Download full article

This article appeared in a journal published by Elsevier. The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elsevier’s archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/authorsrights
Author's personal copy
Experimental Eye Research 110 (2013) 70e75
Contents lists available at SciVerse ScienceDirect
Experimental Eye Research
journal homepage: www.elsevier.com/locate/yexer
Overexpression of peroxiredoxin 2 in pterygium. A proteomic approach
V.M. Bautista-de Lucio a, *, N.L. López-Espinosa a, A. Robles-Contreras b, H.J. Pérez-Cano a, H. Mejía-López a,
G. Mendoza d, M.C. Jiménez-Martínez b, d, Y. Garfias c, d
a
Microbiology and Ocular Proteomics, Research Unit, Institute of Ophthalmology Fundación de Asistencia Privada Conde de Valenciana, Chimalpopoca, 14 Colonia Obrera,
06800 México City, Mexico
b
Immunology Dept, Institute of Ophthalmology Fundación de Asistencia Privada Conde de Valenciana, Chimalpopoca, 14 Colonia Obrera, 06800 México City, Mexico
c
Cellular Biology, Research Unit, Institute of Ophthalmology Fundación de Asistencia Privada Conde de Valenciana, Chimalpopoca, 14 Colonia Obrera, 06800 México City, Mexico
d
Department of Biochemistry, Faculty of Medicine, UNAM, Insurgentes Sur 3000, Coyoacán, 04510 Mexico City, Mexico
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 1 November 2012
Accepted in revised form 1 March 2013
Available online 13 March 2013
Pterygium is one of the most frequent pathologies in ophthalmology, and is a benign, fibrovascular lesion
originating from the bulbar conjunctiva. It is composed of an epithelium and highly vascular, subepithelial, loose connective tissue. The etiology of pterygium is not clearly understood; the most widely
recognized originating factor is ultraviolet radiation. It has been proposed that pterygium and neoplasia
have common features, raising the possibility that pterygium is a neoplastic-like growth disorder. In this
study, proteomic analysis was performed to show that peroxiredoxin 2 is overexpressed in pterygia
compared to healthy conjunctivas. Twelve pterygium specimens were obtained together with healthy
conjunctival tissue from the same eyes. Total proteins of pterygia and healthy conjunctivas were analyzed
in SDS-PAGE. This analysis showed protein bands expressed exclusively in pterygium samples at the
range of 20e25 kDa. After this, 2D electrophoresis was performed for the separation of total proteins;
differential spots expressed in pterygium were excised and sequenced. Mass spectrometry (MS) data
were searched in the NCBInr and EST databases using the MASCOT program. The spot was identified as
peroxiredoxin 2. Real-time PCR, western blot and immunohistochemistry showed that peroxiredoxin 2
was increased in pterygium compared to healthy conjunctiva. Although, these results suggest that
overexpression of peroxiredoxin 2 in pterygium could protect the cell against oxidative stresseinduced
apoptosis, further studies are required to establish the functional role of peroxiredoxin 2 in pterygium to
determine its role in peroxidation and apoptosis in this pathology.
Ó 2013 Elsevier Ltd. All rights reserved.
Keywords:
peroxiredoxin 2
pterygium
oxidative stress
1. Introduction
Pterygium is an overgrowth of fibrovascular tissue, with a winglike appearance, from the conjunctiva over the cornea (Chui et al.,
2008; Solomon et al., 2003; Taylor et al., 1992; Wong et al., 2001).
Pterygium pathophysiology is characterized by invasion of the
basement membrane of normal cornea with the concomitant
dissolution of Bowman’s layer (Dushku and Reid, 1994). Although
the pathogenesis of pterygium is not clearly understood, certain
findings concerning common features in pterygium and neoplasia
have been proposed, raising the possibility that a pterygium is a
neoplastic-like growth disorder (Coroneo, 1993).
Although several theories have been postulated for the pathogenesis of pterygium, including immunological mechanisms,
* Corresponding author. Tel.: þ52 55 54421700x3212; fax: þ52 55
54421700x3206.
E-mail address: [email protected] (V.M. Bautista-de Lucio).
