Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Plant Physiology Preview. Published on December 11, 2015, as DOI:10.1104/pp.15.01163 1 Running head 2 NPF2.4 loads chloride into Arabidopsis xylem 3 4 Corresponding authors 5 Mathew Gilliham 6 7 8 ARC Centre of Excellence in Plant Energy Biology and The University of Adelaide, PMB1, Glen Osmond, SA 5064, Australia. Tel: +61 8 8313 0485; Email: [email protected]. 9 Mark Tester 10 11 12 Centre for Desert Agriculture, King Abdullah University of Science and Technology, Thuwal 23955-6900, Kingdom of Saudi Arabia. Tel.: +966 2 8082922; E-mail: [email protected] 13 14 Research area 15 Membranes, Transport and Biogenetics 16 1 Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. Copyright 2015 by the American Society of Plant Biologists 17 Title of Article 18 Identification of a stelar-localised transport protein that facilitates root-to-shoot transfer 19 of chloride in Arabidopsis 20 21 Authors and Institutions 22 Bo Li1,2,3, Caitlin Byrt2,4, Jiaen Qiu1,2,4, Ute Baumann1,2, Maria Hrmova1,2, Aurelie 23 Evrard1,2, Alexander A.T Johnson5, Kenneth D Birnbaum6, Gwenda M Mayo2, Deepa 24 Jha1,2, Sam W Henderson2,4, Mark Tester*1,2,3, Mathew Gilliham*2,4, Stuart J Roy1,2 25 1 26 Australia; 2School of Agriculture, Food, and Wine, University of Adelaide, SA 5064, 27 Australia; 3Centre for Desert Agriculture, King Abdullah University of Science and 28 Technology, Thuwal 23955-6900, Kingdom of Saudi Arabia ; 4ARC Centre of 29 Excellence in Plant Energy Biology, University of Adelaide, SA 5064, Australia; 5School 30 of BioSciences, University of Melbourne, Parkville, Vic 3010, Australia ,6Centre for 31 Genomics and Systems Biology, New York University, NY 10003, USA 32 Author contributions 33 B.L. performed the majority of the experiments and analysis and drafted the manuscript. 34 C.B. conducted experiments for Figures 7A, 7E, 7F 7G and 7H. J.Q. conducted 35 experiments for Figures 7H and 7I. K.D.B. advised and assisted with the FACS. A.E., 36 A.A., T.J. and U.B. analyzed the microarray data. G.M.M. developed the assays for the 37 cross sections of GUS plant roots. M.H. constructed 3D protein models. D.J. 38 characterised putative npf2.4 knockout lines. S.W.H. assisted with the 36Cl– flux assays. 39 M.T. conceived the research and identified the candidate gene. M.G and S.J.R. 40 supervised the research and co-wrote the manuscript. All authors commented on the 41 manuscript. Australian Centre for Plant Functional Genomics, University of Adelaide, SA 5064, 42 2 Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 43 One-sentence summary 44 Identification and functional analysis of a gene encoding a Cl– transporter responsible for 45 loading Cl– into root xylem of Arabidopsis 3 Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 46 Financial source 47 48 49 50 51 This work was funded by Australian Research Council (ARC), Grains Research and Development Corporation (GRDC) and the King Abdullah University for Science and Technology funding to M.T., GRDC funding (UA00145) to S.J.R. and M.G., and ARC Centre of Excellence (CE140100008) and ARC Future Fellowship (FT130100709) funding to M.G.. 52 53 Corresponding authors 54 Mark Tester 55 [email protected] 56 57 Mathew Gilliham 58 [email protected] 4 Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 59 Abstract 60 61 Under saline conditions higher plants restrict the accumulation of chloride ions (Cl–) in the 62 shoot by regulating their transfer from the root symplast into the xylem-associated apoplast. 63 To identify molecular mechanisms underpinning this phenomenon, we undertook a 64 transcriptional screen of salt stressed Arabidopsis thaliana roots. Microarrays, quantitative 65 RT-PCR and promoter-GUS fusions identified a candidate gene involved in Cl– xylem 66 loading from the Nitrate transporter 1/Peptide Transporter family (NPF2.4). This gene was 67 highly expressed in the root stele compared to the cortex and its expression decreased after 68 exposure to NaCl or abscisic acid. NPF2.4 fused to fluorescent proteins, expressed either 69 transiently or stably, was targeted to the plasma membrane. Electrophysiological analysis of 70 NPF2.4 in Xenopus laevis oocytes suggested that NPF2.4 catalysed passive Cl– efflux out of 71 cells, and was much less permeable to NO3-. Shoot Cl– accumulation was decreased 72 following NPF2.4 amiRNA knockdown whereas it was increased by over-expression of 73 NPF2.4. Taken together, these results suggest that NPF2.4 is involved in long-distance 74 transport of Cl– in plants, playing a role in the loading and the regulation of Cl– loading into 75 the xylem of Arabidopsis roots during salinity stress. Downloaded from on June 14, 20175- Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 76 Introduction 77 78 Soil salinity is a significant threat to world agriculture as it restricts plant growth and 79 decreases the yield of crops (Munns, 2002; Munns and Tester, 2008; Roy et al., 2014). To 80 feed a rapidly growing global population, world food production needs to increase by 70-110 % 81 before 2050 (Tilman et al., 2011). Compounding matters, the area of salt affected farmland is 82 expanding as a consequence of less frequent rainfall, irrigation with suboptimal water and 83 rising water tables (Rengasamy, 2002, 2006). To meet the food demand of future generations, 84 improving crop salinity tolerance is a high priority. One approach to enhance plant salinity 85 tolerance is to minimise salt (NaCl) accumulation in the cytoplasm of the shoot, a primary 86 site of salt damage, whilst maintaining the uptake of beneficial ions such as nitrate (NO3–) 87 and potassium (K+) (Munns, 2002; Tester and Davenport, 2003; Teakle and Tyerman, 2010). 88 Improving salt exclusion from the shoot is one means of enhancing plant salinity tolerance 89 (Apse and Blumwald, 2007; Munns and Tester, 2008; Horie et al., 2009; Munns et al., 2012; 90 Guan et al., 2014). Significant progress has been made in characterising the genes encoding 91 proteins that are central to regulating shoot Na+ accumulation during salt stress (Roy et al., 92 2014; Munns and Gilliham, 2015). In particular, the function of the high affinity K+ 93 transporter HKT gene family (Uozumi et al., 2000; Mäser et al., 2002; Berthomieu et al., 94 2003; Davenport et al., 2007; Waters et al., 2013; Byrt et al., 2014), and the Na+/H+ antiporter 95 (NHX) and salt overly sensitive SOS gene families (Wu et al., 1996; Shi et al., 2000; Qiu et 96 al., 2002; Shi et al., 2002; Bassil and Blumwald, 2014) have been areas of intensive research. 97 Manipulation of these pathways has led to improvements in the salt tolerance of the model 98 plant Arabidopsis (Sunarpi et al., 2005; Møller et al., 2009) and crops (Ren et al., 2005; 99 James et al., 2006; Byrt et al., 2007; Plett et al., 2010; Qiu et al., 2011; Munns et al., 2012). 100 Excessive chloride ion (Cl–) accumulation in the cytoplasm of plant cells, particularly in the 101 shoot, is also toxic to plants (Tyerman, 1992; Xu et al., 1999; Munns and Tester, 2008; 102 Teakle and Tyerman, 2010; Geilfus et al., 2015), resulting in a reduction in plant growth, and 103 symptoms such as leaf burn and leaf abscission for Cl– sensitive species (Abel, 1969; Parker 104 et al., 1983; Cole, 1985). Chloride (Cl–), rather than sodium ions (Na+), is considered to be 105 the more toxic ion for woody perennial species such as grapevine (Tregeagle et al., 2006; 106 Gong et al., 2011), citrus (Storey and Walker, 1999) and legumes such as soybean (Luo et al., Downloaded from on June 14, 20176- Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 107 2005) and lotus (Teakle et al., 2007). For cereal crops such as wheat (Martin and Koebner, 108 1995) and barley (Tavakkoli et al., 2011), the toxic effects of Cl– and Na+ are additive and 109 can often be overcome by restricting excess accumulation of both ions in the shoot. It has 110 also been shown that the xylem-sap Cl– content of salt tolerant genotypes of wheat (Lauchli 111 et al., 2008), citrus (Moya et al., 2003) and lotus (Teakle et al., 2007) is lower when 112 compared with salt sensitive genotypes, suggesting that the control of Cl– concentration in the 113 transpiration stream is a contributing factor to plant salinity tolerance. However, the 114 molecular determinants of long distance Cl– transport in plants and how it is regulated in 115 response to salinity stress are still largely unknown (Teakle and Tyerman, 2010; Henderson et 116 al., 2014). While some candidate proteins, such as cation-Cl– co-transporters (CCC) in 117 Arabidopsis (Colmenero-Flores et al., 2007) and rice (Kong et al., 2011) have been proposed 118 to retrieve Cl– from the xylem, unresolved questions in regard to their localisation and mode 119 of action remain (Teakle and Tyerman, 2010). 