Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Nucleic Acids: Structure, Properties, and Functions Bases A N N H G NH2 N N N H N Adenine N TO NH2 NH Guanine Purines C O N H Cytosine NH NH N NH2 UO O N H O Thymine Pyrimidines N H uridine O NH2 Nucleotides N O -O ATP: energy currency GTP: involved in regulation G-proteins ATP, GTP, CTP, UTP: Precursors for RNA P O- O O P O- N O O P O N N O O- H H OH OH H H Adenosine Adenosine 5’-monophosphate AMP Adenosine 5’-diphosphate ADP Adenosine 5’-triphosphate ATP Deoxynucleotides NH2 N O -O P O- O O P O- N O O P O N O O- H H OH H H dATP, dGTP, dCTP, dUTP: Precursors for DNA N H Deoxyadenosine Deoxyadenosine 5’-monophosphate dAMP Deoxyadenosine 5’-diphosphate dADP Deoxyadenosine 5’-triphosphate dATP Poly(deoxy)nucleotide DNA RNA Base pairing 3D-structure: Watson & Crick, 1953 DNA: double helix; RNA: usually single-stranded, secondary structure Representation of DNA (or genes) 5’ GACGCTGAATTCCGTCACGACTCCGGTTACGAAGTTCACCAC CTGCGACTTAAGGCAGTGCTGAGGCCAATGCTTCAAGTGGTG 3’ D A E F R H D S G Y E V H H CAGAAACTGGTTTTCTTCGCTGAAGACGTTGGTTCCAACAAA GTCTTTGACCAAAAGAAGCGACTTCTGCAACCAAGGTTGTTT Q K L V F F A E D V G S N K 3’ GGTGCTATCATCGGTCTGATGGTTGGTGGTGTTGTTATCGCT CCACGATAGTAGCCAGACTACCAACCACCACAACAATAGCGA 5’ G A I I G L M V G G V V I A Amyloid-beta peptide 1-42 UV spectroscopic properties, DNA melting Different forms of double-stranded DNA Circular DNA DNA Functions 1. Template for DNA replication----heredity 2. Codes for all proteins (genes), all forms of RNA 3. Other biological information: such as transcription signals and regulation signals of cellular processes Drugs targeting DNA 1. Small molecule intercalation into the base pairs Cancer chemotherapy Anti-malaria 2. Alkylating agents Alkylating agent-mitomycin 3. Cisplatin: DNA chelation Steven Lippard, MIT Testicular and ovarian tumors chemotherapy 4. DNA cleavage Sequence-specific DNA cleavage: Peter Dervan, Caltech Sidney Hecht, Virginia Tech Dai, W.-M. et al. J. Med. Chem. 2002 Disadvantages of DNA-targeting Drugs 1. Low specificity leads to severe side effects 2. Too reactive, destroy anything on the road, like endiynes 3. Sequence-specific DNA cleavage agents: ability to penetrate cell membranes Disruption of translation at the mRNA level Transcription Translation × Binding of small complementary RNA/DNA sequences to the mRNA × Disruption of translation at the mRNA level 1. Antisense oligonucleotides: single-stranded, complementary to the target gene 2. Small double-stranded RNA: RNA interference (RNAi), double-stranded, sequence is from target. Movement of the mobile silencing signal in a GFP-expressing tobacco plant is visualized as a red trail where GFP has been silenced, revealing red fluorescence of chlorophyll in the background of green fluorescence from GFP. RNAi in Drosophila Postulated RNAi C. elegans 1. V. Vance1,H. Vaucheret. RNA Silencing in Plants— Defense and Counterdefense, Science 292, 2001, 2277 2. P. Ahlquist, RNA-Dependent RNA Polymerases, Viruses, and RNA Silencing, Science 296, 2002, 1270 3. R. H. A. Plasterk, RNA Silencing: The Genome’s Immune System, Science 296, 2002, 1263 4. M. Matzke, A. J. M. Matzke, J. M. Kooter, RNA: Guiding Gene Silencing, Science 293, 2001, 1080 5. P. D. Zamore, Ancient Pathways Programmed by Small RNAs, Science 296, 2002, 1265 6. M. Boutros, A. A. Kiger, S. Armknecht, K. Kerr, M. Hild, B. Koch, S. A. Haas, H. Fly, Array Consortium, R. Paro, N. Perrimon. Genome-Wide RNAi Analysis of Growth and Viability in Drosophila Cells, Science 2004, 832-835. More reading materials: Li BJ et al. Using siRNA in prophylactic and therapeutic regimens against SARS coronavirus in Rhesus macaque. Nat. Med. 2005; 11: 944–951. Chang Z, Hu J. RNAi therapeutics: Can siRNAs conquer SARS? Gene Ther. 2005, 871-872. Watanabe T, Umehara T, Kohara M. Therapeutic application of RNA interference for hepatitis C virus. Adv. Drug Deliv. Rev. 2007, 59(12):1263-76. Scherer L, Rossi JJ, Weinberg MS. Progress and prospects: RNAbased therapies for treatment of HIV infection. Gene Ther. 2007, 14(14):1057-64. Grimm D, Kay MA. Therapeutic application of RNAi: is mRNA targeting finally ready for prime time? J. Clin. Invest. 2007, 117(12):3633-41. Gewirtz AM. On future's doorstep: RNA interference and the pharmacopeia of tomorrow. J. Clin. Invest. 2007, 117(12):3612-4.