0014-4835/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.exer.2013.03.001
infections, and ultraviolet exposition (Gallagher et al., 2001; Garfias
et al., 2009; Nolan et al., 2003), the precise basis by which pterygium is caused remains still under study. In this context, ultraviolet exposition acts directly by phototoxic or indirectly generating
reactive oxygen species (ROS)(Balci et al., 2011). It has been documented that ROS and metabolic activation are able to modulate
gene expression, and are relevant in oxidative stress in tumor formation (Armstrong et al., 2002; Martini and Ursini, 1996; Okada,
2007). Moreover, it has been described that ROS activity induced
the formation of 8-hydroxydeoxyguanosine, which is a ubiquitous
marker for oxidative stress; interestingly, this molecule is highly
expressed in pterygium samples, suggesting an oxidative stress
environment, which may be favoring the development of this pathology (Kau et al., 2006; Perra et al., 2006; Tsai et al., 2005).
Likewise, ROS are responsible for inducing cyclooxygenase-2
expression, which has been found expressed in pterygium (Maxia
et al., 2009). Additionally, the increase in nitric oxide and malone
dialdehyde molecules found in pterygium samples, highlights the
Author's personal copy
V.M. Bautista-de Lucio et al. / Experimental Eye Research 110 (2013) 70e75
role of the oxidative enzymatic function imbalance described in
pterygia (Balci et al., 2011). In an attempt to identify enzymes
responsible to detoxify free radicals from the environment, Balci
et al. (2011) has reported a reduced activity of superoxide dismutase and glutathione peroxidase which results in an increase
levels of oxidative stress molecules. In the same way, it has been
reported that the deficiency of glucose-6-phosphate-dehydrogenase is considered a risk factor for the development of pterygium
(Peiretti et al., 2010).
Peroxiredoxin 2 is a cytoplasmic enzyme that reduces the
intracellular ROS levels such as peroxide and hydroperoxide that
protects the cell from oxidative stress in several biological processes and detoxification of oxidants (Fujii and Ikeda, 2002). It has
been described that peroxiredoxin 2 overexpression protects
significantly from peroxide induced apoptosis and necrosis, while
down-regulation of this enzyme promotes injurious effects of
oxidative stress in cardiomyocytes (Venardos et al., 2007). Recently,
Liang et al. (2011) reported that pterygium expresses high levels of
cellular proliferation proteins and low levels of cellular apoptosis
markers, suggesting that there is a disruption in the equilibrium
among proliferation and apoptosis, favoring cell proliferation in
pterygium.
In this study, proteomic analysis was performed to show that
peroxiredoxin 2 is overexpressed in pterygia compared to healthy
conjunctivas.
2. Material and methods
2.1. Biological samples
The institutional ethics board approved this study. Twelve pterygium samples were obtained from 12 patients, 6 males and 6
females, with mean age 41 3 year old. Samples of healthy conjunctiva were obtained from the same patients who underwent
pterygium surgical excision. The specimens of the healthy conjunctivas were taken from the autografts obtained from the superior bulbar conjunctiva. All the patients were signed informed
consent to participate in the study.
2.2. Extraction and quantification of tissue proteins
Specimens were located in ice-cold lysis buffer [20 mM Tris pH
7.5; 1 mM EDTA; 0.15 M NaCl; 50 mM NaF; 1% Triton X-100; 4 mM
Na3VO4 and protease inhibitor cocktail tablets (Roche, Mannheim,
Germany)] immediately after surgical excision; the tissues were
homogenized using Tissue-Ruptor (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. Proteins were quantified by the DC Protein Assay kit (Biorad, California, USA). Eighty
micrograms of protein per sample were cleaned using the Ready
Prep TM 2-D Cleanup kit (Biorad, California, USA) and were kept
at 80 C until use.
2.3. Isoelectro focusing (IEF) and 2-D gel electrophoresis
The protein samples were further diluted with an equal volume
of the 2 rehydration buffer (8 M urea, 2% w/v CHAPS, 10 mM DTT,
0.2% Bio-Lyte). The first dimension electrophoresis was carried out
on a Protein IEF Cell (Biorad, California, USA) using pH3-10
Immobilized pH Gradient (IPG) gel strips of 11 cm length. The IEF
was performed at 20 C under the following conditions: 10 h at
50 V; 1 h at 100 V; 2 h at 4000 V and held at 4000 V until the total
Vhr reached 20,000 Vhr. After isoelectro focusing, the IPG strips
were reduced for 10 min in an equilibration buffer I (375 mM TrisHCl, pH 8.8, 6 M urea, 2% DTT), and subsequently alkylated for
10 min in an equilibration buffer II (375 mM Tris-HCl, pH 8.8, 6 M
71
urea, 2% SDS, 2% iodoacetamide). The second dimensional separation was carried out on a custom-made 12% SDS-PAGE and a Miniprotean electrophoresis system (BioRad, California, USA). Gels
were stained with Coomassie blue and the images were digitalized
using G-Box System and Gene Snap Software version 7.12.06
(Syngene, London, UK).
Protein spots were excised from SDS-PAGE with a sterile scalpel.
The gel pieces were washed with 50% (v/v) acetonitrile in 25 mM
ammonium bicarbonate (pH 8.5) for 15 min twice to remove Coomassie dye. After dehydration with 100% (v/v) acetonitrile for
10 min at room temperature (24 3 C, the gel pieces were
vacuum-dried and rehydrated with sequencing-grade modified
trypsin (Promega, Madison, WI.) in 25 mM ammonium bicarbonate
(pH 8.5) at 37 C overnight. The in-gel tryptic digested samples
were injected into an integrated nano-LC-ESI-MS/MS system
(quadrupole/time of flight, Ultima API, Micromass, Manchester,
UK). The injected samples were first trapped and desalted isocratically on an LC-Packing PepMap C18 m-pre-column cartridge
(Dionex, Sunnyvale, CA, USA). After dissolving with 0.1% formic
acid, the samples were loaded into an analytical C18 capillary column connected online to the mass spectrometer. Instrumental
operation, data acquisition, and analysis were performed under the
full control of Mass-Lynx 4.0 (Micromass). The 1-s survey scans
were run over the mass range of m/z 400 to 2000. A maximum of
three concurrent MS/MS acquisitions were triggered for 2þ, 3þ,
and 4þ charged precursor detection at an intensity above the
predefined threshold. The acquired peptide ions were analyzed
with the Mascot program (www.matrixscience.com) using both
NCBInr and EST databases. Parameters for the Mascot search were
peptide mass tolerance of 1 Da; MS/MS ion mass tolerance of 1 Da,
maximally one missed cleavage; and tryptic digestion. Variable
modifications included methionine oxidation and cysteine carbamidomethylation. Only proteins with significant ions scores (>46)
were reported.
2.4. Real time reverse transcription PCR analysis
Samples collected were snap frozen and kept at 80 C until
processed. Isolation of total RNA from biological specimens was
performed using the RNeasy kit (Qiagen, Hilden, Germany). Two
micrograms of RNA was reverse-transcripted using Oligo-dT
(Promega, Madison WI, USA) at 42 C for 30 min and the reaction
was stopped at 95 C for 5 min. From the obtained cDNA, real time
PCR was performed using the 18s gene as previously described
(Steinau et al., 2006). Up to 100 ng of starting RNA was used
for amplification in a Rotor-Gene 6000 apparatus (Corbett Life
Science, Sidney, Australia). Primers for 18s and PRDX2 amplification
had the same melting temperature (60 C) and were 18S forward 50 TCG ATGCTCTTAGCTGAGTGTCC -30 , 18s reverse 50 - TGATCGTCTTC
GAACCTCCG e 30 ; PRXD2 forward 50 -CCAGACGCTTGTCTGAGGAT-30 ,
PRXD2 reverse 50 -ACGTTGGGCTTAATCGTGTC-30 . To identify that
the amplification reactions did not form any spurious sub-products,
the temperature gradient was performed from 72 C to 95 C and
was analyzed by melt curve. In all cases, only one curve was
obtained for each amplification reaction. Relative amplification
increment was calculated using the formula 2-DDCT (Livak and
Schmittgen, 2001) and 18s gene was used as the housekeeping
gene. Each experiment was performed by triplicate in three independent assays.
2.5. Western blot analysis
Sixty micrograms of proteins obtained from pterygia and
healthy conjunctivas were loaded onto 12% SDS-PAGE. After electrophoresis, the proteins were then transferred to a nitrocellulose
Author's personal copy
72
V.M. Bautista-de Lucio et al. / Experimental Eye Research 110 (2013) 70e75
Fig. 1. Differential protein expression in pterygium and healthy conjunctiva by 2D-electrophoresis. Proteins were solved by isoelectric point (bottom arrows) and molecular weight
in a 12% SDS-PAGE and stained with Coomassie blue. In the area corresponding to 20e25 kDa, a spot was weakly expressed in healthy conjunctiva (arrow left panel); in contrast, the
expression of the spot located at the same area was stronger expressed in pterygium compared to healthy conjunctiva (arrow right panel). Molecular weight markers are shown in
the left side of the figure.
membrane (BioRad, California, USA); nonspecific binding was
blocked incubating for 1 h at room temperature with 5% nonfat
milk diluted in PBS-Tween 20 (0.1%). Membranes were incubated
overnight at 4 C with mouse polyclonal anti-peroxiredoxin 2
diluted 1:3000 (R&D Systems, Minneapolis, MN) or rabbit polyclonal anti-GAPDH diluted 1:200 (SantaCruz, CA USA). Secondary
biotinylated antibodies anti-mouse and anti-rabbit were diluted
1:20000 (Jackson ImmunoResearch West Grove, PA, USA). Finally,
the membranes were incubated with peroxidase conjugated antibiotin (Roche, IN, USA) antibodies diluted 1:5000, for 1 h at RT.
Enhanced chemiluminescence reagent (GE, Piscataway, NJ, USA)
was used to develop the reaction. Chemiluminescence was visualized and digitalized with G-Box Dyversity System (Syngene, London, UK) and analyzed with GeneTools software version 4.03.00
(Syngene, London, UK).
2.6. Immunohistochemistry
Tissue segments were fixed by 10% formalin overnight and
processed for paraffin embedding. Sections of 5 mm were cut,
mounted on glass poly-lysine charged slides. All slides were then
deparaffinized and re-hydrated with a gradient of ethanol concentrations. Antigen retrieval was performed heating the samples
in 10 mmol/L citrate buffer (pH 6.0). Samples were then washed
with 0.1%Tween-PBS (pH 7.3); this buffer was used for all subsequent washes. Mouse anti-human peroxiredoxin-2 was used as
primary antibody (R&D Systems), using 1:200 dilution this antibody was incubated at room temperature (RT) for 30 min. Samples
were washed twice. All samples were incubated 30 min with universal biotinylated secondary antibodies at RT. The samples were
then washed twice and a final incubation of 30 min at RT was
Fig. 2. Protein identification by MS. a) Biochemical characteristic of PRDX 2 obtained from MS analysis. After enzyme digestion, protein identification with high score (445) shows
that the spot mentioned above corresponds to peroxiredoxin 2; code is the access number of sequence molecule, the protein was compared to NCBInr and EST databases. Schematic
representation of the matched peptides in a reference sequence shows 38% of protein coverage (b). It is shown the expected and observed MW, ion score and p-value/expect for each
peptide (c).
Author's personal copy
V.M. Bautista-de Lucio et al. / Experimental Eye Research 110 (2013) 70e75
73
performed using streptavidin-peroxidase. Signals were developed
using 3, 30 -diaminobenzidine for 5 min and counterstained with
Mayer’s hematoxylin (Dako, Glostrup, Denmark). Negative controls
were prepared by leaving out the primary antibody. Breast cancer
was used as positive controls for peroxiredoxin 2 (Noh et al., 2001).
3. Results
3.1. Two-dimensional gel electrophoresis profile
The proteomic profile from healthy conjunctivas compared to
proteomic profile from pterygia was different. When proteins were
resolved by SDS-PAGE electrophoresis on 12% gel there was an
evident difference in the identification of a band with a molecular
weight of around 20 kDa presented only in pterygia samples,
meanwhile, this band was totally absent in proteins from healthy
conjunctivas (data not shown). This remarkable result guided us to
analyze putative protein differences in a 2D gel electrophoresis
around the 20 kDa area. When 2D gel analysis was performed,
interestingly there was a spot only present in pterygium samples, in
contrast to healthy conjunctivas in which this spot was absent
(Fig. 1).
3.2. Protein identification by MS
Mass spectrometry analysis from the spot mentioned above was
performed, in order to identify the protein(s) into the spot differentially expressed in pterygia compared to healthy conjunctivas.
The results of MS are summarized in Fig. 2. As mentioned in the
Fig. 2 the spot identified by MS matched to peroxiredoxin 2 protein.
3.3. Validation of overexpression of peroxiredoxin 2 by real time
PCR and western blot
Real time RT-PCR was performed to corroborate the differences
described in the proteomic profile and analyzed by MS, of both
samples from pterygia and healthy conjunctivas. There was 4 times
fold increase on the expression of peroxiredoxin 2 in pterygia
samples compared to healthy conjunctivas according to the method
suggested by Livak and Schmittgen (2001), as shown in Fig. 3a.
Levels of peroxiredoxin 2 protein, were analyzed by western blot,
results showed that peroxiredoxin 2 had higher expression in
pterygia in contrast to healthy conjunctivas (Fig. 3b).
3.4. Peroxiredoxin 2 is exclusively expressed in pterygium tissue
To show the presence and tissue localization of peroxiredoxin 2,
immunohistochemistry assays were performed in pterygium biopsies and healthy conjunctivas. As shown in Fig. 4, peroxiredoxin 2
was exclusively expressed in pterygium. Interestingly, this protein
was preferentially localized in pterygium basal epithelium. Unlike
pterygium biopsies, peroxiredoxin 2 was absent in healthy conjunctiva specimens.
4. Discussion
Proteomics has expanded the opportunities to discover diseasespecific proteins involved in many diseases, including those from
the ophthalmic field such as keratoconus (Joseph et al., 2011),
glaucoma (Sacca et al., 2012) and myopia (Frost and Norton, 2012).
The proteomic technique includes two-dimensional electrophoresis (2-D) and mass spectrometry; the former studies proteins
separated by their isoelectric point and their molecular sizes;
meanwhile, mass spectrometry characterizes and identifies peptides, amino acid sequences using bioinformatics tools (Lemeer
Fig. 3. Validation of overexpression of peroxiredoxin 2 by real time PCR and western
blot. Peroxiredoxin 2 was overexpressed in pterygium in comparison to healthy conjunctiva. a) Real time RT-PCR showed that there was an overexpression of the peroxiredoxin 2 transcript in pterygia compared to healthy conjunctivas. b) Western blot
was performed to corroborate the overexpression of peroxiredoxin 2 protein; as shown
in the figure there is a weak band in healthy conjunctivas; compared to a stronger band
found in pterygia, corresponding to peroxiredoxin 2 protein. GAPDH protein was used
as a loading control. This figure is a representative assay from four western blots.
et al., 2012). In this study, a proteomics approach was performed
to identify putative differences in pterygium samples compared to
healthy conjunctivas. Interestingly, a spot identified as peroxiredoxin 2 was overexpressed in pterygia in comparison to healthy
conjunctivas. Similarly, proline-rich protein 5 has been found in
tear samples of pterygium patients, using proteomics method
(Zhou et al., 2006), sustaining the value of this technique to study
pterygium pathology. As it has been shown, proteomics is a versatile tool to study this pathology, since proteomics is able to
identify differences in tear samples, as well as in biopsies specimens. So far we know, this is the first study comparing samples
from pterygia and healthy conjunctivas by 2D-MS assays, which
opens a new filed in the study of pterygium. In order to validate the
overexpression of peroxiredoxin 2, RT-PCR, western blot and
immunohistochemistry assays were performed. The results of the
present study indicate that both transcript and protein levels from
peroxiredoxin 2 were increased in pterygium samples compared to
healthy conjunctivas. These results suggest that there is a direct
relationship between transcript and translation of this oxidative
enzyme. The positive regulation of the expression of peroxiredoxin
2 might be associated to the increase of ROS found in pterygium
samples observed by other authors (Balci et al., 2011). Ultraviolet
(UV) radiation damage, irritation or inflammation have been proposed as possible etiopathological factors for pterygium development (Mackenzie et al., 1992; Saw and Tan, 1999). The mechanism
by which UV radiation induces uncontrolled proliferation in cells
from pterygium remains unclear. The effects of UV radiation are
driven either directly by the UV phototoxic effect or indirectly by
Author's personal copy
74
V.M. Bautista-de Lucio et al. / Experimental Eye Research 110 (2013) 70e75
Fig. 4. Expression and localization of peroxiredoxin 2 in pterygium. Immunohistochemistry assays performed in pterygium and healthy conjunctiva, showed the presence of
peroxiredoxin 2 protein preferentially in pterygia basal epithelium, meanwhile there was no immunostaining of this protein in healthy conjunctivas. A cytoplasmic and granular
pattern was observed in pterygium positive cells. Breast cancer biopsies were used as positive controls for peroxiredoxin 2 immunostaining. From left to right 100, 400, 1000.
the formation of ROS. Presence of ROS regulates the expression of
several proteins involved in ROS metabolism; it has been demonstrated that 8-hydroxydeoxyguanosine, cyclooxigenase 2 and survivin are overexpressed in pterygium, and proteins such as
superoxide dismutase and glutathione peroxidase showed reduced
activity, all these data suggest that all these proteins are involved in
the development of this cell surface pathology (Shoham et al.,
2008). Peroxiredoxin 2 is a member of an antioxidant enzyme
family, which has the ability to reduce H2O2 and hydroperoxides
into water and alcohol, respectively. Peroxiredoxin 2 is a 25 kDa
protein, and it has been found to be abundant in the cytosol from a
wide range of tissues, making it a major regulator of the H2O2 signal
in the cell. It has been demonstrated that overexpression of this
enzyme protects leukemia cells from apoptosis (Zhang et al., 1997),
meanwhile, blocking peroxiredoxin 2 expression, enhanced
radiation-induced cancer cell death (Park et al., 2000). These data
support the proposal that peroxiredoxin 2 could be involved in the
inhibition of pterygium cell apoptosis.
As it has been described in cardiomyocytes, the overexpression
of peroxiredoxin 2 protected from cell apoptosis, by increasing Bcl2
and decreasing Bax protein expression, and diminishing caspase-3,
-9 and -12 activity (Zhao et al., 2009).
Whether peroxiredoxin 2 is playing a similar role in pterygium
as in cardiomyocytes is still unclear. Many isoforms from peroxiredoxin family have been implicated in survival from several ocular
cells, including retinal cells, trabecular meshwork cells and
epithelial cells from the lens (Fatma et al., 2009, 2011; Tulsawani
et al., 2010); these findings strengthen the possible contribution
of peroxiredoxin 2 in cell survival described in pterygium cells
(Kase et al., 2007). Although we have shown that peroxiredoxin 2
was preferentially localized in pterygium basal epithelium, other
authors have demonstrated that apoptotic cells are found mainly
confined to basal epithelial cells in pterygia (Liang et al., 2011; Tan
et al., 2000), leading the chance that peroxiredoxin 2 is not the only
oxidative enzyme involved in the inhibition of apoptosis in pterygium. Further studies are required to establish the functional role
of peroxiredoxin 2 in pterygium to determine its role in peroxidation and apoptosis in this pathology.
Acknowledgments
This work was partially supported by the Conde de Valenciana
Foundation. The authors wish to thank Verónica Romero for her
technical assistance. This work is dedicated in loving memory of
Guillermo Mendoza-Hernández.
References
Armstrong, J.S., Steinauer, K.K., Hornung, B., Irish, J.M., Lecane, P., Birrell, G.W.,
Peehl, D.M., Knox, S.J., 2002. Role of glutathione depletion and reactive oxygen
species generation in apoptotic signaling in a human B lymphoma cell line. Cell
Death Differ. 9, 252e263.
Balci, M., Sahin, S., Mutlu, F.M., Yagci, R., Karanci, P., Yildiz, M., 2011. Investigation of
oxidative stress in pterygium tissue. Mol. Vis. 17, 443e447.
Chui, J., Di Girolamo, N., Wakefield, D., Coroneo, M.T., 2008. The pathogenesis of
pterygium: current concepts and their therapeutic implications. Ocul. Surf. 6,
24e43.
Coroneo, M.T., 1993. Pterygium as an early indicator of ultraviolet insolation: a
hypothesis. Br. J. Ophthalmol. 77, 734e739.
Dushku, N., Reid, T.W., 1994. Immunohistochemical evidence that human pterygia
originate from an invasion of vimentin-expressing altered limbal epithelial
basal cells. Curr. Eye Res. 13, 473e481.
Fatma, N., Kubo, E., Toris, C.B., Stamer, W.D., Camras, C.B., Singh, D.P., 2009. PRDX6
attenuates oxidative stress- and TGFbeta-induced abnormalities of human
trabecular meshwork cells. Free Radic. Res. 43, 783e795.
Fatma, N., Singh, P., Chhunchha, B., Kubo, E., Shinohara, T., Bhargavan, B., Singh, D.P.,
2011. Deficiency of Prdx6 in lens epithelial cells induces ER stress responsemediated impaired homeostasis and apoptosis. Am. J. Physiol. Cell Physiol.
301, C954eC967.
Frost, M.R., Norton, T.T., 2012. Alterations in protein expression in tree shrew sclera
during development of lens-induced myopia and recovery. Invest. Ophthalmol.
Vis. Sci. 53, 322e336.
Fujii, J., Ikeda, Y., 2002. Advances in our understanding of peroxiredoxin, a multifunctional, mammalian redox protein. Redox Rep. 7, 123e130.
Author's personal copy
V.M. Bautista-de Lucio et al. / Experimental Eye Research 110 (2013) 70e75
Gallagher, M.J., Giannoudis, A., Herrington, C.S., Hiscott, P., 2001. Human papillomavirus in pterygium. Br. J. Ophthalmol. 85, 782e784.
Garfias, Y., Bautista-De Lucio, V.M., Garcia, C., Nava, A., Villalvazo, L., JimenezMartinez, M.C., 2009. Study of the expression of CD30 in pterygia compared to
healthy conjunctivas. Mol. Vis. 15, 2068e2073.
Joseph, R., Srivastava, O.P., Pfister, R.R., 2011. Differential epithelial and stromal
protein profiles in keratoconus and normal human corneas. Exp. Eye Res. 92,
282e298.
Kase, S., Takahashi, S., Sato, I., Nakanishi, K., Yoshida, K., Ohno, S., 2007. Expression
of p27(KIP1) and cyclin D1, and cell proliferation in human pterygium. Br. J.
Ophthalmol. 91, 958e961.
Kau, H.C., Tsai, C.C., Lee, C.F., Kao, S.C., Hsu, W.M., Liu, J.H., Wei, Y.H., 2006. Increased
oxidative DNA damage, 8-hydroxydeoxy- guanosine, in human pterygium. Eye
(Lond) 20, 826e831.
Lemeer, S., Hahne, H., Pachl, F., Kuster, B., 2012. Software tools for MS-based
quantitative proteomics: a brief overview. Methods Mol. Biol. 893, 489e499.
Liang, K., Jiang, Z., Ding, B.Q., Cheng, P., Huang, D.K., Tao, L.M., 2011. Expression of
cell proliferation and apoptosis biomarkers in pterygia and normal conjunctiva.
Mol. Vis. 17, 1687e1693.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25,
402e408.
Mackenzie, F.D., Hirst, L.W., Battistutta, D., Green, A., 1992. Risk analysis in the
development of pterygia. Ophthalmology 99, 1056e1061.
Martini, G., Ursini, M.V., 1996. A new lease of life for an old enzyme. Bioessays 18,
631e637.
Maxia, C., Perra, M.T., Demurtas, P., Minerba, L., Murtas, D., Piras, F., Cabrera, R.,
Ribatti, D., Sirigu, P., 2009. Relationship between the expression of
cyclooxygenase-2 and survivin in primary pterygium. Mol. Vis. 15, 458e463.
Noh, D.Y., Ahn, S.J., Lee, R.A., Kim, S.W., Park, I.A., Chae, H.Z., 2001. Overexpression of
peroxiredoxin in human breast cancer. Anticancer Res. 21, 2085e2090.
Nolan, T.M., DiGirolamo, N., Sachdev, N.H., Hampartzoumian, T., Coroneo, M.T.,
Wakefield, D., 2003. The role of ultraviolet irradiation and heparin-binding
epidermal growth factor-like growth factor in the pathogenesis of pterygium.
Am. J. Pathol. 162, 567e574.
Okada, F., 2007. Beyond foreign-body-induced carcinogenesis: impact of reactive
oxygen species derived from inflammatory cells in tumorigenic conversion and
tumor progression. Int. J. Cancer 121, 2364e2372.
Park, S.H., Chung, Y.M., Lee, Y.S., Kim, H.J., Kim, J.S., Chae, H.Z., Yoo, Y.D., 2000.
Antisense of human peroxiredoxin II enhances radiation-induced cell death.
Clin. Cancer Res. 6, 4915e4920.
Peiretti, E., Mandas, A., Cocco, P., Norfo, C., Abete, C., Angius, F., Pani, A., Vascellari, S.,
Del Fiacco, G., Cannas, D., Diaz, G., Dessi, S., Fossarello, M., 2010. Glucose-6-
75
phosphate-dehydrogenase deficiency as a risk factor for pterygium. Invest.
Ophthalmol. Vis. Sci. 51, 2928e2935.
Perra, M.T., Maxia, C., Corbu, A., Minerba, L., Demurtas, P., Colombari, R., Murtas, D.,
Bravo, S., Piras, F., Sirigu, P., 2006. Oxidative stress in pterygium: relationship
between p53 and 8-hydroxydeoxyguanosine. Mol. Vis. 12, 1136e1142.
Sacca, S.C., Centofanti, M., Izzotti, A., 2012. New proteins as vascular biomarkers in
primary open angle glaucomatous aqueous humor. Invest. Ophthalmol. Vis. Sci.
53, 4242e4253.
Saw, S.M., Tan, D., 1999. Pterygium: prevalence, demography and risk factors.
Ophthalmic Epidemiol. 6, 219e228.
Shoham, A., Hadziahmetovic, M., Dunaief, J.L., Mydlarski, M.B., Schipper, H.M., 2008.
Oxidative stress in diseases of the human cornea. Free Radic. Biol. Med. 45,
1047e1055.
Solomon, A., Grueterich, M., Li, D.Q., Meller, D., Lee, S.B., Tseng, S.C., 2003. Overexpression of Insulin-like growth factor-binding protein-2 in pterygium body
fibroblasts. Invest. Ophthalmol. Vis. Sci. 44, 573e580.
Steinau, M., Rajeevan, M.S., Unger, E.R., 2006. DNA and RNA references for qRT-PCR
assays in exfoliated cervical cells. J. Mol. Diagn. 8, 113e118.
Tan, D.T., Tang, W.Y., Liu, Y.P., Goh, H.S., Smith, D.R., 2000. Apoptosis and apoptosis
related gene expression in normal conjunctiva and pterygium. Br. J. Ophthalmol. 84, 212e216.
Taylor, H.R., West, S., Munoz, B., Rosenthal, F.S., Bressler, S.B., Bressler, N.M., 1992.
The long-term effects of visible light on the eye. Arch. Ophthalmol. 110, 99e104.
Tsai, Y.Y., Cheng, Y.W., Lee, H., Tsai, F.J., Tseng, S.H., Lin, C.L., Chang, K.C., 2005.
Oxidative DNA damage in pterygium. Mol. Vis. 11, 71e75.
Tulsawani, R., Kelly, L.S., Fatma, N., Chhunchha, B., Kubo, E., Kumar, A., Singh, D.P.,
2010. Neuroprotective effect of peroxiredoxin 6 against hypoxia-induced retinal
ganglion cell damage. BMC Neurosci. 11, 125.
Venardos, K.M., Perkins, A., Headrick, J., Kaye, D.M., 2007. Myocardial ischemiareperfusion injury, antioxidant enzyme systems, and selenium: a review. Curr.
Med. Chem. 14, 1539e1549.
Wong, T.Y., Foster, P.J., Johnson, G.J., Seah, S.K., Tan, D.T., 2001. The prevalence and
risk factors for pterygium in an adult Chinese population in Singapore: the
Tanjong Pagar survey. Am. J. Ophthalmol. 131, 176e183.
Zhang, P., Liu, B., Kang, S.W., Seo, M.S., Rhee, S.G., Obeid, L.M., 1997. Thioredoxin
peroxidase is a novel inhibitor of apoptosis with a mechanism distinct from that
of Bcl-2. J. Biol. Chem. 272, 30615e30618.
Zhao, W., Fan, G.C., Zhang, Z.G., Bandyopadhyay, A., Zhou, X., Kranias, E.G., 2009.
Protection of peroxiredoxin II on oxidative stress-induced cardiomyocyte death
and apoptosis. Basic Res. Cardiol. 104, 377e389.
Zhou, L., Beuerman, R.W., Foo, Y., Liu, S., Ang, L.P., Tan, D.T., 2006. Characterisation of
human tear proteins using high-resolution mass spectrometry. Ann. Acad. Med.
Singap. 35, 400e407.