120 Chloride is a micronutrient required by all plants, functioning as a key regulator of turgor 121 (and stomatal movement), membrane potential and cytosolic pH (Xu et al., 1999; White and 122 Broadley, 2001; Teakle and Tyerman, 2010). Cl– is acquired by plants from the soil at low 123 concentrations by active symport with H+ (Sanders, 1980; Beilby and Walker, 1981; Felle, 124 1994) and passively enters the plant at high concentrations due to a reversal in the 125 electrochemical potential (Skerrett and Tyerman, 1994). Casparian bands in the endodermis 126 limit the transfer of Cl– through an apoplastic pathway, thus most Cl– ions move from cell to 127 cell towards xylem vessels following the symplastic pathway (Pitman, 1982). This means Cl– 128 must cross root plasma membranes at least twice for it to be loaded into the xylem vessels, 129 prior to being transferred to the shoot via the transpiration stream. Due to the measured ion 130 concentrations in root cytoplasm and the xylem, the loading of Cl– into the root xylem is 131 highly likely to be electrochemically passive, and it is thus likely to be facilitated by plasma 132 membrane localised anion channels or carriers that are not yet identified (White and Broadley, 133 2001; Munns and Tester, 2008; Teakle and Tyerman, 2010; Kollist et al., 2011; Henderson et 134 al., 2014). 135 While little is known about the genes and proteins responsible for Cl– loading into the root 136 xylem apoplast, more is known about the biological processes involved. ABA was shown to 137 significantly inhibit xylem loading of Cl–, as well as K+ (Rb+), whilst having a limited effect 138 on the initial uptake of these ions from the external medium. This leads to an accumulation of 139 both Cl– and K+ ions in the root, and results in a reduced delivery to the shoot (Cram and Downloaded from on June 14, 20177- Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 140 Pitman, 1972; Pitman et al., 1974; Pitman, 1977). The discovery of the gene underlying K+ 141 xylem loading, the stelar outwardly rectifying K+ channel (SKOR) illustrated that ABA 142 down-regulates the K+ flux to the xylem vessels at both a transcriptional and a post- 143 translational level (Gaymard et al., 1998; Roberts, 1998; Roberts and Snowman, 2000). 144 Electrophysiological studies of maize and barley root xylem parenchyma cells identified 145 three conductances that could facilitate the passive xylem loading of anions such as Cl– and 146 NO3– into the xylem apoplast: xylem-parenchyma quickly-activating anion conductance (X- 147 QUAC), xylem-parenchyma slowly-activating anion conductance (X-SLAC) and xylem- 148 parenchyma inwardly-rectifying anion conductance (X-IRAC) (Kohler and Raschke, 2000; 149 Kohler et al., 2002; Gilliham and Tester, 2005). X-QUAC, the anion conductance most likely 150 to be responsible for the majority of Cl– xylem loading, was significantly down-regulated 151 when plants were treated with ABA (Gilliham and Tester, 2005). 152 Here, we have identified a gene encoding an anion transport protein with properties that are 153 consistent with a role in Cl– loading into the root xylem apoplast in Arabidopsis. The 154 knowledge gained here opens new avenues for manipulation of these pathways in Cl– 155 sensitive species for improving salinity tolerance. Downloaded from on June 14, 20178- Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 156 Results 157 Identification of candidate genes encoding transporters for Cl– xylem loading in 158 Arabidopsis 159 Based on accumulated physiological evidence, it was hypothesised that the rate-limiting step 160 of Cl– loading to the shoot is in the root stele and is ultimately regulated by transcription of 161 genes encoding Cl– transporters (Gilliham and Tester, 2005; Teakle and Tyerman, 2010; 162 Henderson et al., 2014). Previously, a comparative transcriptomic analysis of pericycle and 163 cortical cells in the root of Arabidopsis in response to salt (50 mM NaCl for 2 d) had been 164 conducted using fluorescent-activated cell sorting (FACS) and Affymetrix microarrays 165 (Evrard et al., 2012; Evrard, 2013). The data was subsequently re-analysed to identify stelar- 166 expressed genes that were likely to encode membrane bound anion permeable transport 167 proteins that had their expression reduced by salt stress. Two candidates were identified that 168 satisfied these criteria from this preliminary screen: the known H+/NO3– symporter 169 (AtNRT1.5/NPF7.3, At1g32450), which regulates NO3– transfer to Arabidopsis shoots (Lin et 170 al., 2008) and an uncharacterised gene, At3g45700/NPF2.4, which was annotated as a 171 proton-dependent oligo-peptide transporter. We prioritised the uncharacterised gene for 172 further study. NPF2.4 was preferentially expressed in the stele compared to the cortex (log2 173 fold change (pericycle vs. cortex) = 1.76) and was down regulated by salt (log2 fold change 0 174 mM vs 50 mM = -1.37). A search of the GEO Profiles database (Barrett et al., 2006) revealed 175 that NPF2.4 was rapidly down regulated in the root after exposure to salt in other studies 176 (GEO accession GDS3216). 177 178 Candidate gene At3g45700, also known as NPF2.4, is a member of the NAXT subfamily, 179 a 7-gene clade belonging to the NPF in Arabidopsis 180 NPF2.4 belongs to the NITRATE EXCRETION TRANSPORTER (NAXT) subfamily of the 181 Nitrate Transporter 1/Peptide Transporter (NRT1/PTR) Family (NPF) in Arabidopsis 182 (Segonzac et al., 2007; Tsay et al., 2007; Léran et al., 2014). The NAXT subfamily consists of 183 seven genes (At3g45650, At3g45660, At3g45680, At3g45690, At3g45700, At3g45710 and 184 At3g45720), which are clustered on chromosome 3 (Figure 1) (Tsay et al., 2007). The NAXT 185 subfamily was so named after the properties of NAXT1/NPF2.7 (At3g45650), a NO3– Downloaded from on June 14, 20179- Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 186 transporter in root cortical cells involved in NO3– excretion from the root (Segonzac et al., 187 2007). 188 189 In silica modelling suggests NPF2.4 is a membrane embedded transporter that can bind 190 Cl– 191 The candidate gene NPF2.4 harbours four exons and three introns, and is predicted to encode 192 a 548 amino acid protein, consisting of 12 trans-membrane α-helices with a hydrophilic loop 193 between trans-membrane α-helices 6 and 7 (Figure 2). The protein sequence of NPF2.4 was 194 found to have a 64% identity and a 78% similarity to NAXT1/NPF2.7 and a 76% identity and 195 a 85% similarity to NPF2.3, a NO3– selective xylem loader in Arabidopsis root (Taochy et al., 196 2015)(Supplemental Figure 1). 197 A three-dimensional (3D) molecular model of NPF2.4 was constructed using crystal 198 structures of a proton-dependent oligo-peptide transporter from Shewanella oneidensis (PDB 199 accession 2XUT) (Figure 2A) (Newstead et al., 2011) and a structure of the NRT1.1/NPF6.3 200 H+/NO3– transporter from Arabidopsis in complex with a NO3– ion (Figure 2B) (Sun et al., 201 2014). The putative 3D structure of NPF2.4 derived through use of both structural templates 202 indicated the presence of a central cavity, which was common to both structural templates 203 (Figure 2C). The presence of Cl– ions could be simulated, and several residues including 204 Tyr37, Va141, Asn67 and Met334 were identified in NPF2.4 as important in forming a 205 potential cavity essential for anion transport activity (Figure 2D). This provides an additional 206 basis for further study of NPF2.4 as a candidate for transporting Cl– between roots and shoots. 207 208 NPF2.4 expression is down-regulated by both salt and ABA 209 Expression profiling by qRT-PCR indicated that both NaCl and ABA treatment significantly 210 reduced the transcript abundance of NPF2.4. The reduction in gene expression was found to 211 be concentration dependent, with 100 mM NaCl treatment reducing NPF2.4 transcript 212 abundance more than 50 mM NaCl (Figure 3A). When treated with 75 mM NaCl for 5 days, 213 the abundance of NPF2.4 mRNA in the roots was significantly reduced by almost 90% when 214 compared with untreated plants (2 mM NaCl) (Figure 3B). Exposure to 20 µM ABA for 4 h 215 or 16 h significantly reduced NPF2.4 transcripts in the roots, with the reduction increasing 216 over the time of the assay (Figure 3C). Downloaded from on June 14, 201710 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 217 218 NPF2.4 is preferentially expressed in root stelar cells 219 To examine the localisation of NPF2.4 expression, a 1.5 kb of the putative promoter 220 sequence of NPF2.4 (proNPF2.4) was used to drive the expression of the UidA reporter gene 221 (Figure 4). Compared to non-transformed Col-0 plants (Figure 4A), proNPF2.4 driven GUS 222 activity was detected in the cells associated with the root vascular bundle in both primary and 223 lateral roots of plants transformed with proNPF2.4:UidA (Figure 4B, 4C and 4D). GUS 224 activity was also detectible in the vascular cells of both cotyledons and true leaves (Figure 4E 225 and 4F). Transverse sections of 10-d old proNPF2.4:UidA expressing roots further 226 demonstrated GUS activity in the root stelar cells (Figures 4G). ProNPF2.4 driven GUS 227 activity was also detected in flower and developing siliques (Figure 4H and 4I). 228 229 GUS activity in proNPF2.4:UidA expressing plants is regulated by salt, indicating the 230 existence of salt responsive regulatory elements in the putative NPF2.4 promoter 231 To investigate the responsiveness of the NPF2.4 promoter to salt stress, proNPF2.4:UidA 232 plants were treated with 75 mM or 150 mM NaCl for 5 d on MS plates. A reduction in the 233 intensity of proNPF2.4 associated GUS activity was observed in response to salt treatments. 234 A fluorescence based MUG assay quantified that proNPF2.4:UidA plants treated with 75 235 mM or 150 mM NaCl for 5 d had approximately 70% and 30% GUS activity, respectively, 236 when compared with 0 mM NaCl grown plants (Figure 5). 237 The 1.5 kb putative promoter region of NPF2.4 was compared with the entries of the plant 238 cis-acting regulatory DNA elements (PLACE). Multiple copies of binding sites that are 239 targets of transcription factors belonging to ABA signal transduction pathways were 240 identified (Supplemental Table 1). 241 242 NPF2.4 is localised at the plasma membrane 243 To determine the sub-cellular localisation of NPF2.4, Col-0 plants were stably transformed 244 with Green Fluorescent Protein (GFP) fused to the 3′- end of NPF2.4. GFP was detected on 245 the periphery of root cells in the 10-d old transgenic plants (Figure 6A). After plasmolysis 246 was performed to detach the plasma membrane from the cell wall, fluorescence was detected 247 on Hechtian strands (Figures 6B). To further verify the NPF2.4 localisation, yellow Downloaded from on June 14, 201711 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 248 fluorescent protein (YFP) was fused to the 5′ end of NPF2.4 and transiently expressed in 249 Arabidopsis mesophyll protoplasts. Figures 6C to 6F show that NPF2.4-associated YFP 250 fluorescence overlapped with the CFP fluorescence of the plasma membrane marker 251 ECFP::Rop11 (Munns et al., 2012). 252 253 NPF2.4 facilitates Cl– movement across the cell membrane when expressed in Xenopus 254 laevis oocytes 255 To test whether NPF2.4 was able to facilitate Cl– transport, two-electrode voltage clamping 256 (TEVC) of Xenopus laevis oocytes injected with NPF2.4-cRNA was performed. When the 257 plasma membrane of NPF2.4-cRNA injected oocytes was clamped at a negative membrane 258 potential (i.e. that common to plant cells), an inward current was induced in the presence of 259 external Cl–, which was consistent with the efflux of anions from the oocytes into the 260 extracellular medium through NPF2.4 (Figure 7A; Supplemental Figure 2A). To examine 261 whether Cl– transport activity of NPF2.4 was affected by H+ concentration (as suggested by 262 the original annotation of NPF2.4 as a proton-dependent oligo-peptide transporter), oocytes 263 were incubated in 50 mM Cl– at pH values of either 7.5 or 5.5. No pH dependency of the 264 inward current was observed (Figure 7B; Supplemental Figure 2B and 2C). The magnitude of 265 inward current carried by NO3– and Cl– was compared in NPF2.4-injected oocytes and 266 controls, it was shown that negative currents were much larger and conductance was higher 267 when Cl– was the external anion, rather than NO3– (Figures 7C and 7D; Supplemental Figure 268 2D – 2G); the PCl–/PNO3– permeability ratio of NPF2.4 was calculated to be 4.4 ± 0.8 (with 269 either 50 mM NaCl or NaNO3 in the bathing solution). To distinguish whether the observed 270 inward currents at negative membrane potentials were associated with movements of Cl– or 271 Na+, oocytes pre-injected with NPF2.4-cRNA or water were incubated in the solutions 272 having a constant concentration of Na+ (45 mM) with increasing concentrations of Cl– (0, 5, 273 10, 25, 50 mM), the inward currents observed were larger when increased Cl– concentration 274 in the external solution (Figure 7E; Supplemental Figure 2H and 2I). When used solutions 275 that have a constant concentration of Cl– (45 mM) with increasing concentrations of Na+ (0, 5, 276 10, 25, 50 mM), similar association between external Na+ concentrations and the size of 277 inward currents was observed (Figure 7F; Supplemental Figure 2J and 2K). The effect of 278 different cations on the stimulation of Cl–-carrying currents was examined, and found not to 279 be Na+ specific, K+ also stimulated Cl–-carrying currents, whereas NMDG+, Ca2+ and Mg2+ 280 did not (Figure 7G; Supplemental Figure 2L). When Na+ was present in the absence of Cl–, Downloaded from on June 14, 201712 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 281 no detectible currents were observed (Figure 7A, Figure 7G; Supplemental Figure 2L). To 282 test if Na+ is only activating the transport of Cl– by NPF2.4, not being co-transported with Cl–, 283 Elemental content of Cl–, Na+ and K+ was measured in both NPF2.4-cRNA- and water- 284 injected oocytes incubated in Ca2+ ringer solution for 2 d with and without a 2 h low NaCl 285 treatment. NPF2.4-cRNA injected oocytes had a significantly lower (P < 0.001) Cl– level 286 compared with water-injected controls. No significant difference was observed in Na+ content 287 or K+ content between NPF2.4-cRNA injected oocytes and water-injected controls (Figure 288 7H). To test whether the observed outward currents at positive membrane potentials (Figure 289 7C) were due to Cl– entering the cell through NPF2.4, a unidirectional 36Cl– influx assay for 290 NPF2.4- and water-injected oocytes was performed by incubation in solutions containing 100 291 mM NaCl or 100 mM NMDG-Cl spiked with low activities of 36Cl– for 60 mins (Figure 7I). 292 Oocytes injected with NPF2.4-cRNA exhibited significantly greater uptake of 36Cl– than the 293 water-injected oocytes in presence of NaCl. This stimulated influx was not affected by 294 changes in pH values of 7.5 and 5.5 (Figure 7I). When NaCl was replaced with NMDG-Cl, 295 there was not a significant increase in the uptake of 36Cl– in NPF2.4-cRNA injected oocytes 296 compared to water-injected controls at both pH values tested (Figure 7I). A unidirectional 297 Na+ uptake assay, using oocytes incubated in 100 mM NaCl solution spiked with 298 confirmed that there was no trans-membrane movement of Na+ through NPF2.4 299 (Supplemental Figure 2M). 22 Na+, 300 301 Knockdown of NPF2.4 resulted in reduced shoot Cl– accumulation 302 Putative Atnpf2.4 T-DNA knockouts were ordered from stock centres, but no plants 303 containing an insert within NPF2.4, and/or lacking NPF2.4 expression could be identified 304 (Supplemental Figure 3). Therefore, to elucidate the function of NPF2.4 in planta, artificial 305 microRNAs (amiRNAs) were designed to knockdown NPF2.4 expression. These were 306 transformed into Col-0 plants. Quantitative RT-PCR showed that T2 amiRNA plants had 50% 307 to 80% lower transcript abundance of NPF2.4 compared with the null segregants (Figure 8A). 308 These amiRNA plants were shown to have significantly less Cl– in the shoot when grown 309 under a low salt conditions (2 mM NaCl) (21 – 32% lower Cl–) (Figure 8B). Meanwhile, 310 shoot NO3– content (Figure 8C), as well as Na+ and K+ (Supplemental Figure 4A and 4B), 311 remained similar between knockdown lines and null segregants. Under a high salt load (75 312 mM NaCl), when the endogenous NPF2.4 expression ordinarily decreased in such conditions 313 (Figure 3B), the transcript abundance of NPF2.4 in the amiRNA knockdown lines and null Downloaded from on June 14, 201713 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 314 segregants was at a similar low level (Supplemental Figure 4C), and no significant difference 315 in shoot Cl– concentration was found (Supplemental Figure 4D). Transcript levels of NPF2.5, 316 the closest homolog of NPF2.4, were found to be unaffected in the root of NPF2.4 317 knockdown lines when compared with null segregants (Supplemental Figure 4E). 318 319 Constitutive over-expression of NPF2.4 resulted in increased Cl– accumulation in the 320 shoot 321 To investigate the effect of constitutive over-expression of NPF2.4 on shoot Cl– 322 accumulation, NPF2.4 was constitutively over-expressed in Col-0 plants under the control of 323 a 35S promoter. Two independent T3 NPF2.4 over-expression lines were grown for 4 weeks 324 in hydroponics before being exposed to 2 mM or 75 mM NaCl for 5 d. Greater NPF2.4 325 mRNA levels were observed in both NPF2.4 over-expression lines as detected by qRT-PCR 326 (Supplemental Figure 5). After the 75 mM NaCl treatment, Cl– accumulation in the shoot was 327 higher in both over-expression lines compared to the null segregants, with OEX-NPF2.4-2 328 exhibiting a significant increase of 23 % (Figure 9A). At the same time, no significant 329 difference in shoot content of NO3– was found between the transgenic lines and null 330 segregants (Figure 9B). Small but non-significant increases in shoot Cl– accumulation were 331 observed in NPF2.4 over-expression lines grown in 2 mM NaCl (Figure 9C), while no 332 alternation in shoot content of NO3– was observed (Figure 9D). Downloaded from on June 14, 201714 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 333 Discussion 334 NPF2.4 meets many of the predicted characteristics for a gene encoding an anion channel 335 involved in loading Cl– to the root xylem. It encodes a protein targeted to the plasma 336 membrane of root stelar cells in Arabidopsis (Figures 4 and 6) and its expression is strongly 337 down-regulated by salt and ABA treatment (Figure 3 and 5). NPF2.4 was found to facilitate 338 Cl–-dependent currents across the cell membrane at negative membrane potentials when 339 expressed in Xenopus laevis oocytes (Figure 7A), and Cl– transport was not affected by 340 changes in external pH (Figures 7B and 7I). This is consistent with the predicted mechanism 341 of xylem loading for Cl–, where the difference in electrochemical potential for Cl– across the 342 plasma membrane of cells in the stele favours passive Cl– efflux into the xylem, without the 343 need for direct expenditure of energy (Teakle and Tyerman, 2010). 344 At more positive membrane potentials, the presence of outward currents in NPF2.4-injected 345 oocytes indicates that NPF2.4 can also mediate Cl– influx into cells (Figure 7C). This was 346 confirmed in NPF2.4 expressing oocytes using a 347 inwardly directly Cl– fluxes were dependent, in the conditions tested, upon the presence of 348 Na+ and were absent when NMDG+ was the balancing cation (Figure 7I). However, it appears 349 Cl– transport was not exclusively dependent upon the presence of Na+, as when K+ was 350 present but not H+, Ca2+, Mg2+ or NMDG+, there were also significant Cl– dependent currents 351 (Figures 7F and G). Only Cl– concentration differences and not Na+ or K+ were detected in 352 NPF2.4-injected oocytes (Figure 7H), and no inwardly directed Na+ fluxes were detected 353 (Supplementary Figure 2M). These data indicate that both monovalent cations K+ and Na+ are 354 likely to activate Cl– transport but not be carried by NPF2.4, and it is likely that the in vivo 355 activating cation is K+ in low salt conditions. Under high salt (NaCl) conditions, currents 356 carried by NPF2.4 are likely to be minimised by the lower expression levels of NPF2.4 357 despite a higher concentration of another activating cation. Interestingly, the transport 358 properties of NPF2.4 appear to be specific to Cl–, with no indication of the protein being 359 involved in NO3– transport (Figures 7C and 7D), which is unique when compared with other 360 published NPF2s that are generally permeable to NO3– (Segonzac et al., 2007; Tsay et al., 361 2007; Léran et al., 2014). Combining all evidence, it is suggested that, at negative membrane 362 potentials, NPF2.4 facilitates Cl– efflux across cell membranes, consistent with its proposed 363 role in facilitating a component of the loading of Cl– into the xylem in Arabidopsis. 36 Cl– uptake assay (Figure 7I). These Downloaded from on June 14, 201715 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 364 The use of transgenic plants demonstrated that altering levels of NPF2.4 expression could 365 affect shoot Cl– accumulation but not that of NO3–, Na+ and K+ (Figure 8F, 9B, 9D and 366 Supplemental Figure 4A, 4B). This ion profile provides further evidence that Na+ and K+ are 367 not transported by NPF2.4. Reduction in expression of NPF2.4 in Arabidopsis using 368 amiRNA resulted in decreased Cl– accumulation in the shoot (Figures 8A and 8B; 369 Supplemental Figure 4A), while NPF2.4 over-expression resulted in increased shoot Cl– 370 content (under high salt conditions) (Figures 9A and 9C), thus indicating a role for NPF2.4 in 371 the accumulation of Cl– in Arabidopsis shoots. The increased Cl– accumulation in NPF2.4 372 overexpression lines was not significant in low salt conditions (Figure 9C). Møller et al. 373 (2009) previously observed that the loss of cell specificity when constitutively 374 overexpressing AtHKT1;1 may not in all conditions lead to an expected change in ion profile, 375 with the use of gene knockouts or cell specific complementation being more reliable. In the 376 present study, amiRNA knockdown was performed to lend a greater cell type specificity 377 when manipulating expression of NPF2.4. Reducing expression of NPF2.4 by 80% under a 378 low salt condition (2 mM NaCl), without affecting the expression of genes that are 379 homologous to NPF2.4, resulted in a decrease in the shoot accumulation of Cl– by up to 31% 380 when compared with the null segregants (Figure 8A, 8B and Supplemental Figure 4E), 381 however, this was insufficient to account for a measurable difference in growth 382 (Supplemental Figure 6). Due to the nature of the amiRNA system, knocking down the 383 expression of NPF2.4 does not completely remove its transcript, thus still leaving small 384 amounts of NPF2.4 mRNA that can be translated into a functioning protein. Unfortunately no 385 lines with NPF2.4 completely knocked-out could be identified to test whether a lack of 386 NPF2.4 expression resulted in a greater reduction of shoot Cl–. Under high salt conditions (75 387 mM NaCl), the endogenous down-regulation of NPF2.4 expression (Figure 3) resulted in 388 similar levels of NPF2.4 expression in both knockdowns and null segregants (Supplemental 389 Figure 4C), thus as expected, no difference in shoot Cl– concentration was found 390 (Supplemental Figure 4D). 391 Cl– xylem loading is a complex process, as revealed by at least 3 anion conductances 392 identified in stelar protoplasts (Kohler and Raschke, 2000; Gilliham and Tester, 2005). The 393 electrophysiological profiles of NPF2.4 in Xenopus oocytes did not resemble QUAC, the 394 likely major conductance for Cl– loading into the xylem. Firstly, there was a lack of 395 rectification (Figure 7C). This suggests the involvement of other transport proteins and/or 396 regulators in the loading of Cl– into the xylem (Roy et al., 2008). Furthermore, NPF2.4- Downloaded from on June 14, 201716 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 397 induced currents in oocytes were considerably smaller in the presence of NO3– compared to 398 Cl– (Figure 7C, Figure 7D), whereas X-QUAC type currents were much more permeable to 399 NO3– compared to Cl– (Kohler and Raschke, 2000; Gilliham and Tester, 2005). From the 400 plant data it is clear that NPF2.4 is not the only transporter that facilitates the loading of Cl– 401 into the transpiration stream. Shoot Cl– is reduced by 31% relative to controls, and shoot 402 NO3– remains unchanged when there is an 80% reduction in NPF2.4 expression in the 403 amiRNA lines indicating that other mechanisms contribute to the remaining Cl– loading 404 (Figure 8A and 8B). There are other anion transporters in Arabidopsis that may contribute to 405 Cl– xylem loading, many of which contribute to NO3– loading, such as NRT1.5/NPF7.3 and 406 NRT1.8/NPF7.2 (Lin et al., 2008; Li et al., 2010), SLAH1 and SLAH3, a root-stelar specific 407 homolog of SLAC1 (a protein responsible for Cl- efflux from guard cells) (Negi et al., 2008; 408 Vahisalu et al., 2008) and CCC (Colmenero-Flores et al., 2007). Interestingly, 409 NRT1.5/NPF7.3 and NRT1.8/NPF7.2 were shown to be down- and up- regulated respectively, 410 by salt stress, with nrt1.5/npf7.3 knockout plants exhibiting improved salinity tolerance (Lin 411 et al., 2008; Li et al., 2010; Chen et al., 2012). The involvement of these other proteins in Cl– 412 transport has not yet been reported. 413 The reduction in NPF2.4 expression after the application of ABA and the suggestion of 414 ABA’s role in regulating Cl– transport from the root to the shoot warrants further study. ABA 415 is a signal known to down-regulate Cl– loading of the shoot and the conductances that are 416 responsible for this flux (Cram and Pitman, 1972; Gilliham and Tester, 2005), whereas in 417 stomatal guard cells ABA activates Cl– efflux from cells (Negi et al., 2008; Vahisalu et al., 418 2008; Geiger et al., 2009; Lee et al., 2009; Vahisalu et al., 2010). Therefore, it will be 419 interesting to explore the differences in ABA signalling pathways for these processes that 420 differentially regulate anion efflux from root and shoot cells. 421 The Cl– transport activity of NPF2.4 observed in this study adds to the list of solutes 422 transported by members of the NPF. To date, NO3–, dipeptides, histidine, malate, 423 glucosinolate, auxin and ABA have been reported as substrates transported by various NPFs 424 (Yamashita et al., 1997; Zhou et al., 1998; Jeong et al., 2004; Krouk et al., 2010; Kanno et al., 425 2012; Nour-Eldin et al., 2012). The increasing volume of genomic and functional evidence on 426 the roles of the NPF will assist in addressing the question posed by Tsay et al. as to why 427 plants have so many NPF genes (53 in Arabidopsis and 80 in rice) while yeast, drosophila 428 and humans have only one, three, and six members, respectively (Tsay et al., 2007). NPF 429 transporters identified from organisms other than higher plants are di-/tri- peptide transporters, Downloaded from on June 14, 201717 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 430 it was therefore speculated that the NO3– transport activity of this family in Arabidopsis has 431 evolved from an ancient peptide transporter (Stacey et al., 2002; Tsay et al., 2007). Since then, 432 the NPF has expanded, presumably to fill specific transport roles in specific environments, 433 making this family increasingly diverse. 434 In conclusion, NPF2.4 is a protein involved in Cl– xylem loading in Arabidopsis, regulating 435 Cl– accumulation in the shoot in response to salt stress. To our knowledge, the identification 436 and functional characterisation of NPF2.4 has, for the first time, revealed the molecular 437 properties of a protein that loads Cl– into the xylem. As such, NPF2.4 may be a target for 438 improving plant salinity tolerance in crops that are sensitive to Cl– accumulation. Further 439 research is needed to investigate whether NPF2.4 orthologs are involved in salinity tolerance 440 in other plant species and whether manipulation of NPF2.4-like genes, and other genes 441 involved in Cl– transport to the shoot of crop plants is important for alleviating Cl– toxicity. 442 Downloaded from on June 14, 201718 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 443 Methods 444 Plant material and growth conditions 445 Plant material: 446 T-DNA knockout lines (SALK_111056 and SALK_111071), which were annotated with the 447 T-DNA site of insertion being in the NPF2.4 gene, as well as Col-0 Arabidopsis seeds were 448 obtained from the European Arabidopsis Stock Centre (Nottingham, UK). 449 Soil grown Arabidopsis: 450 Arabidopsis was grown in soil prepared following the methods described in Møller et al. 451 (2009). Plants were kept with light/dark photo periods of either 16 h/8 h (long-day) or 10 452 h/14 h (short-day). Temperature was maintained between 21°C to 23°C; humidity was 453 optimized between 60% and 75%; photon irradiance at the level of plant the leaves was 454 approximately 120 μmol m-2 s-1. 455 Hydroponics grown Arabidopsis: 456 Arabidopsis plants were germinated and grown in hydroponics following the method 457 described in Conn et al. (2013). Growth conditions were similar to those for soil grown plants. 458 At time of salt application, NaCl solutions of different concentrations as indicated in the text 459 were applied to the growth solution four weeks after germination with supplemental Ca2+ 460 added. 461 Expression analysis 462 Gene expression analysis by qRT-PCR was performed following the method described in 463 Burton et al. (2008). The primers for determining NPF2.4 expression were 5ʹ 464 CAGAAGCTAATCCGCAAACC 3ʹ (Forward) and 5ʹ AGGAACCAGCCATAGCACTG 3ʹ 465 (Reverse). 466 described in Jha et al. (2010). 467 Phylogenetic analysis 468 Multiple amino acid sequence alignment was performed with ClustalW2. Proteins used in the 469 alignment included characterised Arabidopsis NPFs and seven members of the NAXT 470 subfamily as shown in the table below. Protein sequences were retrieved from the 471 Arabidopsis genome annotation database release 9 (http://www.arabidopsis.org/). Neighbour- The selected control genes and data normalisations followed the protocols Downloaded from on June 14, 201719 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 472 joining phylogenetic tree was generated using Mega5, with 5000 bootstrap iterations (Tamura 473 et al., 2011). 474 Protein 3D structural modelling 475 3D models of NPF2.4 were constructed and evaluated as described in Cotsaftis et al. (2012) 476 using two structural templates: (i) a proton dependent oligopeptide transporter from 477 Shewanella oneidensis (Newstead et al., 2011) (PDB accession 2XUT), and (ii) a NO3– 478 transporter from Arabidopsis in complex with the NO3– ion (Sun et al., 2014) (PDB accession 479 4OH3). The amino acid sequences of 2XUT (488 residues) and 4OH3 (553 residues, NO3– 480 ion replaced by Cl– ion) were aligned with NPF2.4 (503 and 528 residues) using Local Meta- 481 Threading Server (LOMETS) (Wu and Zhang, 2007), Alignment Annotator (Gille et al., 482 2014), followed by manual alignment adjustments. The aligned sequences were used as input 483 parameters to generate 3D models of NPF2.4 using Modeller 9v8 (Sali and Blundell, 1994) 484 on a Linux station, running the Fedora 12 operating system. Three types of 3D models (using 485 2XUT or 4OH3 as the templates, the latter with and without Cl–) were selected from 40 486 models, based on their low value of the Modeller 9v8 objective function and the most 487 favourable DOPE energy scoring parameters (Shen and Sali, 2006). Images of structural 488 models were generated in the PyMol Molecular Graphics System, Version 1.3 Schrödinger, 489 LLC. 490 Generation of NPF2.4 over-expression lines and NPF2.4 amiRNA knockdown lines 491 492 amiRNA NPF2.4: Web MicroRNA Designer (http://wmd2.weigelworld.org/cgi-bin/mirnatools.pl) (Schwab et 493 al., 2006) was used to design two amiRNA constructs to knockdown NPF2.4 gene expression. 494 Two 21 bp target sequences were identified from the NPF2.4 CDS, allowing the generation 495 of two independent amiRNA constructs. A set of primers (Supplemental Table 2) was used to 496 incorporate the 21 bp amiRNA sequence into the MIR319a vector (Schwab et al., 2006). The 497 amiRNA constructs then were cloned into pCR8 and transferred to pTOOL2 (Roy et al., 2013) 498 by a LR reaction (Invitrogen) and transformed into Arabidopsis Col-0 plants using 499 Agrobacterium-mediated transformation (Clough and Bent, 1998; Weigel and Glazebrook, 500 2002). Downloaded from on June 14, 201720 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 501 35S:NPF2.4: 502 cDNA of NPF2.4 was amplified using Platinum Taq (Invitrogen, CA) and cloned into 503 Gateway® enabled pCR8 entry vector (Invitrogen, CA). NPF2.4 was transferred from pCR8 504 to the pTOOL2 destination vector (Roy et al., 2013) using LR Clonase II (Invitrogen, CA) 505 and transformed into Arabidopsis Col-0 plants using Agrobacterium-mediated floral dip 506 transformation (Clough and Bent, 1998; Weigel and Glazebrook, 2002). 507 508 Promoter GUS fusions. The primers 5ʹ TAGAGAAGAAGACTATCATGGG 509 GGAGGTACTTTGACTTGTGTTTGAG 3ʹ (Reverse) were used to amplify 1.5 kb of the 510 sequence upstream from the start codon of NPF2.4. This fragment was cloned into pCR8 and 511 transferred by LR reaction into pMDC162 to drive UidA expression. The destination vector 512 was transformed into Arabidopsis Col-0 plants using the Agrobacterium-mediated method 513 (Clough and Bent, 1998; Weigel and Glazebrook, 2002). Two-week old T2 proNPF2.4:UidA 514 plants were stained for GUS activity for 1 h following the protocol described in Weigel and 515 Glazebrook (2002). GUS activity was visualised using a Leica MZ16FA stereo microscope 516 (Leica microsystem, Wetzlar, Germany). To prepare transverse sections of roots of 517 proNPF2.4:UidA plants, GUS stained material was washed with milliQ water and fixed at 518 4 °C overnight using 0.1 M phosphate buffer with 5 % glutaraldehyde. Samples were washed 519 twice with 1 × PBS for 10 min each and embedded in 1 % agarose. Tissue was dehydrated by 520 15 min incubations in an ethanol series of 50%, 70%, 90%, 100% (v/v). Samples were 521 transferred to Technovit 7100 hydroxyethyl methacrylate resin solution with 2.5% (v/v) 522 PEG400 and polymerised in thin-walled PCR tubes. 8 µm thick transverse root sections were 523 cover slipped in DPX mountant, and imaged on a Leica ASLMD compound microscope 524 equipped with a DFC480 CCD camera. 525 To test the effect of the salt treatments on GUS activity, proNPF2.4:UidA plants were grown 526 vertically on ½ MS media for 7 d before transferred onto ½ MS media containing 0 mM, 75 527 mM or 150 mM NaCl for a 5-d salt treatment. Salt treated plants were GUS-stained for 1 h 528 and examined under a Leica MZ16FA stereo microscope (Leica microsystem, Wetzlar, 529 Germany). A fluorescent 4-methylumelliferyl-β-Galactopyranoside (MUG) assay was 530 performed to quantify the GUS activity of proNPF2.4:UidA plants after the salt treatments 531 following the protocol as described in Peña (2004). 3ʹ (Forward) Downloaded from on June 14, 201721 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. and 5ʹ 532 NPF2.4::GFP fusion constructs and visualization of fluorescence in planta 533 To determine the subcellular localisation of NPF2.4 in planta, GFP6 was fused to either the 5′ 534 and 3′ end of NPF2.4 and used for constructing GFP::NPF2.4 and NPF2.4::GFP. The 535 coding sequence of NPF2.4 was inserted into the destination vectors pMDC44 and pMDC83 536 (Curtis and Grossniklaus, 2003) to generate the necessary vectors. The fusion vectors were 537 transformed into Arabidopsis Col-0 plants using an Agrobacterium-mediated method (Clough 538 and Bent, 1998; Weigel and Glazebrook, 2002). T2 transgenic plants were geminated on ½ 539 MS media under hygromycin selection. 10 d after the germination, plants were stained with 540 10 µg/ml propidium iodide for 5 min and rinsed with deionised water. Plasmolysis was 541 conducted on a slide by applying 10 % (w/v) sucrose solution on to the roots of GFP6 542 expressing plants. GFP (excitation 488 nm, emission 505-530 nm) and PI (excitation 543 nm, 543 emission longpass 560 nm) fluorescence were visualised using a LSM5 PASCAL laser 544 scanning microscope (Carl Zeiss, Jena, Germany) running PASCAL imaging software 545 (version 3.2 SP2, Carl Zeiss). 546 Arabidopsis mesophyll cell transient transformation 547 To determine the subcellular localisation of NPF2.4 in Arabidopsis protoplasts, YFP was 548 fused to the 5ʹ end of NPF2.4 by cloning the coding sequence of NPF2.4 into the destination 549 vector pattR-YFP (Subramanian et al., 2006). A protein known to be targeted to the plasma 550 membrane (ROP11) was used as a positive control (eCFP::ROP11; Molendijk et al., 2008). 551 Protoplast isolation from Arabidopsis mesophyll cells and PEG-mediated transient 552 transformation were conducted using the protocols described in Yoo et al. (2007) to introduce 553 the fusion vector. CFP (excitation 436nm, emission 470-535) and YFP (excitation 514, 554 emission 525-610 nm) fluorescence were visualised using a LSM5 PASCAL laser scanning 555 microscope (Carl Zeiss, Jena, Germany) running PASCAL imaging software (version 3.2 556 SP2, Carl Zeiss). 557 Electrophysiology 558 TEVC 559 A pGEMHE-DEST destination vector (Shelden et al., 2009) was developed for heterologous 560 expression of NPF2.4 in Xenopus laevis oocytes. cRNA was transcribed from this vector 561 using mMESSAGE mMACHINE kit (Ambion, Austin, TX) following the manufacturer’s 562 instructions, and injected into the following Munns et al. (2012). Two-electrode voltage 563 clamping was performed following Roy et al. (2008). Osmolarities of all solutions were Downloaded from on June 14, 201722 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 564 adjusted using mannitol (Sigma, USA) to 240-260 mOsmol/kg (Fiske® 210 Micro-Sample 565 Osmometer, Advanced Instruments, USA). Membrane currents were recorded in solutions 566 containing 5 mM MES, 2 mM Ca-gluconate ± NMDG-Cl (or NaCl) or NMDG-NO3 (or 567 NaNO3) as indicated. Data were acquired and analysed using pClamp 8.2 (Axon Instruments, 568 Union City, CA). Experiments were repeated using oocytes harvested from different Xenopus 569 laevis surgeries. 570 Isotope uptake assay (36Cl– and 22Na+) 571 Xenopus laevis oocytes microinjected with either NPF2.4 cRNA or water were prepared for 572 36 573 isethionate, 2 mM potassium gluconate, 1.8 mM calcium gluconate, 1 mM magnesium 574 gluconate, 5 mM HEPES, 2.5 mM sodium pyruvate and 5 % gentamicin, pH 7.4) for 120 min 575 2 d after injection. Oocytes were then incubated in uptake buffer (100 mM NaCl, 2 mM Ca- 576 gluconate, 2 mM K-gluconate and 5 mM MES, 240 mOsm kg-1 H2O, pH 7.5) supplemented 577 with 1 µCi/mL of Na36Cl (Radiochemical Centre Limited, Amersham, England.) or 2 µCi/mL 578 22 579 cold uptake buffer, which did not contain 580 oocyte transferred into 1.5 ml microcentrifuge tubes containing 20 µL of 0.1 M nitric acid 581 and macerated by pipetting or transferred to scintillation vials containing 200 µL of 10% SDS 582 and left overnight. 4 mL of scintillation fluid was added to each scintillation vial. 583 Radioactivity, counts per minute, of 584 scintillation counter (Perkin Elmer, USA) or a Beckman Coulter LS6500 scintillation counter 585 (Gladesville, Australia). 586 Elemental analysis of Cl–, Na+, K+ and NO3– 587 Concentration of Cl–, Na+, K+ and NO3– was determined in the whole shoot of Arabidopsis 588 seedlings. The shoot was weighed, freeze-dried and ground into a powder. To determine 589 Arabidopsis shoot and Xenopus laevis oocyte Cl– concentrations, approximately 10-20 mg of 590 material was digested in 2 mL of 1% nitric acid at 80°C overnight and 10 oocytes were 591 digested in 1 mL of 1% nitric acid at 75°C for 2 h. Cl– content was analysed using a Chloride 592 Analyser (Sherwood Scientific model 926, Cambridge, UK) following the manufacturer’s 593 instructions. The NO3– assay described in Kamphake et al. (1967) was used for the 594 determination of the NO3– concentration in plant tissue. To examine Na+ and K+ in plants or 595 oocytes the youngest fully expanded leaf or incubated oocytes were harvested and digested in 596 1% nitric acid at 80°C overnight for plant tissues or 75°C for 2 h for oocytes following Byrt Cl– and 22 Na+ uptake. Oocytes were incubated in Cl– free ND96 media (96 mM sodium NaCl (PerkinElmer, Massachusetts, USA) for 1 h. The oocytes were washed twice with ice- 36 36 Cl– or Cl– or 22 22 Na+, respectively and each individual Na+ was measured using a Tri-Carb liquid Downloaded from on June 14, 201723 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 597 et al. 2014. Samples were diluted and measured relative to appropriate standard solutions 598 using a model 420 Flame Photometer (Sherwood Scientific Ltd, Cambridge, United 599 Kingdom). 600 Acknowledgements 601 The authors thank: Andrew Jacobs for the destination vectors used in this study; Yuan Li for 602 performing the qRT-PCRs (Australian Centre for Plant Function Genomics, Adelaide, 603 Australia); Steven Tyerman and Sunita Ramesh (University of Adelaide, Adelaide, Australia) 604 for the aid with the electrophysiology experiments; Detlef Weigel (Max Planck Institute for 605 Developmental Biology, Tübingen, Germany) for providing pRS300 plasmid for the 606 generation of amiRNA constructs and Christina Morris for editing English language of this 607 manuscript. 608 609 610 Conflict of interests 611 The authors declare that they have no conflict of interests. 612 613 614 Supplemental Figure 1 Multiple sequence alignment of NPF2.4, NPF2.3 and NPF2.1/ 615 NAXT1. 616 Supplemental Figure 2 Raw and control data for expression of NPF2.4 in Xenopus laevis 617 oocytes. 618 Supplemental Figure 3 NPF2.4 transcript levels of lines SALK_111056 and SALK_111071 619 annotated as T-DNA knockouts for NPF2.4 showed the failed disruption of NPF2.4 620 expression in both lines 621 Supplemental Figure 4 Under low salt condition, shoot concentration of both Na+ and K+ 622 were similar between NPF2.4 knockdowns and null segregants. Downloaded from on June 14, 201724 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 623 Supplemental Figure 5 Expression validation of NPF2.4 in the root of NPF2.4 over- 624 expression lines under both low salt and high salt conditions. 625 Supplemental Figure 6 Biomass of NPF2.4 knockdowns was unaffected by low salt 626 condition compared to null segregants. 627 Supplemental Table 1 The ABA signaling pathway associated cis-acting elements in the 628 putative promoter region of NPF2.4. 629 Supplemental Table 2 Primers used for the generation of NPF2.4-amiRNA constructs. 630 Downloaded from on June 14, 201725 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 631 References 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 Abel GH (1969) Inheritance of the capacity for chloride inclusion and chloride exclusion by soybeans. Crop Sciences 9: 697-698 Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell 15: 63-78 Abe H, Yamaguchi-Shinozaki K, Urao T, Iwasaki T, Hosokawa D, Shinozaki K (1997) Role of Arabidopsis MYC and MYB homologs in drought- and abscisic acidregulated gene expression. Plant Cell 9: 1859-1868 Apse MP, Blumwald E (2007) Na+ transport in plants. FEBS Letters 581: 2247-2254 Barrett T, Wilhite SE, Ledoux P, Evangelista C, Kim IF, Tomashevsky M, Marshall KA, Phillippy KH, Sherman PM, Holko M, Yefanov A, Lee H, Zhang N, Robertson CL, Serova N, Davis S, Soboleva A. (2013) NCBI GEO: archive for functional genomics data sets--update. Nucleic Acids Research 41, D991-D995 Bassil E, Blumwald E (2014) The ins and outs of intracellular ion homeostasis: NHX-type cation/H+ transporters. Current Opinion in Plant Biology 22: 1-6 Beilby MJ, Walker NA (1981) Chloride transport in Chara: I. Kinetics and current-voltage curves for a probable proton symport. Journal of Experimental Botany 32: 43-54 Berthomieu P, Conejero G, Nublat A, Brackenbury WJ, Lambert C, Savio C, Uozumi N, Oiki S, Yamada K, Cellier F, Gosti F, Simonneau T, Essah PA, Tester M, Very A-A, Sentenac H, Casse F (2003) Functional analysis of AtHKT1 in Arabidopsis shows that Na+ recirculation by the phloem is crucial for salt tolerance. The EMBO Journal 22: 2004-2014 Burton RA, Jobling SA, Harvey AJ, Shirley NJ, Mather DE, Bacic A, Fincher GB (2008) The genetics and transcriptional profiles of the cellulose synthase-like HvCslF gene family in barley. Plant Physiology 146: 1821-1833 Byrt CS, Platten JD, Spielmeyer W, James RA, Lagudah ES, Dennis ES, Tester M, Munns R (2007) HKT1;5-like cation transporters linked to Na+ exclusion loci in wheat, nax2 and kna1. Plant Physiology 143: 1918-1928 Chen C-Z, Lv X-F, Li J-Y, Yi H-Y, Gong J-M (2012) Arabidopsis NRT1.5 is another essential component in the regulation of nitrate reallocation and stress tolerance. Plant Physiology 159: 1582-1590 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. The Plant Journal 16: 735-743. Cole PJ (1985) Chloride toxicity in citrus. Irrigation Science 6: 63-71 Colmenero-Flores JM, Martinez G, Gamba G, Vazquez N, Iglesias DJ, Brumos J, Talon M (2007) Identification and functional characterization of cation-chloride cotransporters in plants. The Plant Journal 50: 278-292 Conn SJ, Hocking B, Dayod M, Xu B, Athman A, Henderson S, Aukett L, Conn V, Shearer MK, Fuentes S (2013) Protocol: optimising hydroponic growth systems for nutritional and physiological analysis of Arabidopsis thaliana and other plants. Plant methods 9: 4 Downloaded from on June 14, 201726 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 Cotsaftis O, Plett D, Shirley N, Tester M, Hrmova M (2012) A two-staged model of Na+ exclusion in rice explained by 3D modeling of HKT transporters and alternative splicing. PLoS ONE 7: e39865 Cram W, Pitman M (1972) The action of abscisic acid on ion uptake and water flow in plant roots. Australian Journal of Biological Sciences 25: 1125-1132 Curtis MD, Grossniklaus U (2003) A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiology 133: 462-469 Davenport RJ, Munoz-Mayor A, Jha D, Essah PA, Rus ANA, Tester M (2007) The Na+ transporter AtHKT1;1 controls retrieval of Na+ from the xylem in Arabidopsis. Plant, Cell & Environment 30: 497-507 Evrard A (2013) Cell type-specific transcriptional responses of plants to salinity. PhD thesis, The University of Adelaide, Adelaide, Australia Evrard A, Bargmann BR, Birnbaum K, Tester M, Baumann U, Johnson AT (2012) Fluorescence-activated cell sorting for analysis of cell type-specific responses to salinity stress in Arabidopsis and rice. In S Shabala, TA Cuin, eds, Plant Salt Tolerance, Vol 913. Humana Press, pp 265-276 Felle HH (1994) The H+/Cl– symporter in root-hair cells of Sinapis alba (an electrophysiological study using ion-selective microelectrodes). Plant Physiology 106: 1131-1136 Gaymard F, Pilot G, Lacombe B, Bouchez D, Bruneau D, Boucherez J, MichauxFerriere N, Thibaud JB, Sentenac H (1998) Identification and disruption of a plant shaker-like outward channel involved in K+ release into the xylem sap. Cell 94: 647655 Geiger D, Scherzer S, Mumm P, Marten I, Ache P, Matschi S, Liese A, Wellmann C, AlRasheid KAS, Grill E, Romeis T, Hedrich R (2010) Guard cell anion channel SLAC1 is regulated by CDPK protein kinases with distinct Ca2+ affinities. Proceedings of the National Academy of Sciences 107: 8023-8028 Geiger D, Scherzer S, Mumm P, Stange A, Marten I, Bauer H, Ache P, Matschi S, Liese A, Al-Rasheid KAS, Romeis T, Hedrich R (2009) Activity of guard cell anion channel SLAC1 is controlled by drought-stress signaling kinase-phosphatase pair. Proceedings of the National Academy of Sciences 106: 21425-21430 Geilfus C-M, Mithöfer A, Ludwig-Müller J, Zörb C, Muehling KH (2015) Chlorideinducible transient apoplastic alkalinizations induce stomata closure by controlling abscisic acid distribution between leaf apoplast and guard cells in salt-stressed Vicia faba. New Phytologist DOI: 10.1111/nph.13507 Gille C, Birgit W, Gille A (2014) Sequence alignment visualization in HTML5 without Java. Bioinformatics 30: 121-122 Gilliham M, Tester M (2005) The regulation of anion loading to the maize root xylem. Plant Physiology 137: 819-828 Gong H, Blackmore D, Clingeleffer P, Sykes S, Jha D, Tester M, Walker R (2011) Contrast in chloride exclusion between two grapevine genotypes and its variation in their hybrid progeny. Journal of Experimental Botany 62: 989-999 Guan R, Qu Y, Guo Y, Yu L, Liu Y, Jiang J, Chen J, Ren Y, Liu G, Tian L, Jin L, Liu Z, Hong H, Chang R, Gilliham M, Qiu L (2014) Salinity tolerance in soybean is modulated by natural variation in GmSALT3. The Plant Journal 80: 937-950 Henderson SW, Baumann U, Blackmore DH, Walker AR, Walker RR, Gilliham M (2014) Shoot chloride exclusion and salt tolerance in grapevine is associated with differential ion transporter expression in roots. BMC Plant Biology 14: 273 Downloaded from on June 14, 201727 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 Horie T, Hauser F, Schroeder JI (2009) HKT transporter-mediated salinity resistance mechanisms in Arabidopsis and monocot crop plants. Trends in Plant Science 14: 660-668 James RA, Davenport RJ, Munns R (2006) Physiological characterization of two genes for Na+ exclusion in durum wheat, Nax1 and Nax2. Plant Physiology 142: 1537-1547 Jeong J, Suh S, Guan C, Tsay Y-F, Moran N, Oh CJ, An CS, Demchenko KN, Pawlowski K, Lee Y (2004) A nodule-specific dicarboxylate transporter from alder is a member of the peptide transporter family. Plant Physiology 134: 969-978 Jha D, Shirley N, Tester M, Roy SJ (2010) Variation in salinity tolerance and shoot sodium accumulation in Arabidopsis ecotypes linked to differences in the natural expression levels of transporters involved in sodium transport. Plant, Cell & Environment 33: 793-804 Kamphake LJ, Hannah SA, Cohen JM (1967) Automated analysis for nitrate by hydrazine reduction. Water Research 1: 205-216 Kanno Y, Hanada A, Chiba Y, Ichikawa T, Nakazawa M, Matsui M, Koshiba T, Kamiya Y, Seo M (2012) Identification of an abscisic acid transporter by functional screening using the receptor complex as a sensor. Proceedings of the National Academy of Sciences 109: 9653-9658 Kaplan B, Davydov O, Knight H, Galon Y, Knight MR, Fluhr R, Fromm H (2006) Rapid transcriptome changes induced by cytosolic Ca2+ transients reveal ABRErelated sequences as Ca2+-responsive cis elements in Arabidopsis. Plant Cell 18: 2733-2748 Kohler B, Raschke K (2000) The delivery of salts to the xylem. Three types of anion conductance in the plasmalemma of the xylem parenchyma of roots of barley. Plant Physiology 122: 243-254 Kohler B, Wegner LH, Osipov V, Raschke K (2002) Loading of nitrate into the xylem: apoplastic nitrate controls the voltage dependence of X-QUAC, the main anion conductance in xylem-parenchyma cells of barley roots. The Plant Journal 30: 133142 Kollist H, Jossier M, Laanemets K, Thomine S (2011) Anion channels in plant cells. FEBS Journal 278: 4277-4292 Kong X-Q, Gao X-H, Sun W, An J, Zhao Y-X, Zhang H (2011) Cloning and functional characterization of a cation–chloride cotransporter gene OsCCC1. Plant Molecular Biology 75: 567-578 Krouk G, Lacombe B, Bielach A, Perrine-Walker F, Malinska K, Mounier E, Hoyerova K, Tillard P, Leon S, Ljung K, Zazimalova E, Benkova E, Nacry P, Gojon A (2010) Nitrate-regulated auxin transport by NRT1.1 defines a mechanism for nutrient sensing in plants. Developmental Cell 18: 927-937 Lauchli A, James RA, Huang CX, McCully M, Munns R (2008) Cell-specific localization of Na+ in roots of durum wheat and possible control points for salt exclusion. Plant, Cell & Environment 31: 1565-1574 Lee SC, Lan W, Buchanan BB, Luan S (2009) A protein kinase-phosphatase pair interacts with an ion channel to regulate ABA signaling in plant guard cells. Proceedings of the National Academy of Sciences 106: 21419-21424 Léran S, Varala K, Boyer J-C, Chiurazzi M, Crawford N, Daniel-Vedele F, David L, Dickstein R, Fernandez E, Forde B, Gassmann W, Geiger D, Gojon A, Gong J-M, Halkier BA, Harris JM, Hedrich R, Limami AM, Rentsch D, Seo M, Tsay Y-F, Zhang M, Coruzzi G, Lacombe B (2014) A unified nomenclature of NITRATE TRANSPORTER 1/PEPTIDE TRANSPORTER family members in plants. Trends in Plant Science 19: 5-9 Downloaded from on June 14, 201728 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 Li J-Y, Fu Y-L, Pike SM, Bao J, Tian W, Zhang Y, Chen C-Z, Zhang Y, Li H-M, Huang J, Li L-G, Schroeder JI, Gassmann W, Gong J-M (2010) The Arabidopsis nitrate transporter NRT1.8 functions in nitrate removal from the xylem sap and mediates cadmium tolerance. Plant Cell 22: 1633-1646 Lin SH, Kuo HF, Canivenc G, Lin CS, Lepetit M, Hsu PK, Tillard P, Lin HL, Wang YY, Tsai CB, Gojon A, Tsay YF (2008) Mutation of the Arabidopsis NRT1.5 nitrate transporter causes defective root-to-shoot nitrate transport. Plant Cell 20: 2514 - 2528 Luo GZ, Wang HW, Huang J, Tian AG, Wang YJ, Zhang JS, Chen SY (2005) A putative plasma membrane cation/proton antiporter from soybean confers salt tolerance in Arabidopsis. Plant Molecular Biology 59: 809-820 Marcotte WR, Russell SH, Quatrano RS (1989) Abscisic acid-responsive sequences from the em gene of wheat. Plant Cell 1: 969-976 Martin PK, Koebner RMD (1995) Sodium and chloride ions contribute synergistically to salt toxicity in wheat. Biologia Plantarum 37: 265-271 Mäser P, Hosoo Y, Goshima S, Horie T, Eckelman B, Yamada K, Yoshida K, Bakker EP, Shinmyo A, Oiki S, Schroeder JI, Uozumi N (2002) Glycine residues in potassium channel-like selectivity filters determine potassium selectivity in four-loopper-subunit HKT transporters from plants. Proceedings of the National Academy of Sciences 99: 6428-6433 Molendijk AJ, Ruperti B, Singh MK, Dovzhenko FA, Milia M, Westphal L, Rosahl S, Soellick TR, Uhrig J, Weingarten L, Huber M, Palme K (2008) A cysteine-rich receptor-like kinase NCRK and a pathogen-induced protein kinase RBK1 are Rop GTPase interactors. Plant Journal 53: 909-923. Møller IS, Gilliham M, Jha D, Mayo GM, Roy SJ, Coates JC, Haseloff J, Tester M (2009) Shoot Na+ exclusion and increased salinity tolerance engineered by cell typespecific alteration of Na+ transport in Arabidopsis. Plant Cell 21: 2163-2178 Møller IS, Tester M (2007) Salinity tolerance of Arabidopsis: a good model for cereals? Trends in Plant Science 12: 534-540 Moya JL, Gomez-Cadenas A, Primo-Millo E, Talon M (2003) Chloride absorption in saltsensitive Carrizo citrange and salt-tolerant Cleopatra mandarin citrus rootstocks is linked to water use. Journal of Experimental Botany 54: 825-833 Munns R (2002) Comparative physiology of salt and water stress. Plant, Cell & Environment 25: 239-250 Munns R, Gilliham M (2015) Salinity tolerance of crops – what is the cost? New Phytologist: DOI: 10.1111/nph.13519 Munns R, James RA, Xu B, Athman A, Conn SJ, Jordans C, Byrt CS, Hare RA, Tyerman SD, Tester M, Plett D, Gilliham M (2012) Wheat grain yield on saline soils is improved by an ancestral Na+ transporter gene. Nature Biotechnology 30: 360-364 Munns R, Tester M (2008) Mechanisms of salinity tolerance. Annual Review of Plant Biology 59: 651-681 Nakashima K, Fujita Y, Katsura K, Maruyama K, Narusaka Y, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2006) Transcriptional regulation of ABI3- and ABAresponsive genes including RD29B and RD29A in seeds, germinating embryos, and seedlings of Arabidopsis. Plant Molecular Biology 60: 51-68 Marcotte WR, Russell SH, Quatrano RS (1989) Abscisic acid-responsive sequences from the em gene of wheat. Plant Cell 1: 969-976 Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, Narusaka M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Interaction between two cis-acting Downloaded from on June 14, 201729 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis RD29A gene in response to dehydration and high-salinity stresses. The Plant Journal 34: 137-148 Negi J, Matsuda O, Nagasawa T, Oba Y, Takahashi H, Kawai-Yamada M, Uchimiya H, Hashimoto M, Iba K (2008) CO2 regulator SLAC1 and its homologues are essential for anion homeostasis in plant cells. Nature 452: 483-486 Newstead S, Drew D, Cameron AD, Postis VLG, Xia X, Fowler PW, Ingram JC, Carpenter EP, Sansom MSP, McPherson MJ, Baldwin SA, Iwata S (2011) Crystal structure of a prokaryotic homologue of the mammalian oligopeptide-proton symporters, PepT1 and PepT2. The EMBO Journal 30: 417-426 Nour-Eldin HH, Andersen TG, Burow M, Madsen SR, Jorgensen ME, Olsen CE, Dreyer I, Hedrich R, Geiger D, Halkier BA (2012) NRT/PTR transporters are essential for translocation of glucosinolate defence compounds to seeds. Nature 488: 531-534 Parker MB, Gascho GJ, Gaines TP (1983) Chloride toxicity of soybeans grown on atlantic coast flatwoods soils. Agronomy Journal 75: 439-443 Peña L (2004) Transgenic Plants: Methods and Protocols Humana Press, Totowa, New Jersey Pitman M, Luttge U, Lauchli A, Ball E (1974) Effect of previous water stress on ion uptake and transport in barley seedlings. Functional Plant Biology 1: 377-385 Pitman MG (1977) Ion transport into the xylem. Annual Review of Plant Physiology 28: 7188 Pitman MG (1982) Transport across plant roots. Quarterly Reviews of Biophysics 15: 481554 Plett D, Safwat G, Gilliham M, Skrumsager Møller I, Roy S, Shirley N, Jacobs A, Johnson A, Tester M (2010) Improved salinity tolerance of rice through cell typespecific expression of AtHKT1;1. PLoS ONE 5: e12571 Plett DC, Møller IS (2010) Na+ transport in glycophytic plants: what we know and would like to know. Plant, Cell & Environment 33: 612-626 Qiu L, Wu D, Ali S, