this dose of SB-334867 affect the
decrease (p < 0.05) in mean arterial blood pressure induced by the two larger
doses of bethanechol. The absence of effects of atropine on orexin-induced
secretion (Figure 10) and of SB-334867 on bethanechol-induced secretion (Study
III, Fig. 4) suggests independence between pathways for OXA and muscarinicinduced stimulation of the duodenal HCO3 secretion.
Luminal administration of OXA
Glucagon, uroguanylin, heat-stable enterotoxin and the neurohormone melatonin
are potent stimuli of the duodenal secretion when added to the luminal perfusate
(Joo et al. 1998, Flemstrom et al. 1999, Sjoblom & Flemstrom 2003). In addition,
previous results have shown that orexin releases cholecystokinin from the
neuroendocrine cell line STC-1 (Larsson et al. 2003, Allen & Flemstrom 2005).
In the present study, the presence of OXA (1 to 100 nM) in the luminal perfusate
did not affect the HCO3 secretion by the duodenal mucosa (Study III, Fig. 5).
There were no significant differences in rates of secretion between OXA perfused
and control animals. Nor did luminal OXA affect the mean arterial blood pressure
or the decline in blood glucose concentration during the experimental period (data
not shown). Prostaglandin E2 (20 µM), added to the luminal perfusate at the end
of all experiments as a test of the viability of the preparation, caused a similar rise
in HCO3 secretion in OXA-perfused and control animals (p < 0.01 in both
groups).
Central nervous administration of OXA
An i.c.v. infusion of OXA (2 or 20 nmol·kg−1·h−1) caused a small continuous rise
(p < 0.05) in duodenal HCO3 secretion, and this rise continued after cessation of
OXA infusion (Study III, Fig. 6). However, there was a similar increase (p < 0.05)
in secretion in control animals infused with vehicle (artificial cerebrospinal fluid)
alone (Study III, Fig. 6), and the rise in HCO3 secretion in the two orexin-infused
groups was not significantly different (p > 0.05) from that in the control group.
The mean arterial blood pressure in orexin-infused animals remained at a stable
95
level (p > 0.05) and was very similar to that observed in animals infused with
artificial cerebrospinal fluid alone (Study III, Fig. 6).
The absence of an effect of i.c.v. OXA on the duodenal alkaline secretion
could in theory reflect operation-induced damage of the vagal supply to the
cannulated duodenal segment. Central nervous administration of TRH is known
to elicit stimulation of the duodenal alkaline secretion mediated by the vagal
nerves (Flemstrom & Jedstedt 1989, Lenz et al. 1989). I.c.v. TRH caused a rapid
rise (p < 0.05) in duodenal secretion in the present study (Study III, Fig. 6),
confirming that the cannulated segment had persistent efferent vagal supply, and
also slightly increased (p < 0.05) the mean arterial blood pressure. Blood glucose
concentration decreased from 8.8 ± 0.5 to 8.2 ± 0.6 mM in animals infused
intracerebroventricularly with 2 nmol·kg−1·h−1 of OXA, and from 10.3 ± 0.9 to
8.0 ± 0.9 mM in those infused with the higher dose of 20 nmol·kg−1·h−1. These
decreases in glucose concentration were not different from that of the 10.2 ± 0.5
to 8.0 ± 0.5 mM observed in the control animals infused with vehicle alone.
5.2.2 In vitro experiments
OXA induced calcium signaling in rat enterocytes
Experiments were run on preparations taken from the final pellet up to 6 h after
the isolation procedure, and selected (caged) enterocytes were studied for up to 25
min in the temperature-regulated perfusion chamber. Enterocytes were selected
primarily from clusters of 10–50 interconnected enterocytes. As tested by Trypan
blue exclusion, the enterocyte viability was >95% after preparation and remained
at >80% after a 6-h period. Most caged cells displayed a stable [Ca2+]i of ~100
nM during the initial prepeptide period of the experiments. Control experiments
were performed by perfusion with ligand-free electrolyte solution.
Fed animals had free access to their regular supply of food until the start of
the experiments. OXA was added to the perfusate at two concentrations in each
experiment. Exposure to the peptide at a concentration of 1 nM was followed by
exposure to 10 nM (271 cells in clusters from 8 rats), or exposure to a
concentration of 10 nM was followed by 100 nM (220 cells in clusters from 5
rats). The duration of exposure to each concentration was 180 s. OXA increased
[Ca2+]i at all concentrations tested (p < 0.01) in enterocytes harvested from
continuously fed animals (Figure 11). The proportion of responding cells
96
increased dose dependently from ~16% at the lowest concentration of 1 nM to
~20% at 10 nM and ~29% at 100 nM (trend, p < 0.05). In the majority of
responding cells, [Ca2+]i increased without a clear initial peak to reach a sustained
plateau that remained stable within the experimental period. Cessation of
exposure to OXA did not result in any immediate decline in [Ca2+]i. The
magnitude of the rise in [Ca2+]i was concentration dependent in cells that
responded already to the lower of the two tested concentrations of OXA (Study IV,
Fig. 2). The cholinergic agonist carbachol (100 µM) was added to the perfusate in
some experiments as a test of the viability of the enterocytes from fed animals. In
contrast to OXA, carbachol induced intracellular calcium signaling (p < 0.001,
data not shown) in the majority of the caged enterocytes. OXA (10 and 100 nM)
increased [Ca2+]i also in the absence of calcium in the perfusate (153 enterocytes
in clusters from 5 rats). As in the presence of extracellular calcium, the peptide
induced a [Ca2+]i response in a significant (p < 0.01) proportion of enterocytes.
The signaling pattern was, however, distinctly different from that observed in
cells with access to extracellular calcium; the rise in [Ca2+]i displayed an initial
peak response, followed by a rapid decline (Study IV, Fig. 3).
Fasted animals had been deprived of food overnight (16 h) before the
isolation of enterocytes. This period of fasting inhibits the duodenal HCO3
secretory response to exogenous OXA in rats in vivo (Ehrstrom et al. 2005a).
Initially, we tested the same concentrations of peptide and durations of exposure
as were used in experiments with enterocytes from fed animals. The absence of
significant effects (not shown) made it of interest to use a protocol with longer
durations of exposure to OXA. Only one concentration of OXA was superfused in
each experiment, and the time of exposure to the peptide was extended to 600 s.
The concentrations used were 1 nM (52 cells in clusters from 3 rats), 10 nM (139
cells in clusters from 4 rats), or 100 nM (132 cells in clusters from 4 rats). No
significant responses to OXA were observed (Figure 11). Furthermore, the
cholinergic agonist carbachol (100 µM) was added to the perfusate at the end of
experiments as a test of the viability of the enterocytes. Carbachol induced
intracellular calcium signaling (Study IV, Fig. 4) in a majority of enterocytes from
fasted rats also.
97
Fig. 11. At all concentrations tested (1–100 nM), 180 s of exposure to OXA induced an
intracellular calcium signaling in duodenal enterocytes acutely isolated from
continuously fed animals. Despite a longer time of exposure (600 s), the same
concentrations did not elicit a response in cells isolated from fasted animals. The
proportion of caged cells that responded with increased intracellular calcium
2+ i
concentration ([Ca ] ) to OXA stimulation. Responding controls are cells showing
2+ i
spontaneous changes in [Ca ] . Ratio of proportions and 95% confidence interval (CI)
are shown. Dashed line represents ratio of 1. **p < 0.01; ***p < 0.001. IV, published by
permission of Am J Physiol Gastrointest Liver Physiol.
Effects of enteric nervous system on OXA induced calcium signaling
The present findings strongly suggest that OXA exerts its action directly on the
enterocyte membrane receptor. However, it is possible that enterocyte responses
to OXA reflect an action primarily at acetylcholine-releasing enteric neurons. In
the present study, only preparations microscopically devoid of enteric neurons
were used. Enteric neurons are markedly stained by fura 2-AM and would thus
have been easily detectable. Furthermore, pretreatment of cell preparations (fed
animals) with the muscarinergic antagonist atropine (1 µM) did not affect basal
[Ca2+]i nor the proportion of cells responding to 1 or 10 nM OXA (213 cells in
98
clusters from 5 rats, not shown). Neither did atropine affect the shape or
magnitude of the orexin-induced [Ca2+]i responses (data not shown).
Enterocytes from human biopsies
The patients undergoing endoscopy took no food in the morning before the
procedure. This is not directly comparable to overnight fasting, but we used the
same protocol for enterocytes from human biopsies as for those from fasted rats.
OXA was added to clusters of human enterocytes (81 cells, 1 biopsy sample from
each of 3 patients) for an extended period of time (600 s) and in separate
experiments for each concentration. The results from experiments with a lower
concentration of OXA (10 nM) were inconclusive, but at a higher concentration
(100 nM) the peptide induced intracellular calcium signaling in ~11% of the
human enterocytes (p < 0.05). The pattern of the increase in [Ca2+]i was similar to
that observed in rat enterocytes, but in general, the magnitude of the response was
smaller (Study IV, Fig. 5).
Orexin receptor antagonist and agonist
Our in vivo data provided evidence that the SB-334867 at higher doses may act as
a partial agonist. Thus, we performed experiments in which SB-334867 alone (1,
10, and 100 nM) was added to the perfusate (503 cells in clusters from 6 rats),
using the same protocol as for OXA. None of the tested concentrations of SB334867 induced an increase in [Ca2+]i. In further experiments, we used the high
concentration of 1,000 nM of SB-334867 (128 cells in clusters from 5 animals).
In contrast to the lower doses, this high concentration induced a robust increase in
the intracellular calcium level in ~24% of the enterocytes (p < 0.001) (Study IV,
Fig. 6), with a calcium signaling pattern similar to that induced by OXA (not
shown). These findings suggest that, at higher concentrations, SB-334867 acts in
a partial agonistic fashion also in vitro.
The lower concentration of 10 nM of SB-334867 was therefore selected to
test whether the antagonist inhibits the [Ca2+]i response to OXA. The clusters
were preperfused with SB-334867 for 180 s and the antagonist was then present
in the perfusate throughout the experimental period. SB-334867 completely
abolished (p < 0.01) the [Ca2+]i response to OXA (1 and 10 nM, 180 s exposure,
530 cells in clusters from 6 rats) (Study IV, Fig. 7). In further experiments we
examined effects of (Ala11,D-Leu15)-orexin-B, an agonist that displays a 400-fold
99
selectivity for OX2R over OX1R as evaluated from [Ca2+]i responses in the CHOK1 cell line (Asahi et al. 2003). The agonist was added to the perfusate according
to the same protocol as was used for OXA (1, 10, and 100 nM, 714 cells from 7
rats). None of the tested concentrations induced intracellular calcium signaling
(Study IV, Fig. 8).
5.2.3 Quantitative real-time PCR and Western blotting analysis of
orexin receptors
mRNA expression of OX1R and OX2R and protein expression of OX1R in
rat duodenal samples
mRNA expressions of OX1R, as well as OX2R, were significantly downregulated
in fasted animals compared with fed animals (Study IV, Fig. 7; p = 0.00234,
p = 0.00159 respectively). The mRNA levels of OX1R and OX2R in fasted
animals were reduced by 44.5% and 70.1%, respectively. Protein levels of OX1R
in the rat duodenal mucosa samples were determined by Western blotting and
compared between fed and fasted animals. OX1R was detected with an apparent
molecular mass of ~50-kDa, whereas β-actin was detected as a ~45-kDa peptide
(Figure 12). Quantification analysis revealed a significantly (p = 0.0233)
decreased amount of OX1R in fasted animals compared with fed animals (Figure
12). The protein level of OX1R in fasted animals was reduced by 49.3%
compared with that in fed animals (Figure 12).
100
Fig. 12. Western blot analysis of OX1R and β-actin in duodenal mucosa samples of fed
and fasted rats. (Left) OX1R was detected with a molecular mass of 50 kDa and β-actin
of 45 kDa. (Right) Quantification of OX1R Western blots (represents mean of 2
separate runs, n = 4). The protein expression levels of OX1R in fasted animals were
significantly (*p < 0.05) reduced compared with fed animals (means ± SEM). III,
published by permission of Am J Physiol Gastrointest Liver Physiol.
mRNA expression of orexin receptors in rat duodenal enterocytes
Expression of both receptors was significantly downregulated in cells from fasted
animals compared with those from fed animals (p = 0.0447, p = 0.0411,
respectively). The mRNA levels of OX1R and OX2R in fasted animals were
reduced by 54.5% and 60.4%, respectively (Figure 13).
Fig. 13. mRNA expression of the orexin receptors (A, OX1R; B, OX2R) normalized to
18s rRNA in duodenal enterocytes from rats and provided in relative amounts. The
expression levels of OX1R and OX2R in enterocytes from fasted animals were
significantly lower than those in fed animals (n = 5, means ± SEM; *p < 0.05). IV,
published by permission of Am J Physiol Gastrointest Liver Physiol.
101
102
6
Discussion
6.1
The generation and characterization of hPPO overexpressing
mice
Recent studies have evinced the orexin system as an important regulator of sleep
and wakefulness as well as energy homeostasis (Tsujino & Sakurai 2009,
Bonnavion & de Lecea). In the present study, transgenic mice overexpressing the
hPPO transgene under its endogenous promoter were generated, and their sleep–
wake patterns, as well as feeding and energy homeostasis related processes, were
characterized. The tg mice showed significant differences in the circadian
distribution of vigilance states in the light–dark transition periods. In addition, tg
mice showed small reductions in REM sleep during both the light and dark
periods. Moreover, our tg mice showed an increased metabolic heat production
and significantly elevated day time food intake at RT, when compared with their
wt littermates. In addition, after an acute cold exposure both genotypes showed a
similar amount of heat produced. However, tg mice exhibited decreased
locomotor activity compared with their wt littermates. The increased energy
expenditure in the tg mice did not result from a change in UCP1 expression in
BAT. Instead, we found an increase in UCP2 mRNA levels in WAT.
The tg mice were viable and fertile. The hPPO transgene was overexpressed
in the mRNA and protein level in the hypothalami of tg mice. The plasma
concentration of pooled OXA was also slightly elevated in tg animals compared
with wt mice. The transgene expression decreased OX2R mRNA expression in
the hypothalamus, but did not have any effect on OX1R or endogenous
OX1R/OX2R mRNA levels in the BF, cortex or hippocampus. In addition,
OX1Rs, but not OX2Rs, were found to be expressed in wt mice WAT.
6.1.1 The characterization of the sleep-wake patterns
In the baseline recordings, tg mice showed significant differences in the circadian
distribution of vigilance states in the light-dark transition periods when compared
with their wt littermates. After SD, tg mice had a similar amount of SWS recovery
as their wt littermates. However, the amount of REM sleep was decreased. When
recovery REM sleep was normalized to baseline within each individual animal
(spontaneous sleep during corresponding circadian time points), the reduction in
103
REM sleep could no longer be detected, indicating that the tg mice have a normal
REM sleep response to SD. In contrast to studies made on OX-KO mice or
orexin-overexpressing mice, we did not observe vigilance state fragmentation in
our tg mice (Mieda et al. 2004b, Mieda et al. 2006b).
Our results are in line with Mieda et al. who demonstrated that CAG/orexin
mice overexpressing rat PPO, under the control of a β-actin/cytomegalovirus
hybrid promoter, show a significantly suppressed amount of REM sleep during
the daytime (Mieda et al. 2004b, Mieda et al. 2006b). In addition, microinjections
into the right or left lateral ventricle of the brain or 1 h perfusion of OXA into the
histaminergic TMN resulted in decreased REM sleep and SWS during the light
period in rodents (Piper et al. 2000, Huang et al. 2001). In contrast, OX-KO mice
and orexin/ataxin-3 mice with an ablation of orexin-producing neurons, show
increased amounts of REM sleep during the dark period (Chemelli et al. 1999,
Hara et al. 2001). It has been demonstrated, that the expression of ataxin-3 also
eliminates other coexpressed neurotransmitters in the orexin neurons (Chou et al.
2001, Reti et al. 2002, Nilaweera et al. 2003, Kantor et al. 2009). Thus, the
results from orexin/ataxin-3 mice might not reflect completely the functions of
only orexins. A study from Mochizuki et al. demonstrated that OX-KO mice have
normal amounts of wake, NREM and REM sleep (Mochizuki et al. 2004). The
authors speculated that the observation of increased REM sleep in OX-KO mice
presented in other studies might have appeared because cataplexy was not
separated from REM (Chemelli et al. 1999, Willie et al. 2003, Mochizuki et al.
2004). Recently, it was also shown that orexin/ataxin-3 mice kept in constant
darkness had a reduction in REM sleep rhythmicity when compared with wt or
OX-KO mice (Kantor et al. 2009). Thus, it was proposed that orexin neurons, but
not just orexins themselves, are necessary for the circadian control of REM sleep.
Our hPPO tg mice spent less time awake and more time in SWS during the
early hours of the dark period, whereas during the late hours of the dark period
they spent more time awake and less time in SWS. Sleep and wakefulness are
under both homeostatic and circadian control. Orexin levels show day-night
fluctuations, with high levels during the dark period (night time) when mice are
more active (Taheri et al. 2000, Yoshida et al. 2001, Martinez et al. 2002). In
mammals, the primary circadian clock located in SCN, controls the circadian
rhythm and is important for circadian rhythmicity in the orexin system (Deboer et
al. 2004, Klisch et al. 2009). In the present study, overexpression of orexins
affected the circadian distribution of vigilance states. On the other hand, in
constant darkness both OX-KO and orexin/ataxin-3 mice show normal circadian
104
rhythms of wake and NREM sleep (Kantor et al. 2009). As mentioned before,
orexin/ataxin-3 mice had less circadian variation in REM sleep than their wt
littermates or OX-KO mice. In addition, both OX-KO and orexin/ataxin-3 mice
show normal circadian rhythms of body temperature, locomotor activity and
wakefulness, indicating that their circadian clocks and clock effector mechanisms
are functioning normally. However, a recent study has demonstrated that in vitro
applied OXA itself is able to alter neuronal activity of the rat SCN (Klisch et al.
2009). Thus, the orexinergic system might have direct influences on the circadian
system.
SD was performed to investigate sleep homeostasis, a process by which
prolonged waking increases the intensity (measured by EEG delta power 1–4 Hz)
and/or duration of the consequent SWS. No differences in the amount of SWS or
latency to SWS (studied with MMSLT) after SD were found between genotypes.
However, during the first 2 h of recovery sleep, tg mice had a statistically
significant reduction in their SWS delta (between 1 and 2 Hz) response, when
compared with their wt littermates, indicating a reduced SWS intensity/sleep
pressure during recovery sleep. The tg mice had more slow wave intrusions in the
waking EEG during SD. It has been shown that intrusions of slow delta waves in
waking EEG during SD might reflect increased sleep pressure/sleepiness
(Cajochen et al. 2002). Thus the tg mice might have been sleepier (e.g. latency to
sleep after SD) than their wt littermates. However, the mechanism for how tg
mice were able to release some of their sleep pressure already during SD is not
known.
In conclusion, the hPPO-overexpressing mice show a slight, but statistically
significant reduction in REM sleep both during the day and the night, as well as
changes between vigilance states in the light/dark transition periods. Thus, our
results confirm the role of orexins in the maintenance and stabilization of sleep
and wakefulness, as well as inhibition of REM sleep. In addition, orexins might
have influences on the circadian system.
6.1.2 Effects of orexin overexpression on energy homeostasis
Orexins affect energy homeostasis in several different ways, like increasing food
intake and affecting activity, as well as changing the metabolic rate (Lubkin &
Stricker-Krongrad 1998, Sakurai et al. 1998, Chemelli et al. 1999, Haynes et al.
1999, Yamanaka et al. 1999). In the present study, the mice overexpressing hPPO
showed increased metabolic heat production and significantly elevated day time
105
food intake at RT. An acute cold exposure balanced the effects of non-shivering
thermogenesis between genotypes and tg mice had a significantly greater decrease
in their locomotor activity in response to cold compared with wt mice.
Previous reports investigating the effects of orexins using either short or long
term exogenous orexin administration revealed conflicting results. Initially, both
OXA and OXB were shown to promote acute feeding after i.c.v. injections
(Sakurai et al. 1998). Chronic i.c.v. administration of OXA increased daytime
food intake with no or only a little increase in body weight in rats (Yamanaka et
al. 1999). In another study, i.c.v. infusions of OXA resulted in increased daytime
food intake and decreased nocturnal feeding with no effect on weight in rats
(Haynes et al. 1999). Daily intraparaventricular administration of OXA in rats
resulted in significant weight loss (Novak & Levine 2009). However, no
difference was observed in total food intake. In the present study, we did not find
any significant difference in the total amount of 24 h food intake between tg and
wt mice. However, after a subanalysis of our data, we found that orexin tg mice
ate significantly more during daytime when compared with their wt littermates. It
could be speculated whether the shorter times spent awake for tg mice correlated
to increased day time feeding. Our results are, at least partly, consistent with the
findings by Yamanaka et al., who earlier described the effect of chronic i.c.v.
administration of OXA affecting increasingly only daytime feeding (Yamanaka et
al. 1999). Therefore, our results show that long term overexpression of orexins
affects the circadian food intake pattern without an effect on total food
consumption.
Despite the lack of difference in total food intake, our tg mice tended to gain
less weight than the wt mice during the first 5 and half months since birth.
However, the differences were not significant at any time point. In addition, the tg
mice showed an increased heat production (i.e. metabolic rate). Furthermore,
when acutely exposed to cold, our tg mice showed a significantly decreased
locomotor activity compared with wt mice, suggesting that tg mice do not need
additional physical activity when exposed to a cold environment.
Our results are in accordance with the findings from OX-KO mice, which eat
less than their wt littermates and gain slightly more weight, indicating a reduced
metabolic rate (Chemelli et al. 1999, Willie et al. 2003). In addition,
orexin/ataxin-3 mice, with expression of a toxic protein that ablates the orexin
producing neurons, show hypophagia and even obesity (Hara et al. 2001). In
contrast, rat PPO overexpressing CAG/orexin mice on a low fat diet show no
difference in food intake (Funato et al. 2009). However, the same mice on a high
106
fat diet show significantly reduced food intake and increased energy expenditure.
It should be noted that these mice fed on the low fat diet show no difference in
heat production when compared with wt mice. Possible differences in the diet
compositions might explain the differences in the heat productions observed
between Funato´s and our tg mice. Previously it was reported that injection of
OXA increased the metabolic rate in mice (Lubkin & Stricker-Krongrad 1998).
Narcoleptic patients with low or undetectable levels of orexin might have
decreased metabolic rate (Hara et al. 2001, Kok et al. 2003). In addition, the
metabolic rate of the OX-KO mice has been shown to fluctuate diurnally with a
decreased rate upon awakening. Recent studies made with CAG/orexin and
OX1R deficient/orexin overexpressing mice (OX1R-/-;CAG/orexin) on a high fat
diet demonstrated an increased energy expenditure, indicating a role of central
orexin-OX2R signaling in protection from high fat diet induced obesity (Funato et
al. 2009). The respiratory quotient of our tg mice was investigated to find out
whether lipids or carbohydrates are metabolized. No differences, however, were
observed in usage of different substrates between tg or wt mice (data not shown).
It has been shown earlier that chronic i.c.v. administration of OXA has no
effect on plasma cholesterol and free fatty acid levels in rats (Yamanaka et al.
1999). In line with those findings, our tg mice also display normal serum
cholesterol and triglycerides.
Switonska et al. showed that daily subcutaneous injections of orexins for one
week significantly elevated leptin plasma levels in rats (Switonska et al. 2002). In
contrast, Funato et al. reported decreased serum leptin levels in male CAG/orexin
mice, with a significant reduction of fat mass after a low fat diet (Funato et al.
2009). We did not find any significant differences in plasma leptin or ghrelin
concentrations between tg and their wt littermates.
Previously, it was demonstrated that s.c. injection of OXA caused an increase
in both blood insulin and glucose levels in rats (Nowak et al. 2000). Later, it was
also shown that daily administration of orexins for one week significantly
elevated blood insulin in female rats, while Ehrström and colleaques did not
observe any changes in insulin levels after OXA injection into the jugular vein in
18 h fasted male rats (Switonska et al. 2002, Ehrstrom et al. 2004). Instead,
intravenously added OXA significantly decreased plasma insulin levels in fasted
rats and elevated plasma glucose concentration (Ouedraogo et al. 2003). In our tg
mice, no significant difference was observed in glucose or insulin levels during
GTT when compared with wt littermates. CAG/orexin mice on a low fat diet
107
showed no differences in GTT, while being on a high fat diet demonstrated
lowered blood glucose levels after GTT (Funato et al. 2009).
The circadian body temperature cycle is a biological event, which is affected
by food intake, locomotor activity and different enzyme and hormones. These
phenomena are regulated by the suprachiasmatic nucleus, which receives
projections from orexin neurons in LHA (Date et al. 1999). Mochizuki, and co
workers demonstrated that OX-KO mice did not decrease their core body
temperature during sleep at the same level than wt mice did (Mochizuki et al.
2006). This was probably due to deficient activation of heat loss mechanisms or
sustained thermogenic activity. The same mice show a reduced activity during
night time (Chemelli et al. 1999). On the other hand, CAG/orexin mice on a high
fat diet tended to have a higher core body temperature. However, these mice did
not exhibit hyperactivity. In this study, no difference was observed in core body
temperature, nor in total activity between tg and wt mice placed in RT. However,
during acute cold exposure, tg mice showed a trend towards decreased total
activity compared with wt mice. During the night time, that is when the mice are
normally active, tg mice showed significantly increased amounts of activity
counts compared with wt mice. In general, mice respond to acute cold mostly by
shivering and increasing physical activity, while the role of brown fat-derived
UCP1 dependent thermogenesis grows gradually during the next three to four
weeks (Cannon & Nedergaard 2004). Thus, our results are in line with those
observed in CAG/orexin mice, suggesting that the leaner phenotype of orexin tg
mice is due to an increased metabolic rate rather than increased core body
temperature or total activity (Funato et al. 2009). No difference was observed in
plasma T3 levels between genotypes (data not shown).
It should be noted that both wt and tg mice significantly decreased their total
activity in response to acute cold exposure when compared with mice in RT.
During cold exposure, shivering occurs as the predominant muscle function over
physical activity in the very beginning (Cannon & Nedergaard 2004). Thus, the
mice move only when they need to eat or to generate extra heat by physical
activity.
To determine whether mitochondrial uncoupling proteins were responsible
for increased heat production in tg mice, the mRNA expression of UCPs 1–3 were
analyzed in tissues important for energy metabolism (Enerback et al. 1997).
CAG/orexin mice showed increased energy expenditure with elevated UCP1
mRNA levels in BAT under a high fat diet, but not under a low fat diet (Funato et
al. 2009). Importantly, wt mice fed on a high fat diet increased their BAT UCP1
108
levels in the same manner as the tg mice. Thus, the increase in BAT UCP1 is most
probably due to dietary factors. In contrast to the results from CAG/orexin mice
fed on a high diet, we did not find a difference in BAT UCP1 mRNA expression
levels between our hPPO tg and wt animals fed on normal diet. Yet, we found a
difference in the heat production. UCP1 is the main effector of a cold- and dietinduced non-shivering thermogenesis both in rodents and possible also in humans
(Cannon & Nedergaard 2004, Cypess et al. 2009, Zingaretti et al. 2009). Previous
studies have demonstrated that the effects of OXA on core body temperature
might be independent of UCP1 (Yoshimichi et al. 2001, Russell et al. 2002). On
the other hand, OX-KO mice show a stress induced increase in BAT UCP1 levels
and hyperthermia (Zhang et al. 2010). However, our hPPO tg mice do not exhibit
any anxiety like behaviour (unpublished data).
The roles of other UCPs on energy metabolism are less clear (Cannon &
Nedergaard 2004). Interestingly, in the present study, an overexpression of
orexins in the tg mice housed in RT resulted in significantly increased UCP2
mRNA levels in WAT. It should be noticed that UCP2 expression was not
analysed at the protein level. Pecqueur et al. have demonstrated earlier that the
UCP2 protein level does not necessarily correspond to the UCP2 mRNA
expression level (Pecqueur et al. 2001). In line with our results, a 7 day
administration of ghrelin, an orexigenic peptide linked to orexins in mice,
decreased and increased UCP1 in BAT and UCP2 in WAT, respectively (Toshinai
et al. 2003, Tsubone et al. 2005). Even though the authors speculated that ghrelin
can regulate body weight, adiposity and UCPs mRNA expression in mice, the
participation of WAT UCP2 was not discussed (Tsubone et al. 2005). Tg mice
overexpressing UCP2 in orexin neurons (Hcrt-UCP2) had an elevated
hypothalamic temperature resulting in a reduced core body temperature (Conti et
al. 2006). In addition, mice overexpressing UCP2 are leaner than their wt
littermates (Horvath et al. 2003). Furthermore, overexpression of UCP2 in
atherosclerotic plaques and mammalian macrophages results in increased heat
production (van De Parre et al. 2008). Several studies have implicated a role for
UCP2 in resting metabolic rate, fat metabolism and obesity in humans (Bouchard
et al. 1997, Walder et al. 1998, Jia et al. 2009, Salopuro et al. 2009, Srivastava et
al. 2010). Even though the amount of mitochondria in WAT is relatively low
compared with BAT, recent studies have demonstrated that WAT mitochondria
might have a role in obesity related genes (Semple et al. 2004, Dahlman et al.
2006). Digby et al. demonstrated the expression of OX1R and OX2R mRNA in
s.c. and omental adipose tissue and in isolated adipocytes in humans (Digby et al.
109
2006). OXA increased peroxisome-proliferator-activated receptor (PPAR) gamma
expression. Similarly, our experiments show that OX1R is expressed in mRNA
and protein level in wt mice WAT. UCP2 gene expression is under the control of
PPARs in WAT (Aubert et al. 1997, Kelly et al. 1998, Digby et al. 2000). In our
experiments, PPAR delta and PPAR gamma mRNA levels were significantly
upregulated in tg mice WAT. We did not see any difference in the WAT UCP2
mRNA levels in mice acutely exposured to cold when compared with wt mice. It
could be speculated whether wt mice have increased their WAT UCP2 levels in
response to cold. It has been shown earlier that UCP2 mRNA levels in WAT are
increased in mice in response to cold (+4ºC for 24 h) (Masaki et al. 2000).
Therefore, a short cold exposure might have affected WAT UCP2 mRNA levels
also in our mice.
In conclusion, the mice overexpressing hPPO demonstrate that orexins affect
energy metabolism by increasing metabolic heat production. In addition, due to
the increased thermogenesis during the acute cold exposure, tg mice might not
need extra physical activity to compensate for the heat loss. The increased energy
loss is compensated by increased daytime food consumption.
6.2
Effects of overnight fasting on OXA induced duodenal
bicarbonate secretion
Our results demonstrate that OX1R and OX2R mRNA, as well as OX1R protein,
are expressed in the rat duodenal mucosa. OXA induced duodenal HCO3
secretion was inhibited by the pretreatment of the OX1R antagonist, SB-334867.
In freshly isolated rat duodenal enterocytes, SB-334867 inhibited the [Ca2+]i
response to OXA, while the OX2R agonist, (Ala11,D-Leu15)-orexin-B, did not
induce calcium signaling. Short (overnight) food deprivation for 16 h decreased
significantly rat mucosal and enterocyte OX1R, as well as OX2R expression.
Moreover, fasting abolished the secretory response to OXA, as well as the
induction of calcium signaling. These findings provide strong evidence that
OXA-induced duodenal HCO3 secretion is mediated mainly via OX1R. In
addition, the expression of duodenal orexin receptors and secretory responses are
markedly related to food intake.
In the present study, OXA and SB-334867 were administered into the
duodenum by a close intra-arterial infusion, which allows the use of very small
amounts of compound, minimizing the effect of the CNS. The possible sites of
action for intra-arterially infused compounds are enterocyte basolateral receptors,
110
enteroendocrine cell receptors and/or receptors in the enteric nervous system
(ENS) (Flemstrom et al. 2010). An i.c.v. injection of OXA (1.0 nmol), via
activation of vagal efferents, resulted in increased pancreatic exocrine secretion in
conscious rats (Miyasaka et al. 2002). In addition, an intracisternal injection of
OXA (0.2–2.7 nmol) causes a dose-dependent increase in gastric acid secretion in
conscious rats (Takahashi et al. 1999, Okumura et al. 2001). In contrast,
peripherally (i.v. and i.p) administrated OXA had no effect on pancreatic or
gastric secretion (Takahashi et al. 1999, Miyasaka et al. 2002). In our study,
however, the close intra-arterial infusion of OXA caused a stimulation of
duodenal HCO3 secretion, while i.c.v. infusion of the peptide had no significant
effect. Moreover, luminal administration of OXA did not affect duodenal HCO3
secretion, indicating that OXA acts at basolateral receptors. Our results provide
the evidence that effects of OXA on duodenal HCO3 secretion may reflect the
peripheral actions of orexins.
In the current study, we show the presence of both orexin receptors on the
mRNA level and OX1R on the protein level in the rat duodenal mucosa. In
addition, OX1R and OX2R mRNA are expressed in the rat duodenal enterocytes.
OX1R mRNA is expressed in epithelial cells, while OX2R mRNA can be found
in the nonepithelial fraction of rat jejunal mucosa (Ducroc et al. 2007). PPO,
OX1R and/or OX2R mRNA, as well as OXA and/or both receptors on the protein
level, are found in submucosal and myenteric plexa and in interconnecting
neurons (Kirchgessner & Liu 1999, Naslund et al. 2002, Nakabayashi et al. 2003,
Ehrstrom et al. 2005a). Matsuo et al. demonstrated that the cholinergic system is
involved in the OXA induced contraction of guinea-pig ileum (Matsuo et al.
2002). Many of the central actions of orexins are mediated by cholinergic
mechanisms (Tsujino & Sakurai 2009). Overnight fasting induced an 100-fold
decrease in sensitivity to the muscarinic agonist bethanechol (Flemstrom et al.
2003). In many species, duodenal HCO3 secretion is mediated through
muscarinic dependent processes (Jonson et al. 1986, Nylander et al. 1987,
Ballesteros et al. 1991, Glad et al. 1997). In our study, the muscarinic antagonist
atropine abolished the bethanechol induced stimulation of duodenal secretion.
Atropine did not affect the secretory response to OXA. Neither did SB-334867
have an effect on secretion induced by the bethanechol. OXA induced
intracellular calcium signaling in clusters of enterocytes, and the pretreatment
with atropine, did not inhibit this response. Microscopical analysis of enterocytes
confirmed that no enteric neurons were detectable during experiments. In
conclusion, our findings strongly indicate that OXA acts directly on intestinal
111
enterocytes through OX1R. A lower proportion of enterocytes in clusters
responded to OXA, when compared with similar responses seen with melatonin
or carbachol (~40%). The reason might be that feeding induces an expression of
orexin receptors only in a limited number of the enterocytes. In addition, the
location, maturation and development of enterocytes might also influence the
expression.
Experimental studies of gastrointestinal physiology and pathophysiology in
humans and animals have been generally performed after an overnight fast
(Flemstrom et al. 2010). This is an old tradition originating from Pavlov´s
laboratory. Fasting results either in upregulation or downregulation of orexins and
its receptors. Hypothalamic PPO mRNA levels are increased after 48 h fast in rats
(Sakurai et al. 1998, Cai et al. 1999) Similarly, OX1R mRNA levels in the VMH
and the medial division of amygdala, as well as OX2R mRNA levels in the ARC
increased after a 20 h fast in rats (Lu et al. 2000b). Interestingly, a 24 h fasting
period leads to downregulation of the OX1R and OX2R mRNA levels in the rat
adrenal cortex, while in the hypothalamus the levels are naturally upregulated
(Karteris et al. 2005). Our results demonstrated that an overnight fast for 16 h
decreases OX1R and OX2R mRNA expression, as well as OX1R protein
expression on rat duodenal mucosa. Fasting abolishes duodenal HCO3 secretory
response to OXA occurring in fed rats. In addition, OXA induced intracellular
calcium signaling in freshly isolated duodenal enterocytes from fed rats, while no
significant response was observed in cells obtained from fasted rats. A similar
pattern of [Ca2+]i rise was observed also in human enterocytes treated with a high
concentration of OXA (100 nM), although with a smaller magnitude of response.
However, the patients were advised not to eat in the morning before the
endoscopy. Thus, the restriction of food intake was not directly comparable to that
of short overnight fasting. In addition, humans show a lower metabolic rate and
remarkable differences also in rates of intestinal fluid and water transport
(Pappenheimer 1998). Food deprivation for 16 h downregulates the orexin
receptors expression on the mRNA level in rat freshly isolated duodenal
enterocytes. Treatment with carbachol, a cholinergic agonist, induced [Ca2+]i
response also in enterocytes from starved rats that did not respond to OXA,
indicating that short fasting does not induce a general decline in receptors
expression. Short overnight fasting does not affect duodenal secretory responses
to close intra-arterially infused VIP, melatonin, 5-HT, uroguanylin or PGE2
(Flemstrom et al. 2003, Safsten et al. 2006, Bengtsson et al. 2007, Flemstrom et
112
al. 2010). Our results show that studies made on intestinal secretion or effects of
drug therapy require particular evaluation with respect to the feeding status.
The mechanisms by which feeding modulates the intestinal responses to OXA
are still unclear. One explanation could be that nutrients have a stimulatory action
on orexin receptors’ expression. The intestinal mucosa is equipped with different
types of detectors, such as neurons and endocrine cells, and it is in contact with
different intestinal contents (Furness et al. 1999). Again, it can detect and respond
to changes in luminal content. Orexins are present both in enterochromaffin cells
and in nerve endings of enteric neurons (Kirchgessner & Liu 1999, Naslund et al.
2002). Thus, a paracrine/endocrine orexin-mediated response may lead to
upregulation of orexin receptors in response to food. Recently, Bengtsson et al.
demonstrated that glucose (liquid nutrient, 8.5 kJ/ml), but not other nutrients,
introduced to the GI-tract via a gavage, prepared the duodenum for OXA-induced
HCO3 response in overnight fasted rats (Bengtsson 2008).
OXA induced intracellular calcium signaling at all tested doses in acutely
isolated duodenal enterocytes isolated from fed rats. The rise in [Ca2+]i was slow
and no clear initial peak response was observed. In addition, a sustained plateau
was observed even after the removal of OXA. This signaling pattern is
comparable to that induced by 5-HT in acutely isolated enterocytes and to that
produced by OXA in LTD and DR neurons (Kohlmeier et al. 2004, Safsten et al.
2006). OXA increased [Ca2+]i also in rat duodenal enterocytes in the absence of
extracellular calcium. OXA is likely to increase the enterocyte [Ca2+]i by release
of calcium from the endoplasmic reticulum as well as by an influx of extracellular
calcium via store-operated calcium channels (Lund et al. 2000, Kukkonen &
Akerman 2001, Larsson et al. 2005).
In conclusion, our study demonstrates that OXA stimulates duodenal mucosal
HCO3 secretion via basolateral OX1Rs. In addition, OXA induces intracellular
calcium signaling in acutely isolated rat and human duodenal enterocytes.
Moreover, a short overnight food deprivation decreased orexin receptors
expression and abolished the secretory response to OXA, as well as the induction
of intracellular calcium signaling.
113
6.3
Methodological considerations
6.3.1 hPPO overexpressing mice
The generation of transgenic mice
The present study was designed to use different experimental and methodological
approaches, in order to answer the aims set out at the start of this thesis.
The generation of genetically engineered mice, with either overexpressing or
a knocking out of the desired gene/genes, is a common technique for determining
gene functions and the interrelationship between proteins in vivo. The major
advantages of the overexpression mice models are that high levels of target gene
expression can usually be achieved, and the animals often demonstrate a positive
phenotype. However, integration of the transgene into the genome can affect
viability, fertility, tissue specificity and levels of transgene expression. (Williams
& Wagner 2000) Our hPPO overexpressing mice were viable and fertile. In
addition, the transgene was harbored only in one place of the genome. The
overexpression of the gene was observed only in tissues known for their positivity
for orexins expression. The random integration process can lead to inappropriate
insertion of the transgene into the genome. Due to the disruption of some
endogenous gene, different biochemical routes and physiological systems might
be affected. Thus we cannot fully exclude the possibility of the inappropriate
insertion of the hPPO transgene in our mice.
In the present study, the hPPO transgene expression did not have any effect
on mouse endogenous PPO levels in tg mice. Thus, it could be questioned
whether the orexin co-expressed peptides or proteins are not affected by the hPPO
overexpression. Our unpublished data, however, shows that the effect of hPPO
overexpression also affected the orexin co-expressed peptides such as POMC and
GHRH (data not shown).
It could be speculated that some of the current findings observed in our study
are due to the overexpression of orexins, i.e. not from a normal actions of orexins.
However, most of our findings were strongly supported by further studies made
by other groups. Thus, in general, our findings seem to reflect the normal
physiological functions of orexins.
114
Measurement of OXA using RIA
Heinonen et al. demonstrated recently that significant differences may occur
between the results obtained from different laboratories in regard to
immunoreactive OXA levels measured with RIA (Heinonen et al. 2008). However,
the obtained results still show the relative differences between experimental
groups. In our experiments, this was of importance in showing the differences of
OXA plasma concentrations between wt and tg mice, and confirming the
overexpression of orexins in our tg mice.
Effects of genetic background
The genetic background of the wt and tg mice used in this study was CD2 (a
hybrid of a Balb/c × DBA/2). It has been shown, that EEG patterns show a high
degree of heritability, and distinct differences in SWS delta exist between
Balb/c × DBA/2 strains (Franken et al. 1998). In addition, BALB/c mice show a
weak diurnal rhythm (Valatx & Bugat 1974). Therefore, we cannot exclude the
possibility that the observed differences in circadian distribution of vigilance
states and in EEG power found in the present study are partly due to the mixed
genetic background the strain (Valatx & Bugat 1974, Franken et al. 2001).
Both Balb/c and DBA2 strains show a relative resistance to high fat dietinduced glucose intolerance and obesity (Fearnside et al. 2008). In addition, even
when fed with a control diet, these two strains gain significantly less weight than,
for example, C57BL/6 mice. C57BL/6 mice overexpressing rat PPO under βactin/cytomegalovirus hybrid promoter (CAG/orexin) show increased heat
production only when fed on a high fat diet (Funato et al. 2009). Thus, it is
possible that the CD2 background itself may somehow facilitate the actions of
orexin overexpression on heat production in our hPPO tg mice.
Vigilance state scoring
In the present study, both wt and tg mice showed a high number of brief
awakenings per hour. The numbers for wt mice were 22 ± 4 (lights on) and 13 ± 1
(lights off), and for the tg mice, these were 27 ± 2 (lights on) and 16 ± 2 (lights
off). Studies using longer epochs, such as 10 s, show a generally lower number of
brief awakenings or wake bouts (Diniz Behn et al. 2008). In our study, the
vigilance states were scored by 2 s epochs, and brief awakenings were counted as
115
waking episodes from SWS between 2 and 12 s. In addion, the brief awakenings
were scored only if both muscle activation and a clear EEG arousal
(desynchronization/amplitude decrease) were detected together. When including
short lasting arousals also, the number of brief awakenings is higher than in some
published reports where only longer arousals have been counted (Diniz Behn et al.
2008). However, literature and strain differences can greatly affect the number of
brief awakenings (Huber et al. 2000). Thus, our results are in accordance with
other similarly performed studies.
LabMaster measurements
The analyses of feeding, drinking, locomotor activity and calorimetry were
performed using an automated monitoring system, LabMaster, allowing us to
measure 8 mice simultaneously when the experiments were done at RT. Only agematched 3 months ± 1 week old male mice were used in this study. Before each
individual experiment the mice were housed in similar cages to that of
experimental conditions for one week. When mice cages were put in a climate
chamber for the cold exposure studies, we were able to measure 3 mice at once.
Thus the measurement of 15 mice occurred within 1.5 months. However, the
groups were age-matched in order to have all mice 3.5 months ± 1.5 week old at
the time of experiments. The environmental factors, which were temperature,
humidity and day/night light cycle, were continuously controlled. Thus, it is
unlikely that the relatively long time gap between the experiments affected the
results. In addition, the genotypes were randomly chosen by drawn lots in every
run. Furthermore, only persons familiar to the mice were allowed to perform the
analysis, thus minimizing any stress.
6.3.2 In situ and in vitro experiments studying the effects of orexins
on duodenal HCO3 secretion
Drugs used
The OX1R antagonist SB-334867 shows up to a 50-fold higher sensitivity for
OX1R over OX2R in vitro (Smart et al. 2001). The usage of the antagonist is
extensive, and it can be considered as a valuable tool for studying the effects of
OXA (Bingham et al. 2006, Heinonen et al. 2008). In our studies, a partial agonist
116
action of SB-334867 was observed in both in vivo and in vitro experiments. Thus,
only low doses of the antagonist were used in the present study to test whether
SB-334867 inhibits the HCO3 secretion response in rat duodenum or [Ca2+]i
response in the duodenal enterocyte clusters to OXA.
Results from CHO cells show that OX1R has a 10 times higher affinity for
OXA than for OXB, whereas OX2R has an equal affinity for both peptides
(Sakurai et al. 1998). In the present study, we could not totally exclude the
possibility that OX2Rs might also have a role in mediating the action of OXA on
small intestinal secretion. During the time of the experiments, no commercial
selective OX2R antagonist was present. However, in our in vitro study we used a
highly selective OXB agonist, (Ala11,D-Leu15)-orexin-B, which has a 400-fold
selectivity for OX2R over OX1R, as observed from [Ca2+]i responses in the CHOK1 cells (Asahi et al. 2003). The agonist was added to the perfusate using the
same concentrations as was used for OXA, and it did not affect [Ca2+]i. This
provides further evidence that the orexin-induced [Ca2+]i response is mediated
through OX1Rs.
Close intra-arterial infusion
In the present study, we used a close intra-arterial infusion for the infusion of
OXA and SB-334967. This technique allows the use of very small amounts of
compound, thereby minimizing the effect of the CNS. In our study, the intraarterially administered OXA caused a stimulation of duodenal bicarbonate
secretion, while the i.c.v. injection of OXA was without a significant effect. We
observed a slight increase in HCO3 secretion after an i.c.v. infusion of OXA.
However, that was similar to those seen in rats treated with vehicle. Thus, our
results show strong evidence that OXA acts peripherally on small intestinal
secretion.
Animal preparation
In the present study, the close intra-arterial infusion of OXA stimulated duodenal
HCO3 secretion in the fed rats, while i.c.v. infusion was without a significant
effect. The absence of a secretory response to central OXA could reflect an
operation induced damage of vagal nerves. When penetrating the diaphragm, the
abdominal vagal trunks separate into three branches, namely the paired gastric
and celiac branches and the unpaired branch (Berthoud et al. 1991). The
117
duodenum receives fibers from the branches, and axons from the gastric branches
go through the pyloric sphincter to the duodenum (Zhang et al. 2000). In our
experimental setup (Study III, Fig. 1), the duodenum was never cut. The hepatic
branch, entering the duodenum via the perivascular plexuses of the hepatic,
gastroduodenal, and superior pancreaticoduodenal arteries, innervates the
duodenum. In the present study, the stimulatory action of i.c.v. administered TRH
was confirmed. The present type of in situ chamber preparation have been used in
studies demonstrating that i.c.v. administration of the TRH or the catecholamine
phenylephrine induces vagally mediated stimulation of duodenal alkaline
secretion (Flemstrom & Jedstedt 1989, Larson et al. 1996, Zhang et al. 2000,
Sjoblom et al. 2001). In addition, electrical stimulation of the cut cervical vagal
nerves, in the distal direction, stimulates HCO3 secretion in rat and cat duodenum
in situ (Jonson et al. 1986, Nylander et al. 1987). Thus, we have evidenced that
the cannulated duodenum has functional vagal innervations.
Animal control during experiments
During the present experiments, we monitored blood pressure, and analysed the
acid-base balance as well as the blood glucose concentration of the rats. No
differences were observed in the acid-base balances, and some groups showed
only a slight decline in the blood HCO3 concentrations. The mean arterial blood
pressures remained ≥90 mmHg in all rats. Thus, it can be concluded that our rats
were maintained in good condition for studying epithelial acid-base transport. In
most rats treated by intra-arterial OXA or SB-334867, a decrease was observed in
blood glucose concentration during the experiment. However, the decreases did
not differ significantly from those observed with control rats infused with vehicle
alone. Previous studies have shown that administration of OXA to specific brain
areas causes dose-dependent increases in the heart rate and mean arterial blood
pressure (Chen et al. 2000, de Oliveira et al. 2003, Zhang et al. 2005). Of note,
the regulation of cardiovascular functions seems to be age dependent (Hirota et al.
2003). In our study, rats aged only between 7- to 9-week-old were used. Thus, this
might have affected the observed absence of blood pressure effects. OXA is a
highly lipophilic peptide that easily passes brain tissue (Kastin & Akerstrom
1999). The manner of administration as well as the acid-base balance and general
condition of the animals may influence the response.
118
6.4
Future aspects
Orexins are multifunctional peptides that are involved in several physiological
functions including sleep/wake, energy homeostasis and intestinal secretion.
Right after the discovery of orexins and their receptors, the majority of the studies
concentrated on the central actions and regulation of the orexin system. However,
lately, an increasing number of studies have implicated the role of orexins also in
the periphery.
In the present study, the associations of orexins on sleep/wake regulation, as
well as in energy homeostasis were further investigated using a novel transgenic
mouse line overexpressing hPPO under its endogenous promoter (Figure 14). In
addition, we studied the effects of short overnight fasting on orexin receptors
expression, and in OXA induced HCO3 secretory response both in situ in the rat
duodenum and in vitro in acutely isolated duodenal enterocytes (Figure 14). The
hPPO tg mice showed a significant reduction in REM sleep, both during the day
and the night, and differences in vigilance state amounts in the light/dark
transition periods. These findings support the role of the orexin system in the
regulation of REM sleep and propose an important functioning role for them in
the regulation of the circadian system. Further studies are required to better
understand the mechanism for the ability of tg mice to release their sleep pressure
when awake during SD.
Tg mice, housed in RT, showed an increased metabolic heat production and
significantly elevated day time food intake. An acute cold exposure balanced the
effects of non-shivering heat production between the genotypes, and tg mice
decreased significantly their total locomotor activity due to a response to the cold.
Only UCP2 mRNA in WAT, but not UCP1 mRNA in BAT, was elevated in tg
mice. The reason for that is not clear, and further studies should be done to
understand the possible involvement of WAT UCP2 in regard to increased energy
metabolism. Due to the present accepted knowledge, only BAT UCP1 is a
mediator of cold induced thermogenesis. Thus, other possible mechanisms behind
the observed increase in heat production in the current study need to be
considered for study further.
119
Mechanisms to
overcome sleep
pressure during SD
Other factors
related to heat
production
Effects on sleep/wakefulness in
hPPO tg mice:
Effects on energy homeostasis
in hPPO tg mice:
REM sleep
Circadian distribution of vigilance
states
Day time food intake
Heat production
Role of UCP2 in
heat production
UCP2 mRNA expression
in WAT
Acute cold exposure
Total activity
Orexin system
Effects on duodenal secretion:
Short overnight food deprivation
OX1R expression
Abolition of OXA induced [Ca2+]I
signaling and HCO3- secretion
Role of
OX2R
Effects of nutrients
on receptor(s)
expression
Fig. 14. Mind map illustrating the major findings of the present thesis and consequent
ideas for future studies.
Our study demonstrated that stimulation of duodenal mucosal HCO3 secretion by
peripheral OXA is mediated via duodenal basolateral OX1Rs. In addition, OXA
induced a signaling of intracellular calcium in acutely isolated rat and human
duodenal enterocytes. Furthermore, a short overnight food deprivation decreased
orexin receptors expression and abolished the secretory response to OXA, as well
as induction of intracellular calcium signaling. Even though we provided very
strong evidence that the intestinal secretory action of OXA is mediated via
OX1Rs, we cannot exclude the possible role of OX2Rs also on this aspect. Thus,
studies using a selective OX2R antagonist should be conducted in the near future.
In addition, results from overnight food deprivation induced receptor
downregulation suggest that studying intestinal secretion and the effects of drug
therapy require particular evaluation with respect to feeding status.
In summary, the results from the present study further demonstrated that
orexins have an important role in both the regulation of sleep/wake functions and
energy homeostasis. In addition, we showed that the peripheral orexin system has
a significant role in duodenal mucosal HCO3 secretion. Since orexins have wide120
ranging influences on a great variety a physiological processes, the possibilities of
the therapeutical use of orexins and their agonists or antagonists have been
intensively studied (Neubauer 2010, Ritchie et al. 2010, Zhou et al. 2010). Our
results here provide new insights in the field of basic research which is important
for understanding the regulatory mechanisms of the orexin system.
121
122
7
Conclusions
In the current study, the major conclusions were:
1.
2.
3.
4.
The hPPO overexpressing mice showed a significant reduction in REM sleep
during both day and night, and differences in the amount of vigilance states
during the light/dark transition periods.
The tg mice showed an increased metabolic heat production and significantly
elevated day time food intake at RT. An acute cold exposure balanced the
effects of heat production observed at RT between genotypes. In addition, tg
mice decreased their locomotor activity in response to cold.
A short overnight fasting resulted in a decrease of orexin receptors’
expression, and abolished OXA induced duodenal mucosal HCO3 secretion
in rats.
A short overnight fasting inhibited OX1R expression and OXA induced
intracellular calcium signalling in acutely isolated duodenal enterocytes.
123
124
References
Adam JA, Menheere PP, van Dielen FM, Soeters PB, Buurman WA & Greve JW (2002)
Decreased plasma orexin-A levels in obese individuals. Int J Obes Relat Metab Disord
26(2): 274–6.
Adamantidis AR, Zhang F, Aravanis AM, Deisseroth K & de Lecea L (2007) Neural
substrates of awakening probed with optogenetic control of hypocretin neurons.
Nature 450(7168): 420–4.
Akiyama M, Yuasa T, Hayasaka N, Horikawa K, Sakurai T & Shibata S (2004) Reduced
food anticipatory activity in genetically orexin (hypocretin) neuron-ablated mice. Eur
J Neurosci 20(11): 3054–62.
Al-Barazanji KA, Wilson S, Baker J, Jessop DS & Harbuz MS (2001) Central orexin-A
activates hypothalamic-pituitary-adrenal axis and stimulates hypothalamic
corticotropin releasing factor and arginine vasopressin neurones in conscious rats. J
Neuroendocrinol 13(5): 421–4.
Alam MN, Gong H, Alam T, Jaganath R, McGinty D & Szymusiak R (2002) Sleepwaking discharge patterns of neurons recorded in the rat perifornical lateral
hypothalamic area. J Physiol 538(Pt 2): 619–31.
Allen A & Flemstrom G (2005) Gastroduodenal mucus bicarbonate barrier: protection
against acid and pepsin. Am J Physiol Cell Physiol 288(1): C1–19.
Ammoun S, Johansson L, Ekholm ME, Holmqvist T, Danis AS, Korhonen L, Sergeeva
OA, Haas HL, Akerman KE & Kukkonen JP (2006a) OX1 orexin receptors activate
extracellular signal-regulated kinase in Chinese hamster ovary cells via multiple
mechanisms: the role of Ca2+ influx in OX1 receptor signaling. Mol Endocrinol 20(1):
80–99.
Ammoun S, Lindholm D, Wootz H, Akerman KE & Kukkonen JP (2006b) G-proteincoupled OX1 orexin/hcrtr-1 hypocretin receptors induce caspase-dependent and independent cell death through p38 mitogen-/stress-activated protein kinase. J Biol
Chem 281(2): 834–42.
Aoi M, Aihara E, Nakashima M & Takeuchi K (2004) Participation of prostaglandin E
receptor EP4 subtype in duodenal bicarbonate secretion in rats. Am J Physiol
Gastrointest Liver Physiol 287(1): G96–103.
Arihara Z, Takahashi K, Murakami O, Totsune K, Sone M, Satoh F, Ito S, Hayashi Y,
Sasano H & Mouri T (2000) Orexin-A in the human brain and tumor tissues of
ganglioneuroblastoma and neuroblastoma. Peptides 21(4): 565–70.
Arihara Z, Takahashi K, Murakami O, Totsune K, Sone M, Satoh F, Ito S & Mouri T
(2001) Immunoreactive orexin-A in human plasma. Peptides 22(1): 139–42.
Arrigoni E, Mochizuki T & Scammell TE (2009) Activation of the basal forebrain by the
orexin/hypocretin neurones. Acta Physiol (Oxf) 198(3): 223–35.
Arsenijevic D, Onuma H, Pecqueur C, Raimbault S, Manning BS, Miroux B, Couplan E,
Alves-Guerra MC, Goubern M, Surwit R, Bouillaud F, Richard D, Collins S &
Ricquier D (2000) Disruption of the uncoupling protein-2 gene in mice reveals a role
in immunity and reactive oxygen species production. Nat Genet 26(4): 435–9.
125
Asahi S, Egashira S, Matsuda M, Iwaasa H, Kanatani A, Ohkubo M, Ihara M & Morishima
H (2003) Development of an orexin-2 receptor selective agonist, [Ala(11), DLeu(15)]orexin-B. Bioorg Med Chem Lett 13(1): 111–3.
Asakawa A, Inui A, Inui T, Katsuura G, Fujino MA & Kasuga M (2002) Orexin reverses
cholecystokinin-induced reduction in feeding. Diabetes Obes Metab 4(6): 399–401.
Aubert J, Champigny O, Saint-Marc P, Negrel R, Collins S, Ricquier D & Ailhaud G
(1997) Up-regulation of UCP-2 gene expression by PPAR agonists in preadipose and
adipose cells. Biochem Biophys Res Commun 238(2): 606–11.
Backberg M, Hervieu G, Wilson S & Meister B (2002) Orexin receptor-1 (OX-R1)
immunoreactivity in chemically identified neurons of the hypothalamus: focus on
orexin targets involved in control of food and water intake. Eur J Neurosci 15(2):
315–28.
Baldo BA, Gual-Bonilla L, Sijapati K, Daniel RA, Landry CF & Kelley AE (2004)
Activation of a subpopulation of orexin/hypocretin-containing hypothalamic neurons
by GABAA receptor-mediated inhibition of the nucleus accumbens shell, but not by
exposure to a novel environment. Eur J Neurosci 19(2): 376–86.
Ballesteros MA, Wolosin JD, Hogan DL, Koss MA & Isenberg JI (1991) Cholinergic
regulation of human proximal duodenal mucosal bicarbonate secretion. Am J Physiol
261(2 Pt 1): G327–31.
Baranowska B, Wolinska-Witort E, Martynska L, Chmielowska M & Baranowska-Bik A
(2005) Plasma orexin A, orexin B, leptin, neuropeptide Y (NPY) and insulin in obese
women. Neuro Endocrinol Lett 26(4): 293–6.
Barreiro ML, Pineda R, Gaytan F, Archanco M, Burrell MA, Castellano JM, Hakovirta H,
Nurmio M, Pinilla L, Aguilar E, Toppari J, Dieguez C & Tena-Sempere M (2005)
Pattern of orexin expression and direct biological actions of orexin-a in rat testis.
Endocrinology 146(12): 5164–75.
Barreiro ML, Pineda R, Navarro VM, Lopez M, Suominen JS, Pinilla L, Senaris R,
Toppari J, Aguilar E, Dieguez C & Tena-Sempere M (2004) Orexin 1 receptor
messenger ribonucleic acid expression and stimulation of testosterone secretion by
orexin-A in rat testis. Endocrinology 145(5): 2297–306.
Beck B, Richy S, Dimitrov T & Stricker-Krongrad A (2001) Opposite regulation of
hypothalamic orexin and neuropeptide Y receptors and peptide expressions in obese
Zucker rats. Biochem Biophys Res Commun 286(3): 518–23.
Beiras-Fernandez A, Gallego R, Blanco M, Garcia-Caballero T, Dieguez C & Beiras A
(2004) Merkel cells, a new localization of prepro-orexin and orexin receptors. J Anat
204(2): 117–22.
Bengtsson MW (2008) Effects of Orexins, Guanylins and Feeding on Duodenal
Bicarbonate Secretion and Enterocyte Intracellular Signaling. Digital Comprehensive
Summary thesis. Uppsala University, Department of Neuroscience, Division of
Physiology.
Bengtsson MW, Jedstedt G & Flemstrom G (2007) Duodenal bicarbonate secretion in rats:
stimulation by intra-arterial and luminal guanylin and uroguanylin. Acta Physiol (Oxf)
191(4): 309–17.
126
Berthoud HR, Carlson NR & Powley TL (1991) Topography of efferent vagal innervation
of the rat gastrointestinal tract. Am J Physiol 260(1 Pt 2): R200–7.
Beuckmann CT, Sinton CM, Williams SC, Richardson JA, Hammer RE, Sakurai T &
Yanagisawa M (2004) Expression of a poly-glutamine-ataxin-3 transgene in orexin
neurons induces narcolepsy-cataplexy in the rat. J Neurosci 24(18): 4469–77.
Binder HJ (2005) Gastric Function. In: Boron WF & Boulpaep EL (eds) Medical
Physiology. Philadelphia, Elsevier Saunders: 903–905.
Bingham MJ, Cai J & Deehan MR (2006) Eating, sleeping and rewarding: orexin receptors
and their antagonists. Curr Opin Drug Discov Devel 9(5): 551–9.
Blanco M, Gallego R, Garcia-Caballero T, Dieguez C & Beiras A (2003) Cellular
localization of orexins in human anterior pituitary. Histochem Cell Biol 120(4): 259–
64.
Blanco M, Garcia-Caballero T, Fraga M, Gallego R, Cuevas J, Forteza J, Beiras A &
Dieguez C (2002) Cellular localization of orexin receptors in human adrenal gland,
adrenocortical adenomas and pheochromocytomas. Regul Pept 104(1–3): 161–5.
Blanco M, Lopez M, Garcia-Caballero T, Gallego R, Vazquez-Boquete A, Morel G,
Senaris R, Casanueva F, Dieguez C & Beiras A (2001) Cellular localization of orexin
receptors in human pituitary. J Clin Endocrinol Metab 86(4): 1616–9.
Bonnavion P & de Lecea L (2010) Hypocretins in the control of sleep and wakefulness.
Curr Neurol Neurosci Rep 10(3): 174–9.
Borbely AA (1982) A two process model of sleep regulation. Hum Neurobiol 1(3): 195–
204.
Borecky J, Maia IG & Arruda P (2001) Mitochondrial uncoupling proteins in mammals
and plants. Biosci Rep 21(2): 201–12.
Borgland SL, Storm E & Bonci A (2008) Orexin B/hypocretin 2 increases glutamatergic
transmission to ventral tegmental area neurons. Eur J Neurosci 28(8): 1545–56.
Borgland SL, Taha SA, Sarti F, Fields HL & Bonci A (2006) Orexin A in the VTA is
critical for the induction of synaptic plasticity and behavioral sensitization to cocaine.
Neuron 49(4): 589–601.
Boss O, Samec S, Dulloo A, Seydoux J, Muzzin P & Giacobino JP (1997a) Tissuedependent upregulation of rat uncoupling protein-2 expression in response to fasting
or cold. FEBS Lett 412(1): 111–4.
Boss O, Samec S, Paoloni-Giacobino A, Rossier C, Dulloo A, Seydoux J, Muzzin P &
Giacobino JP (1997b) Uncoupling protein-3: a new member of the mitochondrial
carrier family with tissue-specific expression. FEBS Lett 408(1): 39–42.
Bouchard C, Perusse L, Chagnon YC, Warden C & Ricquier D (1997) Linkage between
markers in the vicinity of the uncoupling protein 2 gene and resting metabolic rate in
humans. Hum Mol Genet 6(11): 1887–9.
Bouillaud F (2009) UCP2, not a physiologically relevant uncoupler but a glucose sparing
switch impacting ROS production and glucose sensing. Biochim Biophys Acta
1787(5): 377–83.
127
Bourgin P, Huitron-Resendiz S, Spier AD, Fabre V, Morte B, Criado JR, Sutcliffe JG,
Henriksen SJ & de Lecea L (2000) Hypocretin-1 modulates rapid eye movement sleep
through activation of locus coeruleus neurons. J Neurosci 20(20): 7760–5.
Boutrel B, Cannella N & de Lecea L (2010) The role of hypocretin in driving arousal and
goal-oriented behaviors. Brain Res 1314: 103–11.
Boutrel B, Kenny PJ, Specio SE, Martin-Fardon R, Markou A, Koob GF & de Lecea L
(2005) Role for hypocretin in mediating stress-induced reinstatement of cocaineseeking behavior. Proc Natl Acad Sci USA 102(52): 19168–73.
Brisbare-Roch C, Dingemanse J, Koberstein R, Hoever P, Aissaoui H, Flores S, Mueller C,
Nayler O, van Gerven J, de Haas SL, Hess P, Qiu C, Buchmann S, Scherz M, Weller
T, Fischli W, Clozel M & Jenck F (2007) Promotion of sleep by targeting the orexin
system in rats, dogs and humans. Nat Med 13(2): 150–5.
Bronsky J, Nedvidkova J, Zamrazilova H, Pechova M, Chada M, Kotaska K, Nevoral J &
Prusa R (2007) Dynamic changes of orexin A and leptin in obese children during
body weight reduction. Physiol Res 56(1): 89–96.
Brown RE, Sergeeva OA, Eriksson KS & Haas HL (2002) Convergent excitation of dorsal
raphe serotonin neurons by multiple arousal systems (orexin/hypocretin, histamine
and noradrenaline). J Neurosci 22(20): 8850–9.
Brown TM, Coogan AN, Cutler DJ, Hughes AT & Piggins HD (2008)
Electrophysiological actions of orexins on rat suprachiasmatic neurons in vitro.
Neurosci Lett 448(3): 273–8.
Brownell SE & Conti B (2010) Age- and gender-specific changes of hypocretin
immunopositive neurons in C57Bl/6 mice. Neurosci Lett 472(1): 29–32.
Burdakov D, Gerasimenko O & Verkhratsky A (2005) Physiological changes in glucose
differentially modulate the excitability of hypothalamic melanin-concentrating
hormone and orexin neurons in situ. J Neurosci 25(9): 2429–33.
Burdakov D, Jensen LT, Alexopoulos H, Williams RH, Fearon IM, O'Kelly I,
Gerasimenko O, Fugger L & Verkhratsky A (2006) Tandem-pore K+ channels
mediate inhibition of orexin neurons by glucose. Neuron 50(5): 711–22.
Burdyga G, Lal S, Spiller D, Jiang W, Thompson D, Attwood S, Saeed S, Grundy D,
Varro A, Dimaline R & Dockray GJ (2003) Localization of orexin-1 receptors to
vagal afferent neurons in the rat and humans. Gastroenterology 124(1): 129–39.
Burlet S, Tyler CJ & Leonard CS (2002) Direct and indirect excitation of laterodorsal
tegmental neurons by Hypocretin/Orexin peptides: implications for wakefulness and
narcolepsy. J Neurosci 22(7): 2862–72.
Cadenas S, Buckingham JA, Samec S, Seydoux J, Din N, Dulloo AG & Brand MD (1999)
UCP2 and UCP3 rise in starved rat skeletal muscle but mitochondrial proton
conductance is unchanged. FEBS Lett 462(3): 257–60.
Cadenas S, Echtay KS, Harper JA, Jekabsons MB, Buckingham JA, Grau E, Abuin A,
Chapman H, Clapham JC & Brand MD (2002) The basal proton conductance of
skeletal muscle mitochondria from transgenic mice overexpressing or lacking
uncoupling protein-3. J Biol Chem 277(4): 2773–8.
128
Cai XJ, Widdowson PS, Harrold J, Wilson S, Buckingham RE, Arch JR, Tadayyon M,
Clapham JC, Wilding J & Williams G (1999) Hypothalamic orexin expression:
modulation by blood glucose and feeding. Diabetes 48(11): 2132–7.
Cajochen C, Wyatt JK, Czeisler CA & Dijk DJ (2002) Separation of circadian and wake
duration-dependent modulation of EEG activation during wakefulness. Neuroscience
114(4): 1047–60.
Cannon B & Nedergaard J (2004) Brown adipose tissue: function and physiological
significance. Physiol Rev 84(1): 277–359.
Cannon B, Shabalina IG, Kramarova TV, Petrovic N & Nedergaard J (2006) Uncoupling
proteins: a role in protection against reactive oxygen species--or not? Biochim
Biophys Acta 1757(5–6): 449–58.
Challet E (2010) Interactions between light, mealtime and calorie restriction to control
daily timing in mammals. J Comp Physiol B 180(5): 631–44.
Champigny O & Ricquier D (1990) Effects of fasting and refeeding on the level of
uncoupling protein mRNA in rat brown adipose tissue: evidence for diet-induced and
cold-induced responses. J Nutr 120(12): 1730–6.
Chang H, Saito T, Ohiwa N, Tateoka M, Deocaris CC, Fujikawa T & Soya H (2007)
Inhibitory effects of an orexin-2 receptor antagonist on orexin A- and stress-induced
ACTH responses in conscious rats. Neurosci Res 57(3): 462–6.
Chemelli RM, Willie JT, Sinton CM, Elmquist JK, Scammell T, Lee C, Richardson JA,
Williams SC, Xiong Y, Kisanuki Y, Fitch TE, Nakazato M, Hammer RE, Saper CB &
Yanagisawa M (1999) Narcolepsy in orexin knockout mice: molecular genetics of
sleep regulation. Cell 98(4): 437–51.
Chen CT, Hwang LL, Chang JK & Dun NJ (2000) Pressor effects of orexins injected
intracisternally and to rostral ventrolateral medulla of anesthetized rats. Am J Physiol
Regul Integr Comp Physiol 278(3): R692–7.
Chen J & Randeva HS (2004) Genomic organization of mouse orexin receptors:
characterization of two novel tissue-specific splice variants. Mol Endocrinol 18(11):
2790–804.
Chen L, Thakkar MM, Winston S, Bolortuya Y, Basheer R & McCarley RW (2006) REM
sleep changes in rats induced by siRNA-mediated orexin knockdown. Eur J Neurosci
24(7): 2039–48.
Chen XW, Huang W, Yan JA, Fan HX, Guo N, Lu J, Xiu Y, Gu JL, Zhang CX, Ruan HZ,
Hu ZA, Yu ZP & Zhou Z (2008) Reinvestigation of the effect of orexin A on
catecholamine release from adrenal chromaffin cells. Neurosci Lett 436(2): 181–4.
Chew CS, Safsten B & Flemstrom G (1998) Calcium signaling in cultured human and rat
duodenal enterocytes. Am J Physiol 275(2 Pt 1): G296–304.
Chou TC, Lee CE, Lu J, Elmquist JK, Hara J, Willie JT, Beuckmann CT, Chemelli RM,
Sakurai T, Yanagisawa M, Saper CB & Scammell TE (2001) Orexin (hypocretin)
neurons contain dynorphin. J Neurosci 21(19): RC168.
Ciriello J, Li Z & de Oliveira CV (2003) Cardioacceleratory responses to hypocretin-1
injections into rostral ventromedial medulla. Brain Res 991(1–2): 84–95.
129
Cohade C, Mourtzikos KA & Wahl RL (2003a) "USA-Fat": prevalence is related to
ambient outdoor temperature-evaluation with 18F-FDG PET/CT. J Nucl Med 44(8):
1267–70.
Cohade C, Osman M, Pannu HK & Wahl RL (2003b) Uptake in supraclavicular area fat
("USA-Fat"): description on 18F-FDG PET/CT. J Nucl Med 44(2): 170–6.
Conti B, Sanchez-Alavez M, Winsky-Sommerer R, Morale MC, Lucero J, Brownell S,
Fabre V, Huitron-Resendiz S, Henriksen S, Zorrilla EP, de Lecea L & Bartfai T (2006)
Transgenic mice with a reduced core body temperature have an increased life span.
Science 314(5800): 825–8.
Cox CD, Breslin MJ, Whitman DB, Schreier JD, McGaughey GB, Bogusky MJ, Roecker
AJ, Mercer SP, Bednar RA, Lemaire W, Bruno JG, Reiss DR, Harrell CM, Murphy
KL, Garson SL, Doran SM, Prueksaritanont T, Anderson WB, Tang C, Roller S,
Cabalu TD, Cui D, Hartman GD, Young SD, Koblan KS, Winrow CJ, Renger JJ &
Coleman PJ (2010) Discovery of the Dual Orexin Receptor Antagonist [(7R)-4-(5Chloro-1,3-benzoxazol-2-yl)-7-methyl-1,4-diazepan-1-yl][5-methy
l-2-(2H-1,2,3triazol-2-yl)phenyl]methanone (MK-4305) for the Treatment of Insomnia. J Med
Chem 53(14): 5320–32.
Cusin I, Zakrzewska KE, Boss O, Muzzin P, Giacobino JP, Ricquier D, Jeanrenaud B &
Rohner-Jeanrenaud F (1998) Chronic central leptin infusion enhances insulinstimulated glucose metabolism and favors the expression of uncoupling proteins.
Diabetes 47(7): 1014–9.
Cutler DJ, Morris R, Sheridhar V, Wattam TA, Holmes S, Patel S, Arch JR, Wilson S,
Buckingham RE, Evans ML, Leslie RA & Williams G (1999) Differential distribution
of orexin-A and orexin-B immunoreactivity in the rat brain and spinal cord. Peptides
20(12): 1455–70.
Cypess AM, Lehman S, Williams G, Tal I, Rodman D, Goldfine AB, Kuo FC, Palmer EL,
Tseng YH, Doria A, Kolodny GM & Kahn CR (2009) Identification and importance
of brown adipose tissue in adult humans. N Engl J Med 360(15): 1509–17.
Dahlman I, Forsgren M, Sjogren A, Nordstrom EA, Kaaman M, Naslund E, Attersand A &
Arner P (2006) Downregulation of electron transport chain genes in visceral adipose
tissue in type 2 diabetes independent of obesity and possibly involving tumor necrosis
factor-alpha. Diabetes 55(6): 1792–9.
Dalal MA, Schuld A, Haack M, Uhr M, Geisler P, Eisensehr I, Noachtar S & Pollmacher T
(2001) Normal plasma levels of orexin A (hypocretin-1) in narcoleptic patients.
Neurology 56(12): 1749–51.
Date Y, Ueta Y, Yamashita H, Yamaguchi H, Matsukura S, Kangawa K, Sakurai T,
Yanagisawa M & Nakazato M (1999) Orexins, orexigenic hypothalamic peptides,
interact with autonomic, neuroendocrine and neuroregulatory systems. Proc Natl Acad
Sci USA 96(2): 748–53.
Deboer T, Overeem S, Visser NA, Duindam H, Frolich M, Lammers GJ & Meijer JH
(2004) Convergence of circadian and sleep regulatory mechanisms on hypocretin-1.
Neuroscience 129(3): 727–32.
130
Dibner C, Schibler U & Albrecht U (2010) The mammalian circadian timing system:
organization and coordination of central and peripheral clocks. Annu Rev Physiol 72:
517–49.
Digby JE, Chen J, Tang JY, Lehnert H, Matthews RN & Randeva HS (2006) Orexin
receptor expression in human adipose tissue: effects of orexin-A and orexin-B. J
Endocrinol 191(1): 129–36.
Digby JE, Crowley VE, Sewter CP, Whitehead JP, Prins JB & O'Rahilly S (2000) Depotrelated and thiazolidinedione-responsive expression of uncoupling protein 2 (UCP2)
in human adipocytes. Int J Obes Relat Metab Disord 24(5): 585–92.
DiLeone RJ, Georgescu D & Nestler EJ (2003) Lateral hypothalamic neuropeptides in
reward and drug addiction. Life Sci 73(6): 759–68.
Diniz Behn CG, Kopell N, Brown EN, Mochizuki T & Scammell TE (2008) Delayed
orexin signaling consolidates wakefulness and sleep: physiology and modeling. J
Neurophysiol 99(6): 3090–103.
Dube MG, Kalra SP & Kalra PS (1999) Food intake elicited by central administration of
orexins/hypocretins: identification of hypothalamic sites of action. Brain Res 842(2):
473–7.
Ducroc R, Voisin T, El Firar A & Laburthe M (2007) Orexins control intestinal glucose
transport by distinct neuronal, endocrine, and direct epithelial pathways. Diabetes
56(10): 2494–500.
Dudley CA, Erbel-Sieler C, Estill SJ, Reick M, Franken P, Pitts S & McKnight SL (2003)
Altered patterns of sleep and behavioral adaptability in NPAS2-deficient mice.
Science 301(5631): 379–83.
Easton A, Meerlo P, Bergmann B & Turek FW (2004) The suprachiasmatic nucleus
regulates sleep timing and amount in mice. Sleep 27(7): 1307–18.
Echtay KS (2007) Mitochondrial uncoupling proteins--what is their physiological role?
Free Radic Biol Med 43(10): 1351–71.
Edgar DM, Dement WC & Fuller CA (1993) Effect of SCN lesions on sleep in squirrel
monkeys: evidence for opponent processes in sleep-wake regulation. J Neurosci 13(3):
1065–79.
Eggermann E, Serafin M, Bayer L, Machard D, Saint-Mleux B, Jones BE & Muhlethaler
M (2001) Orexins/hypocretins excite basal forebrain cholinergic neurones.
Neuroscience 108(2): 177–81.
Ehrstrom M, Gustafsson T, Finn A, Kirchgessner A, Gryback P, Jacobsson H, Hellstrom
PM & Naslund E (2005a) Inhibitory effect of exogenous orexin a on gastric emptying,
plasma leptin, and the distribution of orexin and orexin receptors in the gut and
pancreas in man. J Clin Endocrinol Metab 90(4): 2370–7.
Ehrstrom M, Levin F, Kirchgessner AL, Schmidt PT, Hilsted LM, Gryback P, Jacobsson H,
Hellstrom PM & Naslund E (2005b) Stimulatory effect of endogenous orexin A on
gastric emptying and acid secretion independent of gastrin. Regul Pept 132(1–3): 9–
16.
131
Ehrstrom M, Naslund E, Levin F, Kaur R, Kirchgessner AL, Theodorsson E & Hellstrom
PM (2004) Pharmacokinetic profile of orexin A and effects on plasma insulin and
glucagon in the rat. Regul Pept 119(3): 209–12.
Ehrstrom M, Naslund E, Ma J, Kirchgessner AL & Hellstrom PM (2003) Physiological
regulation and NO-dependent inhibition of migrating myoelectric complex in the rat
small bowel by OXA. Am J Physiol Gastrointest Liver Physiol 285(4): G688–95.
Elias CF, Saper CB, Maratos-Flier E, Tritos NA, Lee C, Kelly J, Tatro JB, Hoffman GE,
Ollmann MM, Barsh GS, Sakurai T, Yanagisawa M & Elmquist JK (1998)
Chemically defined projections linking the mediobasal hypothalamus and the lateral
hypothalamic area. J Comp Neurol 402(4): 442–59.
Elmquist JK, Elias CF & Saper CB (1999) From lesions to leptin: hypothalamic control of
food intake and body weight. Neuron 22(2): 221–32.
Enerback S, Jacobsson A, Simpson EM, Guerra C, Yamashita H, Harper ME & Kozak LP
(1997) Mice lacking mitochondrial uncoupling protein are cold-sensitive but not
obese. Nature 387(6628): 90–4.
Espana RA, Baldo BA, Kelley AE & Berridge CW (2001) Wake-promoting and sleepsuppressing actions of hypocretin (orexin): basal forebrain sites of action.
Neuroscience 106(4): 699–715.
Fadel J & Deutch AY (2002) Anatomical substrates of orexin-dopamine interactions:
lateral hypothalamic projections to the ventral tegmental area. Neuroscience 111(2):
379–87.
Fadel J, Pasumarthi R & Reznikov LR (2005) Stimulation of cortical acetylcholine release
by orexin A. Neuroscience 130(2): 541–7.
Farkas B, Vilagi I & Detari L (2002) Effect of orexin-A on discharge rate of rat
suprachiasmatic nucleus neurons in vitro. Acta Biol Hung 53(4): 435–43.
Fearnside JF, Dumas ME, Rothwell AR, Wilder SP, Cloarec O, Toye A, Blancher C,
Holmes E, Tatoud R, Barton RH, Scott J, Nicholson JK & Gauguier D (2008)
Phylometabonomic patterns of adaptation to high fat diet feeding in inbred mice.
PLoS ONE 3(2): e1668.
Feldmann HM, Golozoubova V, Cannon B & Nedergaard J (2009) UCP1 ablation induces
obesity and abolishes diet-induced thermogenesis in mice exempt from thermal stress
by living at thermoneutrality. Cell Metab 9(2): 203–9.
Flemstrom G (1980) Stimulation of HCO3- transport in isolated proximal bullfrog
duodenum by prostaglandins. Am J Physiol 239(3): G198–203.
Flemstrom G, Bengtsson MW, Makela K & Herzig KH (2010) Effects of short-term food
deprivation on orexin-A-induced intestinal bicarbonate secretion in comparison with
related secretagogues. Acta Physiol (Oxf) 198(3): 373–80.
Flemstrom G, Garner A, Nylander O, Hurst BC & Heylings JR (1982) Surface epithelial
HCO3(-) transport by mammalian duodenum in vivo. Am J Physiol 243(5): G348–58.
Flemstrom G, Hallgren A, Nylander O, Engstrand L, Wilander E & Allen A (1999)
Adherent surface mucus gel restricts diffusion of macromolecules in rat duodenum in
vivo. Am J Physiol 277(2 Pt 1): G375–82.
132
Flemstrom G & Isenberg JI (2001) Gastroduodenal mucosal alkaline secretion and
mucosal protection. News Physiol Sci 16: 23–8.
Flemstrom G & Jedstedt G (1989) Stimulation of duodenal mucosal bicarbonate secretion
in the rat by brain peptides. Gastroenterology 97(2): 412–20.
Flemstrom G & Nylander O (1981) Stimulation of duodenal epithelial HCO3- transport in
the guinea pig and cat by luminal prostaglandin E2. Prostaglandins 21 Suppl: 47–52.
Flemstrom G & Sjoblom M (2005) Epithelial cells and their neighbors. II. New
perspectives on efferent signaling between brain, neuroendocrine cells, and gut
epithelial cells. Am J Physiol Gastrointest Liver Physiol 289(3): G377–80.
Flemstrom G, Sjoblom M, Jedstedt G & Akerman KE (2003) Short fasting dramatically
decreases rat duodenal secretory responsiveness to orexin A but not to VIP or
melatonin. Am J Physiol Gastrointest Liver Physiol 285(6): G1091–6.
Fleury C, Neverova M, Collins S, Raimbault S, Champigny O, Levi-Meyrueis C,
Bouillaud F, Seldin MF, Surwit RS, Ricquier D & Warden CH (1997) Uncoupling
protein-2: a novel gene linked to obesity and hyperinsulinemia. Nat Genet 15(3): 269–
72.
Fogelholm M & Kukkonen-Harjula K (2000) Does physical activity prevent weight gain--a
systematic review. Obes Rev 1(2): 95–111.
Franken P, Chollet D & Tafti M (2001) The homeostatic regulation of sleep need is under
genetic control. J Neurosci 21(8): 2610–21.
Franken P, Malafosse A & Tafti M (1998) Genetic variation in EEG activity during sleep
in inbred mice. Am J Physiol 275(4 Pt 2): R1127–37.
Fuller PM, Gooley JJ & Saper CB (2006) Neurobiology of the sleep-wake cycle: sleep
architecture, circadian regulation, and regulatory feedback. J Biol Rhythms 21(6):
482–93.
Fuller PM, Lu J & Saper CB (2008) Differential rescue of light- and food-entrainable
circadian rhythms. Science 320(5879): 1074–7.
Funato H, Tsai AL, Willie JT, Kisanuki Y, Williams SC, Sakurai T & Yanagisawa M
(2009) Enhanced orexin receptor-2 signaling prevents diet-induced obesity and
improves leptin sensitivity. Cell Metab 9(1): 64–76.
Furness JB, Kunze WA & Clerc N (1999) Nutrient tasting and signaling mechanisms in the
gut. II. The intestine as a sensory organ: neural, endocrine, and immune responses.
Am J Physiol 277(5 Pt 1): G922–8.
Gallmann E, Arsenijevic D, Williams G, Langhans W & Spengler M (2006) Effect of
intraperitoneal CCK-8 on food intake and brain orexin-A after 48 h of fasting in the
rat. Regul Pept 133(1–3): 139–46.
Gallopin T, Fort P, Eggermann E, Cauli B, Luppi PH, Rossier J, Audinat E, Muhlethaler M
& Serafin M (2000) Identification of sleep-promoting neurons in vitro. Nature
404(6781): 992–5.
Ganong WF (2005) Regulation of gastrointestinal function. In: Ganong WF (ed) Review of
Medical Physiology. New York, McGraw-Hill Medical: 491, 503.
133
Georgescu D, Zachariou V, Barrot M, Mieda M, Willie JT, Eisch AJ, Yanagisawa M,
Nestler EJ & DiLeone RJ (2003) Involvement of the lateral hypothalamic peptide
orexin in morphine dependence and withdrawal. J Neurosci 23(8): 3106–11.
Gimeno RE, Dembski M, Weng X, Deng N, Shyjan AW, Gimeno CJ, Iris F, Ellis SJ,
Woolf EA & Tartaglia LA (1997) Cloning and characterization of an uncoupling
protein homolog: a potential molecular mediator of human thermogenesis. Diabetes
46(5): 900–6.
Glad H, Svendsen P, Olsen O & Schaffalitzky de Muckadell OB (1997) Importance of
vagus nerves in duodenal acid neutralization in anesthetized pigs. Am J Physiol 272(1
Pt 1): G154–60.
Golozoubova V, Cannon B & Nedergaard J (2006) UCP1 is essential for adaptive
adrenergic nonshivering thermogenesis. Am J Physiol Endocrinol Metab 291(2):
E350–7.
Goncz E, Strowski MZ, Grotzinger C, Nowak KW, Kaczmarek P, Sassek M, Mergler S,
El-Zayat BF, Theodoropoulou M, Stalla GK, Wiedenmann B & Plockinger U (2008)
Orexin-A inhibits glucagon secretion and gene expression through a Foxo1-dependent
pathway. Endocrinology 149(4): 1618–26.
Gong DW, He Y, Karas M & Reitman M (1997) Uncoupling protein-3 is a mediator of
thermogenesis regulated by thyroid hormone, beta3-adrenergic agonists, and leptin. J
Biol Chem 272(39): 24129–32.
Grynkiewicz G, Poenie M & Tsien RY (1985) A new generation of Ca2+ indicators with
greatly improved fluorescence properties. J Biol Chem 260(6): 3440–50.
Guba M, Kuhn M, Forssmann WG, Classen M, Gregor M & Seidler U (1996) Guanylin
strongly stimulates rat duodenal HCO3- secretion: proposed mechanism and
comparison with other secretagogues. Gastroenterology 111(6): 1558–68.
Hagan JJ, Leslie RA, Patel S, Evans ML, Wattam TA, Holmes S, Benham CD, Taylor SG,
Routledge C, Hemmati P, Munton RP, Ashmeade TE, Shah AS, Hatcher JP, Hatcher
PD, Jones DN, Smith MI, Piper DC, Hunter AJ, Porter RA & Upton N (1999) Orexin
A activates locus coeruleus cell firing and increases arousal in the rat. Proc Natl Acad
Sci USA 96(19): 10911–6.
Hany TF, Gharehpapagh E, Kamel EM, Buck A, Himms-Hagen J & von Schulthess GK
(2002) Brown adipose tissue: a factor to consider in symmetrical tracer uptake in the
neck and upper chest region. Eur J Nucl Med Mol Imaging 29(10): 1393–8.
Hara J, Beuckmann CT, Nambu T, Willie JT, Chemelli RM, Sinton CM, Sugiyama F,
Yagami K, Goto K, Yanagisawa M & Sakurai T (2001) Genetic ablation of orexin
neurons in mice results in narcolepsy, hypophagia, and obesity. Neuron 30(2): 345–54.
Hara J, Yanagisawa M & Sakurai T (2005) Difference in obesity phenotype between
orexin-knockout mice and orexin neuron-deficient mice with same genetic
background and environmental conditions. Neurosci Lett 380(3): 239–42.
Harris GC, Wimmer M & Aston-Jones G (2005) A role for lateral hypothalamic orexin
neurons in reward seeking. Nature 437(7058): 556–9.
134
Haynes AC, Chapman H, Taylor C, Moore GB, Cawthorne MA, Tadayyon M, Clapham
JC & Arch JR (2002) Anorectic, thermogenic and anti-obesity activity of a selective
orexin-1 receptor antagonist in ob/ob mice. Regul Pept 104(1–3): 153–9.
Haynes AC, Jackson B, Chapman H, Tadayyon M, Johns A, Porter RA & Arch JR (2000)
A selective orexin-1 receptor antagonist reduces food consumption in male and female
rats. Regul Pept 96(1–2): 45–51.
Haynes AC, Jackson B, Overend P, Buckingham RE, Wilson S, Tadayyon M & Arch JR
(1999) Effects of single and chronic intracerebroventricular administration of the
orexins on feeding in the rat. Peptides 20(9): 1099–105.
Heinonen MV, Purhonen AK, Makela KA & Herzig KH (2008) Functions of orexins in
peripheral tissues. Acta Physiol (Oxf) 192(4): 471–85.
Heinonen MV, Purhonen AK, Miettinen P, Paakkonen M, Pirinen E, Alhava E, Akerman
K & Herzig KH (2005) Apelin, orexin-A and leptin plasma levels in morbid obesity
and effect of gastric banding. Regul Pept 130(1–2): 7–13.
Hervieu GJ, Cluderay JE, Harrison DC, Roberts JC & Leslie RA (2001) Gene expression
and protein distribution of the orexin-1 receptor in the rat brain and spinal cord.
Neuroscience 103(3): 777–97.
Herzig KH & Purhonen AK (2010) Physiology and pathophysiology of
hypocretins/orexins. Acta Physiol (Oxf) 198(3): 199–200.
Higuchi S, Usui A, Murasaki M, Matsushita S, Nishioka N, Yoshino A, Matsui T,
Muraoka H, Ishizuka Y, Kanba S & Sakurai T (2002) Plasma orexin-A is lower in
patients with narcolepsy. Neurosci Lett 318(2): 61–4.
Hirota K, Kushikata T, Kudo M, Kudo T, Smart D & Matsuki A (2003) Effects of central
hypocretin-1 administration on hemodynamic responses in young-adult and middleaged rats. Brain Res 981(1–2): 143–50.
Hoever P, de Haas S, Winkler J, Schoemaker RC, Chiossi E, van Gerven J & Dingemanse
J (2010) Orexin receptor antagonism, a new sleep-promoting paradigm: an ascending
single-dose study with almorexant. Clin Pharmacol Ther 87(5): 593–600.
Hogan DL, Rapier RC, Dreilinger A, Koss MA, Basuk PM, Weinstein WM, Nyberg LM &
Isenberg JI (1996) Duodenal bicarbonate secretion: eradication of Helicobacter pylori
and duodenal structure and function in humans. Gastroenterology 110(3): 705–16.
Hollander JA, Lu Q, Cameron MD, Kamenecka TM & Kenny PJ (2008) Insular hypocretin
transmission regulates nicotine reward. Proc Natl Acad Sci USA 105(49): 19480–5.
Holm M, Johansson B, Pettersson A & Fandriks L (1998) Carbon dioxide mediates
duodenal mucosal alkaline secretion in response to luminal acidity in the anesthetized
rat. Gastroenterology 115(3): 680–5.
Holmqvist T, Akerman KE & Kukkonen JP (2002) Orexin signaling in recombinant
neuron-like cells. FEBS Lett 526(1–3): 11–4.
Holmqvist T, Johansson L, Ostman M, Ammoun S, Akerman KE & Kukkonen JP (2005)
OX1 orexin receptors couple to adenylyl cyclase regulation via multiple mechanisms.
J Biol Chem 280(8): 6570–9.
135
Hondo M, Nagai K, Ohno K, Kisanuki Y, Willie JT, Watanabe T, Yanagisawa M &
Sakurai T (2009) Histamine-1 receptor is not required as a downstream effector of
orexin-2 receptor in maintenance of basal sleep/wake states. Acta Physiol (Oxf).
Horvath TL, Diano S, Miyamoto S, Barry S, Gatti S, Alberati D, Livak F, Lombardi A,
Moreno M, Goglia F, Mor G, Hamilton J, Kachinskas D, Horwitz B & Warden CH
(2003) Uncoupling proteins-2 and 3 influence obesity and inflammation in transgenic
mice. Int J Obes Relat Metab Disord 27(4): 433–42.
Horvath TL, Peyron C, Diano S, Ivanov A, Aston-Jones G, Kilduff TS & van Den Pol AN
(1999) Hypocretin (orexin) activation and synaptic innervation of the locus coeruleus
noradrenergic system. J Comp Neurol 415(2): 145–59.
Huang C, Zhang Y, Gong Z, Sheng X, Li Z, Zhang W & Qin Y (2006) Berberine inhibits
3T3-L1 adipocyte differentiation through the PPARgamma pathway. Biochem
Biophys Res Commun 348(2): 571–8.
Huang ZL, Qu WM, Li WD, Mochizuki T, Eguchi N, Watanabe T, Urade Y & Hayaishi O
(2001) Arousal effect of orexin A depends on activation of the histaminergic system.
Proc Natl Acad Sci USA 98(17): 9965–70.
Huber R, Deboer T & Tobler I (2000) Effects of sleep deprivation on sleep and sleep EEG
in three mouse strains: empirical data and simulations. Brain Res 857(1–2): 8–19.
Hulbert AJ & Else PL (2004) Basal metabolic rate: history, composition, regulation, and
usefulness. Physiol Biochem Zool 77(6): 869–76.
Hungs M, Fan J, Lin L, Lin X, Maki RA & Mignot E (2001) Identification and functional
analysis of mutations in the hypocretin (orexin) genes of narcoleptic canines. Genome
Res 11(4): 531–9.
Ibuka N, Nihonmatsu I & Sekiguchi S (1980) Sleep-wakefulness rhythms in mice after
suprachiasmatic nucleus lesions. Waking Sleeping 4(2): 167–73.
Isenberg JI, Hogan DL, Koss MA & Selling JA (1986) Human duodenal mucosal
bicarbonate secretion. Evidence for basal secretion and stimulation by hydrochloric
acid and a synthetic prostaglandin E1 analogue. Gastroenterology 91(2): 370–8.
Jaburek M, Varecha M, Gimeno RE, Dembski M, Jezek P, Zhang M, Burn P, Tartaglia LA
& Garlid KD (1999) Transport function and regulation of mitochondrial uncoupling
proteins 2 and 3. J Biol Chem 274(37): 26003–7.
Jaszberenyi M, Bujdoso E, Pataki I & Telegdy G (2000) Effects of orexins on the
hypothalamic-pituitary-adrenal system. J Neuroendocrinol 12(12): 1174–8.
Jia JJ, Zhang X, Ge CR & Jois M (2009) The polymorphisms of UCP2 and UCP3 genes
associated with fat metabolism, obesity and diabetes. Obes Rev 10(5): 519–26.
Johansson L, Ekholm ME & Kukkonen JP (2007) Regulation of OX1 orexin/hypocretin
receptor-coupling to phospholipase C by Ca2+ influx. Br J Pharmacol 150(1): 97–104.
Johansson L, Ekholm ME & Kukkonen JP (2008) Multiple phospholipase activation by
OX(1) orexin/hypocretin receptors. Cell Mol Life Sci 65(12): 1948–56.
John J, Wu MF, Maidment NT, Lam HA, Boehmer LN, Patton M & Siegel JM (2004)
Developmental changes in CSF hypocretin-1 (orexin-A) levels in normal and
genetically narcoleptic Doberman pinschers. J Physiol 560(Pt 2): 587–92.
136
Johren O, Neidert SJ, Kummer M, Dendorfer A & Dominiak P (2001) Prepro-orexin and
orexin receptor mRNAs are differentially expressed in peripheral tissues of male and
female rats. Endocrinology 142(8): 3324–31.
Jonson C, Nylander O, Flemstrom G & Fandriks L (1986) Vagal stimulation of duodenal
HCO3(-)-secretion in anaesthetized rats. Acta Physiol Scand 128(1): 65–70.
Joo NS, London RM, Kim HD, Forte LR & Clarke LL (1998) Regulation of intestinal Cland HCO3-secretion by uroguanylin. Am J Physiol 274(4 Pt 1): G633–44.
Kantor S, Mochizuki T, Janisiewicz AM, Clark E, Nishino S & Scammell TE (2009)
Orexin neurons are necessary for the circadian control of REM sleep. Sleep 32(9):
1127–34.
Karteris E, Chen J & Randeva HS (2004) Expression of human prepro-orexin and
signaling characteristics of orexin receptors in the male reproductive system. J Clin
Endocrinol Metab 89(4): 1957–62.
Karteris E, Machado RJ, Chen J, Zervou S, Hillhouse EW & Randeva HS (2005) Food
deprivation differentially modulates orexin receptor expression and signaling in rat
hypothalamus and adrenal cortex. Am J Physiol Endocrinol Metab 288(6): E1089–100.
Karteris E, Randeva HS, Grammatopoulos DK, Jaffe RB & Hillhouse EW (2001)
Expression and coupling characteristics of the CRH and orexin type 2 receptors in
human fetal adrenals. J Clin Endocrinol Metab 86(9): 4512–9.
Kastin AJ & Akerstrom V (1999) Orexin A but not orexin B rapidly enters brain from
blood by simple diffusion. J Pharmacol Exp Ther 289(1): 219–23.
Kaur S, Thankachan S, Begum S, Blanco-Centurion C, Sakurai T, Yanagisawa M &
Shiromani PJ (2008) Entrainment of temperature and activity rhythms to restricted
feeding in orexin knock out mice. Brain Res 1205: 47–54.
Kayaba Y, Nakamura A, Kasuya Y, Ohuchi T, Yanagisawa M, Komuro I, Fukuda Y &
Kuwaki T (2003) Attenuated defense response and low basal blood pressure in orexin
knockout mice. Am J Physiol Regul Integr Comp Physiol 285(3): R581–93.
Kelly LJ, Vicario PP, Thompson GM, Candelore MR, Doebber TW, Ventre J, Wu MS,
Meurer R, Forrest MJ, Conner MW, Cascieri MA & Moller DE (1998) Peroxisome
proliferator-activated receptors gamma and alpha mediate in vivo regulation of
uncoupling protein (UCP-1, UCP-2, UCP-3) gene expression. Endocrinology 139(12):
4920–7.
Kim HY, Hong E, Kim JI & Lee W (2004) Solution structure of human orexin-A:
regulator of appetite and wakefulness. J Biochem Mol Biol 37(5): 565–73.
Kim J, Nakajima K, Oomura Y, Wayner MJ & Sasaki K (2009) Electrophysiological
effects of orexins/hypocretins on pedunculopontine tegmental neurons in rats: an in
vitro study. Peptides 30(2): 191–209.
Kintscher U & Law RE (2005) PPARgamma-mediated insulin sensitization: the
importance of fat versus muscle. Am J Physiol Endocrinol Metab 288(2): E287–91.
Kirchgessner AL & Liu M (1999) Orexin synthesis and response in the gut. Neuron 24(4):
941–51.
137
Kisanuki YY, Chemelli RM, Sinton CM, Williams SC, Richardson JA, Hammer RE &
Yanagisawa M (2000) The role of Orexin Receptor Type-1 (OX1R) in the Regulation
of Sleep. Sleep 23: A91.
Kisanuki YY, Chemelli RM, Tokita S, Willie JT, Sinton CM & Yanagisawa M (2001)
Behavioral and Polysomnographic Characterization of Orexin-1 Receptor and Orexin2 Receptor Double Knockout Mice. Sleep 24: A22.
Klisch C, Inyushkin A, Mordel J, Karnas D, Pevet P & Meissl H (2009) Orexin A
modulates neuronal activity of the rodent suprachiasmatic nucleus in vitro. Eur J
Neurosci 30(1): 65–75.
Kobashi M, Furudono Y, Matsuo R & Yamamoto T (2002) Central orexin facilitates
gastric relaxation and contractility in rats. Neurosci Lett 332(3): 171–4.
Kohlmeier KA, Inoue T & Leonard CS (2004) Hypocretin/orexin peptide signaling in the
ascending arousal system: elevation of intracellular calcium in the mouse dorsal raphe
and laterodorsal tegmentum. J Neurophysiol 92(1): 221–35.
Kohno D, Suyama S & Yada T (2008) Leptin transiently antagonizes ghrelin and longlastingly orexin in regulation of Ca2+ signaling in neuropeptide Y neurons of the
arcuate nucleus. World J Gastroenterol 14(41): 6347–54.
Kok SW, Overeem S, Visscher TL, Lammers GJ, Seidell JC, Pijl H & Meinders AE (2003)
Hypocretin deficiency in narcoleptic humans is associated with abdominal obesity.
Obes Res 11(9): 1147–54.
Komaki G, Matsumoto Y, Nishikata H, Kawai K, Nozaki T, Takii M, Sogawa H & Kubo
C (2001) Orexin-A and leptin change inversely in fasting non-obese subjects. Eur J
Endocrinol 144(6): 645–51.
Krowicki ZK, Burmeister MA, Berthoud HR, Scullion RT, Fuchs K & Hornby PJ (2002)
Orexins in rat dorsal motor nucleus of the vagus potently stimulate gastric motor
function. Am J Physiol Gastrointest Liver Physiol 283(2): G465–72.
Kukkonen JP & Akerman KE (2001) Orexin receptors couple to Ca2+ channels different
from store-operated Ca2+ channels. Neuroreport 12(9): 2017–20.
Kukkonen JP, Holmqvist T, Ammoun S & Akerman KE (2002) Functions of the
orexinergic/hypocretinergic system. Am J Physiol Cell Physiol 283(6): C1567–91.
Kuru M, Ueta Y, Serino R, Nakazato M, Yamamoto Y, Shibuya I & Yamashita H (2000)
Centrally administered orexin/hypocretin activates HPA axis in rats. Neuroreport
11(9): 1977–80.
Lammers GJ, Pijl H, Iestra J, Langius JA, Buunk G & Meinders AE (1996) Spontaneous
food choice in narcolepsy. Sleep 19(1): 75–6.
Landolt HP, Dijk DJ, Gaus SE & Borbely AA (1995) Caffeine reduces low-frequency
delta activity in the human sleep EEG. Neuropsychopharmacology 12(3): 229–38.
Lang M, Bufe B, De Pol S, Reiser O, Meyerhof W & Beck-Sickinger AG (2006) Structural
properties of orexins for activation of their receptors. J Pept Sci 12(4): 258–66.
Larson GM, Jedstedt G, Nylander O & Flemstrom G (1996) Intracerebral adrenoceptor
agonists influence rat duodenal mucosal bicarbonate secretion. Am J Physiol 271(5 Pt
1): G831–40.
138
Larsson KP, Akerman KE, Magga J, Uotila S, Kukkonen JP, Nasman J & Herzig KH
(2003) The STC-1 cells express functional orexin-A receptors coupled to CCK release.
Biochem Biophys Res Commun 309(1): 209–16.
Larsson KP, Peltonen HM, Bart G, Louhivuori LM, Penttonen A, Antikainen M,
Kukkonen JP & Akerman KE (2005) Orexin-A-induced Ca2+ entry: evidence for
involvement of trpc channels and protein kinase C regulation. J Biol Chem 280(3):
1771–81.
Lawrence AJ, Cowen MS, Yang HJ, Chen F & Oldfield B (2006) The orexin system
regulates alcohol-seeking in rats. Br J Pharmacol 148(6): 752–9.
de Lecea L, Kilduff TS, Peyron C, Gao X, Foye PE, Danielson PE, Fukuhara C,
Battenberg EL, Gautvik VT, Bartlett FS, 2nd, Frankel WN, van den Pol AN, Bloom
FE, Gautvik KM & Sutcliffe JG (1998) The hypocretins: hypothalamus-specific
peptides with neuroexcitatory activity. Proc Natl Acad Sci USA 95(1): 322–7.
de Lecea L & Sutcliffe JG (2005) The hypocretins and sleep. FEBS J 272(22): 5675–88.
Lee JH, Bang E, Chae KJ, Kim JY, Lee DW & Lee W (1999) Solution structure of a new
hypothalamic neuropeptide, human hypocretin-2/orexin-B. Eur J Biochem 266(3):
831–9.
Lee MG, Hassani OK & Jones BE (2005) Discharge of identified orexin/hypocretin
neurons across the sleep-waking cycle. J Neurosci 25(28): 6716–20.
Lenz HJ (1989) Regulation of duodenal bicarbonate secretion during stress by
corticotropin-releasing factor and beta-endorphin. Proc Natl Acad Sci USA 86(4):
1417–20.
Lenz HJ, Vale WW & Rivier JE (1989) TRH-induced vagal stimulation of duodenal HCO3 mediated by VIP and muscarinic pathways. Am J Physiol 257(5 Pt 1): G677–82.
Leppaluoto J, Paakkonen T, Korhonen I & Hassi J (2005) Pituitary and autonomic
responses to cold exposures in man. Acta Physiol Scand 184(4): 255–64.
Li Y & van den Pol AN (2006) Differential target-dependent actions of coexpressed
inhibitory dynorphin and excitatory hypocretin/orexin neuropeptides. J Neurosci
26(50): 13037–47.
Lin L, Faraco J, Li R, Kadotani H, Rogers W, Lin X, Qiu X, de Jong PJ, Nishino S &
Mignot E (1999) The sleep disorder canine narcolepsy is caused by a mutation in the
hypocretin (orexin) receptor 2 gene. Cell 98(3): 365–76.
Liu RJ, van den Pol AN & Aghajanian GK (2002) Hypocretins (orexins) regulate serotonin
neurons in the dorsal raphe nucleus by excitatory direct and inhibitory indirect actions.
J Neurosci 22(21): 9453–64.
Liu X, Rossmeisl M, McClaine J, Riachi M, Harper ME & Kozak LP (2003) Paradoxical
resistance to diet-induced obesity in UCP1-deficient mice. J Clin Invest 111(3): 399–
407.
Liu ZW & Gao XB (2007) Adenosine inhibits activity of hypocretin/orexin neurons by the
A1 receptor in the lateral hypothalamus: a possible sleep-promoting effect. J
Neurophysiol 97(1): 837–48.
139
Lopez M, Lage R, Tung YC, Challis BG, Varela L, Virtue S, O'Rahilly S, Vidal-Puig A,
Dieguez C & Coll AP (2007) Orexin expression is regulated by alpha-melanocytestimulating hormone. J Neuroendocrinol 19(9): 703–7.
Lopez M, Senaris R, Gallego R, Garcia-Caballero T, Lago F, Seoane L, Casanueva F &
Dieguez C (1999) Orexin receptors are expressed in the adrenal medulla of the rat.
Endocrinology 140(12): 5991–4.
Lopez M, Seoane LM, Tovar S, Nogueiras R, Dieguez C & Senaris R (2004) Orexin-A
regulates growth hormone-releasing hormone mRNA content in a nucleus-specific
manner and somatostatin mRNA content in a growth hormone-dependent fashion in
the rat hypothalamus. Eur J Neurosci 19(8): 2080–8.
Lowell BB & Spiegelman BM (2000) Towards a molecular understanding of adaptive
thermogenesis. Nature 404(6778): 652–60.
Lu J, Greco MA, Shiromani P & Saper CB (2000a) Effect of lesions of the ventrolateral
preoptic nucleus on NREM and REM sleep. J Neurosci 20(10): 3830–42.
Lu J, Sherman D, Devor M & Saper CB (2006) A putative flip-flop switch for control of
REM sleep. Nature 441(7093): 589–94.
Lu XY, Bagnol D, Burke S, Akil H & Watson SJ (2000b) Differential distribution and
regulation of OX1 and OX2 orexin/hypocretin receptor messenger RNA in the brain
upon fasting. Horm Behav 37(4): 335–44.
Lubkin M & Stricker-Krongrad A (1998) Independent feeding and metabolic actions of
orexins in mice. Biochem Biophys Res Commun 253(2): 241–5.
Lund PE, Shariatmadari R, Uustare A, Detheux M, Parmentier M, Kukkonen JP &
Akerman KE (2000) The orexin OX1 receptor activates a novel Ca2+ influx pathway
necessary for coupling to phospholipase C. J Biol Chem 275(40): 30806–12.
Ma X, Zubcevic L, Bruning JC, Ashcroft FM & Burdakov D (2007) Electrical inhibition of
identified anorexigenic POMC neurons by orexin/hypocretin. J Neurosci 27(7): 1529–
33.
Malendowicz LK, Hochol A, Ziolkowska A, Nowak M, Gottardo L & Nussdorfer GG
(2001) Prolonged orexin administration stimulates steroid-hormone secretion, acting
directly on the rat adrenal gland. Int J Mol Med 7(4): 401–4.
Malendowicz LK, Tortorella C & Nussdorfer GG (1999) Orexins stimulate corticosterone
secretion of rat adrenocortical cells, through the activation of the adenylate cyclasedependent signaling cascade. J Steroid Biochem Mol Biol 70(4–6): 185–8.
Mao W, Yu XX, Zhong A, Li W, Brush J, Sherwood SW, Adams SH & Pan G (1999)
UCP4, a novel brain-specific mitochondrial protein that reduces membrane potential
in mammalian cells. FEBS Lett 443(3): 326–30.
Marston OJ, Williams RH, Canal MM, Samuels RE, Upton N & Piggins HD (2008)
Circadian and dark-pulse activation of orexin/hypocretin neurons. Mol Brain 1(1): 19.
Martinez GS, Smale L & Nunez AA (2002) Diurnal and nocturnal rodents show rhythms
in orexinergic neurons. Brain Res 955(1–2): 1–7.
Masaki T, Yoshimatsu H, Chiba S & Sakata T (2000) Impaired response of UCP family to
cold exposure in diabetic (db/db) mice. Am J Physiol Regul Integr Comp Physiol
279(4): R1305–9.
140
Matsumura K, Tsuchihashi T & Abe I (2001) Central orexin-A augments sympathoadrenal
outflow in conscious rabbits. Hypertension 37(6): 1382–7.
Matsuo K, Kaibara M, Uezono Y, Hayashi H, Taniyama K & Nakane Y (2002)
Involvement of cholinergic neurons in orexin-induced contraction of guinea pig ileum.
Eur J Pharmacol 452(1): 105–9.
Mazzocchi G, Malendowicz LK, Aragona F, Rebuffat P, Gottardo L & Nussdorfer GG
(2001a) Human pheochromocytomas express orexin receptor type 2 gene and display
an in vitro secretory response to orexins A and B. J Clin Endocrinol Metab 86(10):
4818–21.
Mazzocchi G, Malendowicz LK, Gottardo L, Aragona F & Nussdorfer GG (2001b) Orexin
A stimulates cortisol secretion from human adrenocortical cells through activation of
the adenylate cyclase-dependent signaling cascade. J Clin Endocrinol Metab 86(2):
778–82.
McCarley RW (2007) Neurobiology of REM and NREM sleep. Sleep Med 8(4): 302–30.
McGranaghan PA & Piggins HD (2001) Orexin A-like immunoreactivity in the
hypothalamus and thalamus of the Syrian hamster (Mesocricetus auratus) and Siberian
hamster (Phodopus sungorus), with special reference to circadian structures. Brain
Res 904(2): 234–44.
Mieda M, Williams SC, Richardson JA, Tanaka K & Yanagisawa M (2006a) The
dorsomedial hypothalamic nucleus as a putative food-entrainable circadian pacemaker.
Proc Natl Acad Sci USA 103(32): 12150–5.
Mieda M, Williams SC, Sinton CM, Richardson JA, Sakurai T & Yanagisawa M (2004a)
Orexin neurons function in an efferent pathway of a food-entrainable circadian
oscillator in eliciting food-anticipatory activity and wakefulness. J Neurosci 24(46):
10493–501.
Mieda M, Willie J & Sakurai T (2006b) Genetic Rescue of Narcoleptic Mice. In: Nishino S
& Sakurai T (eds) Orexin/Hypocretin System: Physiology and Pathophysiology.
Totowa, New Jersey, Humana Press, p 365.
Mieda M, Willie JT, Hara J, Sinton CM, Sakurai T & Yanagisawa M (2004b) Orexin
peptides prevent cataplexy and improve wakefulness in an orexin neuron-ablated
model of narcolepsy in mice. Proc Natl Acad Sci USA 101(13): 4649–54.
Mignot E, Hayduk R, Black J, Grumet FC & Guilleminault C (1997) HLA DQB1*0602 is
associated with cataplexy in 509 narcoleptic patients. Sleep 20(11): 1012–20.
Mignot E, Lin L, Rogers W, Honda Y, Qiu X, Lin X, Okun M, Hohjoh H, Miki T, Hsu S,
Leffell M, Grumet F, Fernandez-Vina M, Honda M & Risch N (2001) Complex HLADR and -DQ interactions confer risk of narcolepsy-cataplexy in three ethnic groups.
Am J Hum Genet 68(3): 686–99.
de Miguel MJ & Burrell MA (2002) Immunocytochemical detection of orexin A in
endocrine cells of the developing mouse gut. J Histochem Cytochem 50(1): 63–9.
Mills EM, Banks ML, Sprague JE & Finkel T (2003) Pharmacology: uncoupling the agony
from ecstasy. Nature 426(6965): 403–4.
141
Miskolzie M, Lucyk S & Kotovych G (2003) NMR conformational studies of micellebound orexin-B: a neuropeptide involved in the sleep/awake cycle and feeding
regulation. J Biomol Struct Dyn 21(3): 341–51.
Mistlberger RE (2005) Circadian regulation of sleep in mammals: role of the
suprachiasmatic nucleus. Brain Res Brain Res Rev 49(3): 429–54.
Mistlberger RE (2009) Food-anticipatory circadian rhythms: concepts and methods. Eur J
Neurosci 30(9): 1718–29.
Mistlberger RE, Bergmann BM & Rechtschaffen A (1987) Relationships among wake
episode lengths, contiguous sleep episode lengths, and electroencephalographic delta
waves in rats with suprachiasmatic nuclei lesions. Sleep 10(1): 12–24.
Mistlberger RE & Skene DJ (2005) Nonphotic entrainment in humans? J Biol Rhythms
20(4): 339–52.
Mitsuma T, Hirooka Y, Kayama M, Mori Y, Yokoi Y, Rhue N, Ping J, Izumi M, Ikai R,
Adachi K & Nogimori T (2000a) Radioimmunoassay for orexin A. Life Sci 66(10):
897–904.
Mitsuma T, Hirooka Y, Kayma M, Mori Y, Yokoi Y, Izumi M, Rhue N, Ping J, Adachi K,
Ikai R, Kawai N, Nakayashiki A & Nogimori T (2000b) Radioimmunoassay for
hypocretin-2. Endocr Regul 34(1): 23–7.
Miyasaka K, Masuda M, Kanai S, Sato N, Kurosawa M & Funakoshi A (2002) Central
Orexin-A stimulates pancreatic exocrine secretion via the vagus. Pancreas 25(4): 400–
4.
Mochizuki T, Crocker A, McCormack S, Yanagisawa M, Sakurai T & Scammell TE (2004)
Behavioral state instability in orexin knock-out mice. J Neurosci 24(28): 6291–300.
Mochizuki T, Klerman EB, Sakurai T & Scammell TE (2006) Elevated body temperature
during sleep in orexin knockout mice. Am J Physiol Regul Integr Comp Physiol
291(3): R533–40.
Moreno G, Perello M, Gaillard RC & Spinedi E (2005) Orexin a stimulates hypothalamicpituitary-adrenal (HPA) axis function, but not food intake, in the absence of full
hypothalamic NPY-ergic activity. Endocrine 26(2): 99–106.
Morrison SF, Nakamura K & Madden CJ (2008) Central control of thermogenesis in
mammals. Exp Physiol 93(7): 773–97.
Mrosovsky N (1996) Locomotor activity and non-photic influences on circadian clocks.
Biol Rev Camb Philos Soc 71(3): 343–72.
Murillo-Rodriguez E, Liu M, Blanco-Centurion C & Shiromani PJ (2008) Effects of
hypocretin (orexin) neuronal loss on sleep and extracellular adenosine levels in the rat
basal forebrain. Eur J Neurosci 28(6): 1191–8.
Muroya S, Funahashi H, Yamanaka A, Kohno D, Uramura K, Nambu T, Shibahara M,
Kuramochi M, Takigawa M, Yanagisawa M, Sakurai T, Shioda S & Yada T (2004)
Orexins (hypocretins) directly interact with neuropeptide Y, POMC and glucoseresponsive neurons to regulate Ca2+ signaling in a reciprocal manner to leptin:
orexigenic neuronal pathways in the mediobasal hypothalamus. Eur J Neurosci 19(6):
1524–34.
142
Nakabayashi M, Suzuki T, Takahashi K, Totsune K, Muramatsu Y, Kaneko C, Date F,
Takeyama J, Darnel AD, Moriya T & Sasano H (2003) Orexin-A expression in human
peripheral tissues. Mol Cell Endocrinol 205(1–2): 43–50.
Nambu T, Sakurai T, Mizukami K, Hosoya Y, Yanagisawa M & Goto K (1999)
Distribution of orexin neurons in the adult rat brain. Brain Res 827(1–2): 243–60.
Nanmoku T, Isobe K, Sakurai T, Yamanaka A, Takekoshi K, Kawakami Y, Goto K &
Nakai T (2002) Effects of orexin on cultured porcine adrenal medullary and cortex
cells. Regul Pept 104(1–3): 125–30.
Nanmoku T, Isobe K, Sakurai T, Yamanaka A, Takekoshi K, Kawakami Y, Ishii K, Goto
K & Nakai T (2000) Orexins suppress catecholamine synthesis and secretion in
cultured PC12 cells. Biochem Biophys Res Commun 274(2): 310–5.
Naqvi NH, Rudrauf D, Damasio H & Bechara A (2007) Damage to the insula disrupts
addiction to cigarette smoking. Science 315(5811): 531–4.
Narita M, Nagumo Y, Hashimoto S, Narita M, Khotib J, Miyatake M, Sakurai T,
Yanagisawa M, Nakamachi T, Shioda S & Suzuki T (2006) Direct involvement of
orexinergic systems in the activation of the mesolimbic dopamine pathway and related
behaviors induced by morphine. J Neurosci 26(2): 398–405.
Naslund E, Ehrstrom M, Ma J, Hellstrom PM & Kirchgessner AL (2002) Localization and
effects of orexin on fasting motility in the rat duodenum. Am J Physiol Gastrointest
Liver Physiol 282(3): G470–9.
Nau K, Fromme T, Meyer CW, von Praun C, Heldmaier G & Klingenspor M (2008)
Brown adipose tissue specific lack of uncoupling protein 3 is associated with impaired
cold tolerance and reduced transcript levels of metabolic genes. J Comp Physiol B
178(3): 269–77.
Nedergaard J, Bengtsson T & Cannon B (2007) Unexpected evidence for active brown
adipose tissue in adult humans. Am J Physiol Endocrinol Metab 293(2): E444–52.
Nedergaard J & Cannon B (2003) The 'novel' 'uncoupling' proteins UCP2 and UCP3: what
do they really do? Pros and cons for suggested functions. Exp Physiol 88(1): 65–84.
Neubauer DN (2010) Almorexant, a dual orexin receptor antagonist for the treatment of
insomnia. Curr Opin Investig Drugs 11(1): 101–10.
Nilaweera KN, Barrett P, Mercer JG & Morgan PJ (2003) Precursor-protein convertase 1
gene expression in the mouse hypothalamus: differential regulation by ob gene
mutation, energy deficit and administration of leptin, and coexpression with preproorexin. Neuroscience 119(3): 713–20.
Nishino S, Ripley B, Overeem S, Lammers GJ & Mignot E (2000) Hypocretin (orexin)
deficiency in human narcolepsy. Lancet 355(9197): 39–40.
Novak CM & Levine JA (2009) Daily intraparaventricular orexin-A treatment induces
weight loss in rats. Obesity (Silver Spring) 17(8): 1493–8.
Nowak KW, Mackowiak P, Switonska MM, Fabis M & Malendowicz LK (2000) Acute
orexin effects on insulin secretion in the rat: in vivo and in vitro studies. Life Sci 66(5):
449–54.
143
Nowak KW, Strowski MZ, Switonska MM, Kaczmarek P, Singh V, Fabis M, Mackowiak
P, Nowak M & Malendowicz LK (2005) Evidence that orexins A and B stimulate
insulin secretion from rat pancreatic islets via both receptor subtypes. Int J Mol Med
15(6): 969–72.
Nylander O, Flemstrom G, Delbro D & Fandriks L (1987) Vagal influence on
gastroduodenal HCO3- secretion in the cat in vivo. Am J Physiol 252(4 Pt 1): G522–8.
Okumura T, Takeuchi S, Motomura W, Yamada H, Egashira Si S, Asahi S, Kanatani A,
Ihara M & Kohgo Y (2001) Requirement of intact disulfide bonds in orexin-Ainduced stimulation of gastric acid secretion that is mediated by OX1 receptor
activation. Biochem Biophys Res Commun 280(4): 976–81.
de Oliveira CV, Rosas-Arellano MP, Solano-Flores LP & Ciriello J (2003) Cardiovascular
effects of hypocretin-1 in nucleus of the solitary tract. Am J Physiol Heart Circ
Physiol 284(4): H1369–77.
Ouedraogo R, Naslund E & Kirchgessner AL (2003) Glucose regulates the release of
orexin-a from the endocrine pancreas. Diabetes 52(1): 111–7.
Panula P (2010) Hypocretin/orexin in fish physiology with emphasis on zebrafish. Acta
Physiol (Oxf) 198(3): 381–6.
Pappenheimer JR (1998) Scaling of dimensions of small intestines in non-ruminant
eutherian mammals and its significance for absorptive mechanisms. Comp Biochem
Physiol A Mol Integr Physiol 121(1): 45–58.
Pecqueur C, Alves-Guerra MC, Gelly C, Levi-Meyrueis C, Couplan E, Collins S, Ricquier
D, Bouillaud F & Miroux B (2001) Uncoupling protein 2, in vivo distribution,
induction upon oxidative stress, and evidence for translational regulation. J Biol Chem
276(12): 8705–12.
Pelin Z, Guilleminault C, Risch N, Grumet FC & Mignot E (1998) HLA-DQB1*0602
homozygosity increases relative risk for narcolepsy but not disease severity in two
ethnic groups. US Modafinil in Narcolepsy Multicenter Study Group. Tissue Antigens
51(1): 96–100.
Peyron C, Faraco J, Rogers W, Ripley B, Overeem S, Charnay Y, Nevsimalova S, Aldrich
M, Reynolds D, Albin R, Li R, Hungs M, Pedrazzoli M, Padigaru M, Kucherlapati M,
Fan J, Maki R, Lammers GJ, Bouras C, Kucherlapati R, Nishino S & Mignot E (2000)
A mutation in a case of early onset narcolepsy and a generalized absence of
hypocretin peptides in human narcoleptic brains. Nat Med 6(9): 991–7.
Peyron C, Tighe DK, van den Pol AN, de Lecea L, Heller HC, Sutcliffe JG & Kilduff TS
(1998) Neurons containing hypocretin (orexin) project to multiple neuronal systems. J
Neurosci 18(23): 9996–10015.
Piper DC, Upton N, Smith MI & Hunter AJ (2000) The novel brain neuropeptide, orexin-A,
modulates the sleep-wake cycle of rats. Eur J Neurosci 12(2): 726–30.
van den Pol AN (1999) Hypothalamic hypocretin (orexin): robust innervation of the spinal
cord. J Neurosci 19(8): 3171–82.
van den Pol AN, Gao XB, Obrietan K, Kilduff TS & Belousov AB (1998) Presynaptic and
postsynaptic actions and modulation of neuroendocrine neurons by a new
hypothalamic peptide, hypocretin/orexin. J Neurosci 18(19): 7962–71.
144
van den Pol AN, Patrylo PR, Ghosh PK & Gao XB (2001) Lateral hypothalamus: early
developmental expression and response to hypocretin (orexin). J Comp Neurol 433(3):
349–63.
Porkka-Heiskanen T, Alanko L, Kalinchuk A, Heiskanen S & Stenberg D (2004) The
effect of age on prepro-orexin gene expression and contents of orexin A and B in the
rat brain. Neurobiol Aging 25(2): 231–8.
Porkka-Heiskanen T, Strecker RE, Thakkar M, Bjorkum AA, Greene RW & McCarley
RW (1997) Adenosine: a mediator of the sleep-inducing effects of prolonged
wakefulness. Science 276(5316): 1265–8.
Prober DA, Rihel J, Onah AA, Sung RJ & Schier AF (2006) Hypocretin/orexin
overexpression induces an insomnia-like phenotype in zebrafish. J Neurosci 26(51):
13400–10.
Radulovacki M, Virus RM, Djuricic-Nedelson M & Green RD (1984) Adenosine analogs
and sleep in rats. J Pharmacol Exp Ther 228(2): 268–74.
Ramanjaneya M, Conner AC, Chen J, Kumar P, Brown JE, Johren O, Lehnert H, Stanfield
PR & Randeva HS (2009) Orexin-stimulated MAP kinase cascades are activated
through multiple G-protein signalling pathways in human H295R adrenocortical cells:
diverse roles for orexins A and B. J Endocrinol 202(2): 249–61.
Ramsey JJ, Kemnitz JW, Newton W, Hagopian K, Patterson TA & Swick AG (2005) Food
intake in rhesus monkeys following central administration of orexins. Regul Pept
124(1–3): 209–14.
Randeva HS, Karteris E, Grammatopoulos D & Hillhouse EW (2001) Expression of
orexin-A and functional orexin type 2 receptors in the human adult adrenals:
implications for adrenal function and energy homeostasis. J Clin Endocrinol Metab
86(10): 4808–13.
Reti IM, Reddy R, Worley PF & Baraban JM (2002) Selective expression of Narp, a
secreted neuronal pentraxin, in orexin neurons. J Neurochem 82(6): 1561–5.
Richards JK, Simms JA, Steensland P, Taha SA, Borgland SL, Bonci A & Bartlett SE
(2008) Inhibition of orexin-1/hypocretin-1 receptors inhibits yohimbine-induced
reinstatement of ethanol and sucrose seeking in Long-Evans rats.
Psychopharmacology (Berl) 199(1): 109–17.
Ripley B, Overeem S, Fujiki N, Nevsimalova S, Uchino M, Yesavage J, Di Monte D, Dohi
K, Melberg A, Lammers GJ, Nishida Y, Roelandse FW, Hungs M, Mignot E &
Nishino S (2001) CSF hypocretin/orexin levels in narcolepsy and other neurological
conditions. Neurology 57(12): 2253–8.
Ritchie C, Okuro M, Kanbayashi T & Nishino S (2010) Hypocretin ligand deficiency in
narcolepsy: recent basic and clinical insights. Curr Neurol Neurosci Rep 10(3): 180–9.
Roecker AJ & Coleman PJ (2008) Orexin receptor antagonists: medicinal chemistry and
therapeutic potential. Curr Top Med Chem 8(11): 977–87.
Russell SH, Small CJ, Sunter D, Morgan I, Dakin CL, Cohen MA & Bloom SR (2002)
Chronic intraparaventricular nuclear administration of orexin A in male rats does not
alter thyroid axis or uncoupling protein-1 in brown adipose tissue. Regul Pept 104(1–
3): 61–8.
145
Safsten B, Jedstedt G & Flemstrom G (1991) Effects of diazepam and Ro 15–1788 on
duodenal bicarbonate secretion in the rat. Gastroenterology 101(4): 1031–8.
Safsten B, Sjoblom M & Flemstrom G (2006) Serotonin increases protective duodenal
bicarbonate secretion via enteric ganglia and a 5-HT4-dependent pathway. Scand J
Gastroenterol 41(11): 1279–89.
Sakurai T, Amemiya A, Ishii M, Matsuzaki I, Chemelli RM, Tanaka H, Williams SC,
Richardson JA, Kozlowski GP, Wilson S, Arch JR, Buckingham RE, Haynes AC,
Carr SA, Annan RS, McNulty DE, Liu WS, Terrett JA, Elshourbagy NA, Bergsma DJ
& Yanagisawa M (1998) Orexins and orexin receptors: a family of hypothalamic
neuropeptides and G protein-coupled receptors that regulate feeding behavior. Cell
92(4): 573–85.
Sakurai T, Moriguchi T, Furuya K, Kajiwara N, Nakamura T, Yanagisawa M & Goto K
(1999) Structure and function of human prepro-orexin gene. J Biol Chem 274(25):
17771–6.
Sakurai T, Nagata R, Yamanaka A, Kawamura H, Tsujino N, Muraki Y, Kageyama H,
Kunita S, Takahashi S, Goto K, Koyama Y, Shioda S & Yanagisawa M (2005) Input
of orexin/hypocretin neurons revealed by a genetically encoded tracer in mice. Neuron
46(2): 297–308.
Salopuro T, Pulkkinen L, Lindstrom J, Kolehmainen M, Tolppanen AM, Eriksson JG,
Valle TT, Aunola S, Ilanne-Parikka P, Keinanen-Kiukaanniemi S, Tuomilehto J,
Laakso M & Uusitupa M (2009) Variation in the UCP2 and UCP3 genes associates
with abdominal obesity and serum lipids: the Finnish Diabetes Prevention Study.
BMC Med Genet 10: 94.
Samson WK, Gosnell B, Chang JK, Resch ZT & Murphy TC (1999) Cardiovascular
regulatory actions of the hypocretins in brain. Brain Res 831(1–2): 248–53.
Sanchis D, Fleury C, Chomiki N, Goubern M, Huang Q, Neverova M, Gregoire F, Easlick
J, Raimbault S, Levi-Meyrueis C, Miroux B, Collins S, Seldin M, Richard D, Warden
C, Bouillaud F & Ricquier D (1998) BMCP1, a novel mitochondrial carrier with high
expression in the central nervous system of humans and rodents, and respiration
uncoupling activity in recombinant yeast. J Biol Chem 273(51): 34611–5.
Saper CB, Chou TC & Scammell TE (2001) The sleep switch: hypothalamic control of
sleep and wakefulness. Trends Neurosci 24(12): 726–31.
Satoh N, Ogawa Y, Katsuura G, Numata Y, Masuzaki H, Yoshimasa Y & Nakao K (1998)
Satiety effect and sympathetic activation of leptin are mediated by hypothalamic
melanocortin system. Neurosci Lett 249(2–3): 107–10.
Satoh S, Matsumura H, Kanbayashi T, Yoshida Y, Urakami T, Nakajima T, Kimura N,
Nishino S & Yoneda H (2006a) Expression pattern of FOS in orexin neurons during
sleep induced by an adenosine A2A receptor agonist. Behav Brain Res 170(2): 277–
86.
Satoh Y, Okishio Y, Azuma YT, Nakajima H, Hata F & Takeuchi T (2006b) Orexin A
affects ascending contraction depending on downstream cholinergic neurons and
descending relaxation through independent pathways in mouse jejunum.
Neuropharmacology 51(3): 466–73.
146
Satoh Y, Uchida M, Fujita A, Nishio H, Takeuchi T & Hata F (2001) Possible role of
orexin A in nonadrenergic, noncholinergic inhibitory response of muscle of the mouse
small intestine. Eur J Pharmacol 428(3): 337–42.
Scarpace PJ, Matheny M, Pollock BH & Tumer N (1997) Leptin increases uncoupling
protein expression and energy expenditure. Am J Physiol 273(1 Pt 1): E226–30.
Schagger H (2006) Tricine-SDS-PAGE. Nat Protoc 1(1): 16–22.
Schmittgen TD & Zakrajsek BA (2000) Effect of experimental treatment on housekeeping
gene expression: validation by real-time, quantitative RT-PCR. J Biochem Biophys
Methods 46(1–2): 69–81.
Schneider ER, Rada P, Darby RD, Leibowitz SF & Hoebel BG (2007) Orexigenic peptides
and alcohol intake: differential effects of orexin, galanin, and ghrelin. Alcohol Clin
Exp Res 31(11): 1858–65.
Schwartz MW, Woods SC, Porte D, Jr., Seeley RJ & Baskin DG (2000) Central nervous
system control of food intake. Nature 404(6778): 661–71.
Semple RK, Crowley VC, Sewter CP, Laudes M, Christodoulides C, Considine RV, VidalPuig A & O'Rahilly S (2004) Expression of the thermogenic nuclear hormone receptor
coactivator PGC-1alpha is reduced in the adipose tissue of morbidly obese subjects.
Int J Obes Relat Metab Disord 28(1): 176–9.
Seoane LM, Tovar SA, Perez D, Mallo F, Lopez M, Senaris R, Casanueva FF & Dieguez
C (2004) Orexin A suppresses in vivo GH secretion. Eur J Endocrinol 150(5): 731–6.
Shariatmadari R, Lund PE, Krijukova E, Sperber GO, Kukkonen JP & Akerman KE (2001)
Reconstitution of neurotransmission by determining communication between
differentiated PC12 pheochromocytoma and HEL 92.1.7 erythroleukemia cells.
Pflugers Arch 442(2): 312–20.
Sherin JE, Shiromani PJ, McCarley RW & Saper CB (1996) Activation of ventrolateral
preoptic neurons during sleep. Science 271(5246): 216–9.
Shirasaka T, Nakazato M, Matsukura S, Takasaki M & Kannan H (1999) Sympathetic and
cardiovascular actions of orexins in conscious rats. Am J Physiol 277(6 Pt 2): R1780–
5.
Silveyra P, Cataldi NI, Lux-Lantos V & Libertun C (2009) Gonadal steroids modulated
hypocretin/orexin type-1 receptor expression in a brain region, sex and daytime
specific manner. Regul Pept 158(1–3): 121–6.
Silveyra P, Lux-Lantos V & Libertun C (2007) Both orexin receptors are expressed in rat
ovaries and fluctuate with the estrous cycle: effects of orexin receptor antagonists on
gonadotropins and ovulation. Am J Physiol Endocrinol Metab 293(4): E977–85.
Simpson KA, Martin NM & Bloom SR (2009) Hypothalamic regulation of food intake and
clinical therapeutic applications. Arq Bras Endocrinol Metabol 53(2): 120–8.
Sjoblom M & Flemstrom G (2003) Melatonin in the duodenal lumen is a potent stimulant
of mucosal bicarbonate secretion. J Pineal Res 34(4): 288–93.
Sjoblom M, Jedstedt G & Flemstrom G (2001) Peripheral melatonin mediates neural
stimulation of duodenal mucosal bicarbonate secretion. J Clin Invest 108(4): 625–33.
147
Sjoblom M, Safsten B & Flemstrom G (2003) Melatonin-induced calcium signaling in
clusters of human and rat duodenal enterocytes. Am J Physiol Gastrointest Liver
Physiol 284(6): G1034–44.
Smart D, Sabido-David C, Brough SJ, Jewitt F, Johns A, Porter RA & Jerman JC (2001)
SB-334867-A: the first selective orexin-1 receptor antagonist. Br J Pharmacol 132(6):
1179–82.
Smedfors B & Johansson C (1986) Cholinergic influence on duodenal bicarbonate
response to hydrochloric acid perfusion in the conscious rat. Scand J Gastroenterol
21(7): 809–15.
Smith AJ, Chappell AE, Buret AG, Barrett KE & Dong H (2006) 5-Hydroxytryptamine
contributes significantly to a reflex pathway by which the duodenal mucosa protects
itself from gastric acid injury. FASEB J 20(14): 2486–95.
Smith PM, Connolly BC & Ferguson AV (2002) Microinjection of orexin into the rat
nucleus tractus solitarius causes increases in blood pressure. Brain Res 950(1–2):
261–7.
Smith PM, Samson WK & Ferguson AV (2007) Cardiovascular actions of orexin-A in the
rat subfornical organ. J Neuroendocrinol 19(1): 7–13.
Spinazzi R, Rucinski M, Neri G, Malendowicz LK & Nussdorfer GG (2005) Preproorexin
and orexin receptors are expressed in cortisol-secreting adrenocortical adenomas, and
orexins stimulate in vitro cortisol secretion and growth of tumor cells. J Clin
Endocrinol Metab 90(6): 3544–9.
Srivastava N, Prakash J, Lakhan R, Agarwal CG, Pant DC & Mittal B (2010) A common
polymorphism in the promoter of UCP2 is associated with obesity and
hyperinsulenemia in northern Indians. Mol Cell Biochem 337(1–2): 293–8.
Stanley S, Pinto S, Segal J, Perez CA, Viale A, DeFalco J, Cai X, Heisler LK & Friedman
JM (2010) Identification of neuronal subpopulations that project from hypothalamus
to both liver and adipose tissue polysynaptically. Proc Natl Acad Sci USA 107(15):
7024–9.
Steiger A (2002) Sleep cycle. In: Craighead EW & Nemeroff CB (eds) The Corsini
Encyclopedia of Psychology and Behavioral Science, Wiley 4, p 1538.
Steiger A (2007) Neurochemical regulation of sleep. J Psychiatr Res 41(7): 537–52.
Stenberg D, Litonius E, Halldner L, Johansson B, Fredholm BB & Porkka-Heiskanen T
(2003) Sleep and its homeostatic regulation in mice lacking the adenosine A1 receptor.
J Sleep Res 12(4): 283–90.
Stephan FK (2002) The "other" circadian system: food as a Zeitgeber. J Biol Rhythms
17(4): 284–92.
Stuart JA, Harper JA, Brindle KM, Jekabsons MB & Brand MD (2001) Physiological
levels of mammalian uncoupling protein 2 do not uncouple yeast mitochondria. J Biol
Chem 276(21): 18633–9.
Sugimoto T, Nagake Y, Sugimoto S, Akagi S, Ichikawa H, Nakamura Y, Ogawa N &
Makino H (2002) Plasma orexin concentrations in patients on hemodialysis. Nephron
90(4): 379–83.
148
Surendran S, Campbell GA, Tyring SK, Matalon K, McDonald JD & Matalon R (2003)
High levels of orexin A in the brain of the mouse model for phenylketonuria: possible
role of orexin A in hyperactivity seen in children with PKU. Neurochem Res 28(12):
1891–4.
Switonska MM, Kaczmarek P, Malendowicz LK & Nowak KW (2002) Orexins and
adipoinsular axis function in the rat. Regul Pept 104(1–3): 69–73.
Szymusiak R, Alam N, Steininger TL & McGinty D (1998) Sleep-waking discharge
patterns of ventrolateral preoptic/anterior hypothalamic neurons in rats. Brain Res
803(1–2): 178–88.
Taheri S, Sunter D, Dakin C, Moyes S, Seal L, Gardiner J, Rossi M, Ghatei M & Bloom S
(2000) Diurnal variation in orexin A immunoreactivity and prepro-orexin mRNA in
the rat central nervous system. Neurosci Lett 279(2): 109–12.
Takahashi K, Arihara Z, Suzuki T, Sone M, Kikuchi K, Sasano H, Murakami O & Totsune
K (2006) Expression of orexin-A and orexin receptors in the kidney and the presence
of orexin-A-like immunoreactivity in human urine. Peptides 27(4): 871–7.
Takahashi K, Koyama Y, Kayama Y & Yamamoto M (2002) Effects of orexin on the
laterodorsal tegmental neurones. Psychiatry Clin Neurosci 56(3): 335–6.
Takahashi N, Okumura T, Yamada H & Kohgo Y (1999) Stimulation of gastric acid
secretion by centrally administered orexin-A in conscious rats. Biochem Biophys Res
Commun 254(3): 623–7.
Takano S, Kanai S, Hosoya H, Ohta M, Uematsu H & Miyasaka K (2004) Orexin-A does
not stimulate food intake in old rats. Am J Physiol Gastrointest Liver Physiol 287(6):
G1182–7.
Takeuchi K, Ukawa H, Kato S, Furukawa O, Araki H, Sugimoto Y, Ichikawa A, Ushikubi
F & Narumiya S (1999) Impaired duodenal bicarbonate secretion and mucosal
integrity in mice lacking prostaglandin E-receptor subtype EP(3). Gastroenterology
117(5): 1128–35.
Takeuchi K, Yagi K, Kato S & Ukawa H (1997) Roles of prostaglandin E-receptor
subtypes in gastric and duodenal bicarbonate secretion in rats. Gastroenterology
113(5): 1553–9.
Tang J, Chen J, Ramanjaneya M, Punn A, Conner AC & Randeva HS (2008) The
signalling profile of recombinant human orexin-2 receptor. Cell Signal 20(9): 1651–
61.
Tanida M, Niijima A, Shen J, Yamada S, Sawai H, Fukuda Y & Nagai K (2006) Dosedifferent effects of orexin-A on the renal sympathetic nerve and blood pressure in
urethane-anesthetized rats. Exp Biol Med (Maywood) 231(10): 1616–25.
Tao R, Ma Z, McKenna JT, Thakkar MM, Winston S, Strecker RE & McCarley RW (2006)
Differential effect of orexins (hypocretins) on serotonin release in the dorsal and
median raphe nuclei of freely behaving rats. Neuroscience 141(3): 1101–5.
Terao A, Apte-Deshpande A, Morairty S, Freund YR & Kilduff TS (2002) Age-related
decline in hypocretin (orexin) receptor 2 messenger RNA levels in the mouse brain.
Neurosci Lett 332(3): 190–4.
149
Thakkar MM, Engemann SC, Walsh KM & Sahota PK (2008) Adenosine and the
homeostatic control of sleep: effects of A1 receptor blockade in the perifornical lateral
hypothalamus on sleep-wakefulness. Neuroscience 153(4): 875–80.
Thakkar MM, Ramesh V, Strecker RE & McCarley RW (2001) Microdialysis perfusion of
orexin-A in the basal forebrain increases wakefulness in freely behaving rats. Arch
Ital Biol 139(3): 313–28.
Thakkar MM, Winston S & McCarley RW (2002) Orexin neurons of the hypothalamus
express adenosine A1 receptors. Brain Res 944(1–2): 190–4.
Thannickal TC, Moore RY, Nienhuis R, Ramanathan L, Gulyani S, Aldrich M, Cornford
M & Siegel JM (2000) Reduced number of hypocretin neurons in human narcolepsy.
Neuron 27(3): 469–74.
Thorpe AJ & Kotz CM (2005) Orexin A in the nucleus accumbens stimulates feeding and
locomotor activity. Brain Res 1050(1–2): 156–62.
Tomasik PJ, Spodaryk M & Sztefko K (2004) Plasma concentrations of orexins in children.
Ann Nutr Metab 48(4): 215–20.
van den Top M, Lee K, Whyment AD, Blanks AM & Spanswick D (2004) Orexigensensitive NPY/AgRP pacemaker neurons in the hypothalamic arcuate nucleus. Nat
Neurosci 7(5): 493–4.
Toshinai K, Date Y, Murakami N, Shimada M, Mondal MS, Shimbara T, Guan JL, Wang
QP, Funahashi H, Sakurai T, Shioda S, Matsukura S, Kangawa K & Nakazato M
(2003) Ghrelin-induced food intake is mediated via the orexin pathway.
Endocrinology 144(4): 1506–12.
Trivedi P, Yu H, MacNeil DJ, Van der Ploeg LH & Guan XM (1998) Distribution of
orexin receptor mRNA in the rat brain. FEBS Lett 438(1–2): 71–5.
Tsubone T, Masaki T, Katsuragi I, Tanaka K, Kakuma T & Yoshimatsu H (2005) Ghrelin
regulates adiposity in white adipose tissue and UCP1 mRNA expression in brown
adipose tissue in mice. Regul Pept 130(1–2): 97–103.
Tsujino N & Sakurai T (2009) Orexin/hypocretin: a neuropeptide at the interface of sleep,
energy homeostasis, and reward system. Pharmacol Rev 61(2): 162–76.
Tsujino N, Yamanaka A, Ichiki K, Muraki Y, Kilduff TS, Yagami K, Takahashi S, Goto K
& Sakurai T (2005) Cholecystokinin activates orexin/hypocretin neurons through the
cholecystokinin A receptor. J Neurosci 25(32): 7459–69.
Tuo BG & Isenberg JI (2003) Effect of 5-hydroxytryptamine on duodenal mucosal
bicarbonate secretion in mice. Gastroenterology 125(3): 805–14.
Tuo BG, Sellers Z, Paulus P, Barrett KE & Isenberg JI (2004) 5-HT induces duodenal
mucosal bicarbonate secretion via cAMP- and Ca2+-dependent signaling pathways and
5-HT4 receptors in mice. Am J Physiol Gastrointest Liver Physiol 286(3): G444–51.
Turunen PM, Ekholm ME, Somerharju P & Kukkonen JP (2009) Arachidonic acid release
mediated by OX(1) orexin receptors. Br J Pharmacol.
Ukropec J, Anunciado RP, Ravussin Y, Hulver MW & Kozak LP (2006) UCP1independent thermogenesis in white adipose tissue of cold-acclimated Ucp1-/- mice. J
Biol Chem 281(42): 31894–908.
150
Uramura K, Funahashi H, Muroya S, Shioda S, Takigawa M & Yada T (2001) Orexin-a
activates phospholipase C- and protein kinase C-mediated Ca2+ signaling in dopamine
neurons of the ventral tegmental area. Neuroreport 12(9): 1885–9.
Wakamatsu H, Yoshinobu Y, Aida R, Moriya T, Akiyama M & Shibata S (2001)
Restricted-feeding-induced anticipatory activity rhythm is associated with a phaseshift of the expression of mPer1 and mPer2 mRNA in the cerebral cortex and
hippocampus but not in the suprachiasmatic nucleus of mice. Eur J Neurosci 13(6):
1190–6.
Vakkuri O, Rintamaki H & Leppaluoto J (1985) Presence of immunoreactive melatonin in
different tissues of the pigeon (Columba livia). Gen Comp Endocrinol 58(1): 69–75.
Valatx JL & Bugat R (1974) [Genetic factors as determinants of the waking-sleep cycle in
the mouse (author's transl)]. Brain Res 69(2): 315–30.
Walder K, Norman RA, Hanson RL, Schrauwen P, Neverova M, Jenkinson CP, Easlick J,
Warden CH, Pecqueur C, Raimbault S, Ricquier D, Silver MH, Shuldiner AR,
Solanes G, Lowell BB, Chung WK, Leibel RL, Pratley R & Ravussin E (1998)
Association between uncoupling protein polymorphisms (UCP2-UCP3) and energy
metabolism/obesity in Pima indians. Hum Mol Genet 7(9): 1431–5.
van De Parre TJ, Martinet W, Verheye S, Kockx MM, Van Langenhove G, Herman AG &
De Meyer GR (2008) Mitochondrial uncoupling protein 2 mediates temperature
heterogeneity in atherosclerotic plaques. Cardiovasc Res 77(2): 425–31.
Wang B, You ZB & Wise RA (2009) Reinstatement of cocaine seeking by hypocretin
(orexin) in the ventral tegmental area: independence from the local corticotropinreleasing factor network. Biol Psychiatry 65(10): 857–62.
Veasey SC, Yeou-Jey H, Thayer P & Fenik P (2004) Murine Multiple Sleep Latency Test:
phenotyping sleep propensity in mice. Sleep 27(3): 388–93.
Wenzel J, Grabinski N, Knopp CA, Dendorfer A, Ramanjaneya M, Randeva HS, EhrhartBornstein M, Dominiak P & Johren O (2009) Hypocretin/orexin increases the
expression of steroidogenic enzymes in human adrenocortical NCI H295R cells. Am J
Physiol Regul Integr Comp Physiol 297(5): R1601–9.
Verty AN, Allen AM & Oldfield BJ (2010) The Endogenous Actions of Hypothalamic
Peptides on Brown Adipose Tissue Thermogenesis in the Rat. Endocrinology.
Westerterp-Plantenga MS (2008) Protein intake and energy balance. Regul Pept 149(1–3):
67–9.
WHO (2010) Obesity. URI: http://www.who.int/topics/obesity/en/.
Vidal-Puig A, Solanes G, Grujic D, Flier JS & Lowell BB (1997) UCP3: an uncoupling
protein homologue expressed preferentially and abundantly in skeletal muscle and
brown adipose tissue. Biochem Biophys Res Commun 235(1): 79–82.
Vidal-Puig AJ, Grujic D, Zhang CY, Hagen T, Boss O, Ido Y, Szczepanik A, Wade J,
Mootha V, Cortright R, Muoio DM & Lowell BB (2000) Energy metabolism in
uncoupling protein 3 gene knockout mice. J Biol Chem 275(21): 16258–66.
Williams RS & Wagner PD (2000) Transgenic animals in integrative biology: approaches
and interpretations of outcome. J Appl Physiol 88(3): 1119–26.
151
Willie JT, Chemelli RM, Sinton CM, Tokita S, Williams SC, Kisanuki YY, Marcus JN,
Lee C, Elmquist JK, Kohlmeier KA, Leonard CS, Richardson JA, Hammer RE &
Yanagisawa M (2003) Distinct narcolepsy syndromes in Orexin receptor-2 and Orexin
null mice: molecular genetic dissection of Non-REM and REM sleep regulatory
processes. Neuron 38(5): 715–30.
Willie JT, Chemelli RM, Sinton CM & Yanagisawa M (2001) To eat or to sleep? Orexin in
the regulation of feeding and wakefulness. Annu Rev Neurosci 24: 429–58.
Xi MC, Morales FR & Chase MH (2001) Effects on sleep and wakefulness of the injection
of hypocretin-1 (orexin-A) into the laterodorsal tegmental nucleus of the cat. Brain
Res 901(1–2): 259–64.
Xie X, Crowder TL, Yamanaka A, Morairty SR, Lewinter RD, Sakurai T & Kilduff TS
(2006) GABA(B) receptor-mediated modulation of hypocretin/orexin neurones in
mouse hypothalamus. J Physiol 574(Pt 2): 399–414.
Yamada H, Okumura T, Motomura W, Kobayashi Y & Kohgo Y (2000) Inhibition of food
intake by central injection of anti-orexin antibody in fasted rats. Biochem Biophys Res
Commun 267(2): 527–31.
Yamanaka A, Beuckmann CT, Willie JT, Hara J, Tsujino N, Mieda M, Tominaga M,
Yagami K, Sugiyama F, Goto K, Yanagisawa M & Sakurai T (2003) Hypothalamic
orexin neurons regulate arousal according to energy balance in mice. Neuron 38(5):
701–13.
Yamanaka A, Kunii K, Nambu T, Tsujino N, Sakai A, Matsuzaki I, Miwa Y, Goto K &
Sakurai T (2000) Orexin-induced food intake involves neuropeptide Y pathway. Brain
Res 859(2): 404–9.
Yamanaka A, Sakurai T, Katsumoto T, Yanagisawa M & Goto K (1999) Chronic
intracerebroventricular administration of orexin-A to rats increases food intake in
daytime, but has no effect on body weight. Brain Res 849(1–2): 248–52.
Yamanaka A, Tsujino N, Funahashi H, Honda K, Guan JL, Wang QP, Tominaga M, Goto
K, Shioda S & Sakurai T (2002) Orexins activate histaminergic neurons via the orexin
2 receptor. Biochem Biophys Res Commun 290(4): 1237–45.
Yeung HW, Grewal RK, Gonen M, Schoder H & Larson SM (2003) Patterns of (18)FFDG uptake in adipose tissue and muscle: a potential source of false-positives for PET.
J Nucl Med 44(11): 1789–96.
Yokogawa T, Marin W, Faraco J, Pezeron G, Appelbaum L, Zhang J, Rosa F, Mourrain P
& Mignot E (2007) Characterization of sleep in zebrafish and insomnia in hypocretin
receptor mutants. PLoS Biol 5(10): e277.
Yoshida K, McCormack S, Espana RA, Crocker A & Scammell TE (2006) Afferents to the
orexin neurons of the rat brain. J Comp Neurol 494(5): 845–61.
Yoshida Y, Fujiki N, Nakajima T, Ripley B, Matsumura H, Yoneda H, Mignot E &
Nishino S (2001) Fluctuation of extracellular hypocretin-1 (orexin A) levels in the rat
in relation to the light-dark cycle and sleep-wake activities. Eur J Neurosci 14(7):
1075–81.
152
Yoshimichi G, Yoshimatsu H, Masaki T & Sakata T (2001) Orexin-A regulates body
temperature in coordination with arousal status. Exp Biol Med (Maywood) 226(5):
468–76.
Yu XX, Mao W, Zhong A, Schow P, Brush J, Sherwood SW, Adams SH & Pan G (2000)
Characterization of novel UCP5/BMCP1 isoforms and differential regulation of UCP4
and UCP5 expression through dietary or temperature manipulation. FASEB J 14(11):
1611–8.
Zhang S, Zeitzer JM, Sakurai T, Nishino S & Mignot E (2007) Sleep/wake fragmentation
disrupts metabolism in a mouse model of narcolepsy. J Physiol 581(Pt 2): 649–63.
Zhang S, Zeitzer JM, Yoshida Y, Wisor JP, Nishino S, Edgar DM & Mignot E (2004)
Lesions of the suprachiasmatic nucleus eliminate the daily rhythm of hypocretin-1
release. Sleep 27(4): 619–27.
Zhang W, Fukuda Y & Kuwaki T (2005) Respiratory and cardiovascular actions of orexinA in mice. Neurosci Lett 385(2): 131–6.
Zhang W, Sunanaga J, Takahashi Y, Mori T, Skurai T, Kanmura Y & Kuwaki T (2010)
Orexin neurons are indispensable for stress-induced thermogenesis in mice. J Physiol.
Zhang X, Renehan WE & Fogel R (2000) Vagal innervation of the rat duodenum. J Auton
Nerv Syst 79(1): 8–18.
Zheng H, Corkern M, Stoyanova I, Patterson LM, Tian R & Berthoud HR (2003) Peptides
that regulate food intake: appetite-inducing accumbens manipulation activates
hypothalamic orexin neurons and inhibits POMC neurons. Am J Physiol Regul Integr
Comp Physiol 284(6): R1436–44.
Zheng H, Patterson LM & Berthoud HR (2007) Orexin signaling in the ventral tegmental
area is required for high-fat appetite induced by opioid stimulation of the nucleus
accumbens. J Neurosci 27(41): 11075–82.
Zhou Y, Proudnikov D, Yuferov V & Kreek MJ (2010) Drug-induced and genetic
alterations in stress-responsive systems: Implications for specific addictive diseases.
Brain Res 1314: 235–52.
Zhu Y, Miwa Y, Yamanaka A, Yada T, Shibahara M, Abe Y, Sakurai T & Goto K (2003)
Orexin receptor type-1 couples exclusively to pertussis toxin-insensitive G-proteins,
while orexin receptor type-2 couples to both pertussis toxin-sensitive and -insensitive
G-proteins. J Pharmacol Sci 92(3): 259–66.
Zingaretti MC, Crosta F, Vitali A, Guerrieri M, Frontini A, Cannon B, Nedergaard J &
Cinti S (2009) The presence of UCP1 demonstrates that metabolically active adipose
tissue in the neck of adult humans truly represents brown adipose tissue. FASEB J
23(9): 3113–20.
Ziolkowska A, Spinazzi R, Albertin G, Nowak M, Malendowicz LK, Tortorella C &
Nussdorfer GG (2005) Orexins stimulate glucocorticoid secretion from cultured rat
and human adrenocortical cells, exclusively acting via the OX1 receptor. J Steroid
Biochem Mol Biol 96(5): 423–9.
153
154
Original publications
I
Mäkelä KA, Wigren HK, Zant JC, Sakurai T, Alhonen L, Kostin A, PorkkaHeiskanen T & Herzig KH (2010) Characterization of sleep-wake patterns in a novel
transgenic mouse line overexpressing human prepro-orexin/hypocretin. Acta Physiol
198(3): 237–249. DOI: 10.1111/j.1748-1716.2009.02068.x.
II Mäkelä KA, Kettunen TS, Kovalainen M, Markkula A, Åkerman KEO, Järvelin MR,
Saarela S, Alhonen L & Herzig KH Mice overexpressing human prepro-orexin have
increased heat production and a PPAR gamma dependent upregulation of UCP2 in
WAT. Manuscript.
III Bengtsson MW, Mäkelä K, Sjöblom M, Uotila S, Åkerman KEO, Herzig KH &
Flemström G (2007) Food-induced expression of orexin receptors in rat duodenal
mucosa regulates the bicarbonate secretory response to orexin-A. Am J Physiol
Gastrointest Liver Physiol 293(2): G501-G509. DOI: 10.1152/ajpgi.00514.2006.
IV Bengtsson MW, Mäkelä K, Herzig KH & Flemström G (2009) Short food deprivation
inhibits orexin receptor 1 expression and orexin-A induced intracellular calcium
signaling in acutely isolated duodenal enterocytes. Am J Physiol Gastrointest Liver
Physiol 296(3): G651-G658. DOI: 10.1152/ajpgi.90387.2008.
Reprinted with permissions from Acta Physiol (Oxf.) (I) and Am J Physiol
Gastrointest Liver Physiol (III, IV).
Original publications are not included in the electronic version of the dissertation.
155
156
ACTA UNIVERSITATIS OULUENSIS
SERIES D MEDICA
1070. Tanskanen, Päivikki (2010) Brain MRI in subjects with schizophrenia and in adults
born prematurely : the Northern Finland 1966 Birth Cohort Study
1071. Abass, Khaled M. (2010) Metabolism and interactions of pesticides in human and
animal in vitro hepatic models
1072. Luukkonen, Anu-Helmi (2010) Bullying behaviour in relation to psychiatric
disorders, suicidality and criminal offences : a study of under-age adolescent
inpatients in Northern Finland
1073. Ahola, Riikka (2010) Measurement of bone exercise : osteogenic features of
loading
1074. Krüger, Johanna (2010) Molecular genetics of early-onset Alzheimer's disease and
frontotemporal lobar degeneration
1075. Kinnunen, Urpo (2010) Blood culture findings during neutropenia in adult
patients with acute myeloid leukaemia : the influence of the phase of the disease,
chemotherapy and the blood culture systems
1076. Saarela, Ville (2010) Stereometric parameters of the Heidelberg Retina
Tomograph in the follow-up of glaucoma
1077. Reponen, Jarmo (2010) Teleradiology—changing radiological service processes
from local to regional, international and mobile environment
1078. Leskinen, Kaja (2010) Fissure sealants in caries prevention : a practice-based
study using survival analysis
1079. Hietasalo, Pauliina (2010) Behavioral and economic aspects of caries control
1080. Jääskeläinen, Minna (2010) Apoptosis-regulating factors in developing and adult
ovaries
1081. Alahuhta, Maija (2010) Tyypin 2 diabeteksen riskiryhmään kuuluvien työikäisten
henkilöiden painonhallinnan ja elintapamuutoksen tunnuspiirteitä
1082. Hurskainen, Merja (2010) The roles of collagens XV and XVIII in vessel
formation, the function of recombinant human full-length type XV collagen and
the roles of collagen XV and laminin ?α4 in peripheral nerve development and
function
1083. Rasi, Karolina (2010) Collagen XV as a matrix organizer : its function in the heart
and its role together with laminin α4 in peripheral nerves
1084. Korkiakangas, Eveliina (2010) Aikuisten liikuntamotivaatioon vaikuttavat tekijät
Book orders:
Granum: Virtual book store
http://granum.uta.fi/granum/
D 1085
OULU 2010
U N I V E R S I T Y O F O U L U P. O. B . 7 5 0 0 F I - 9 0 0 1 4 U N I V E R S I T Y O F O U L U F I N L A N D
U N I V E R S I TAT I S
S E R I E S
SCIENTIAE RERUM NATURALIUM
Professor Mikko Siponen
HUMANIORA
University Lecturer Elise Kärkkäinen
TECHNICA
Professor Hannu Heusala
ACTA
U N I V E R S I T AT I S O U L U E N S I S
Kari Antero Mäkelä
E D I T O R S
Kari Antero Mäkelä
A
B
C
D
E
F
G
O U L U E N S I S
ACTA
A C TA
D 1085
THE ROLES OF OREXINS ON
SLEEP/WAKEFULNESS,
ENERGY HOMEOSTASIS AND
INTESTINAL SECRETION
MEDICA
Professor Olli Vuolteenaho
SCIENTIAE RERUM SOCIALIUM
Senior Researcher Eila Estola
SCRIPTA ACADEMICA
Information officer Tiina Pistokoski
OECONOMICA
University Lecturer Seppo Eriksson
EDITOR IN CHIEF
Professor Olli Vuolteenaho
PUBLICATIONS EDITOR
Publications Editor Kirsti Nurkkala
ISBN 978-951-42-6377-4 (Paperback)
ISBN 978-951-42-6378-1 (PDF)
ISSN 0355-3221 (Print)
ISSN 1796-2234 (Online)
UNIVERSITY OF OULU,
FACULTY OF MEDICINE,
INSTITUTE OF BIOMEDICINE,
DEPARTMENT OF PHYSIOLOGY;
UNIVERSITY OF OULU,
BIOCENTER OULU;
UNIVERSITY OF EASTERN FINLAND,
DEPARTMENT OF BIOTECHNOLOGY AND MOLECULAR MEDICINE,
A. I. VIRTANEN INSTITUTE FOR MOLECULAR SCIENCES
D
MEDICA
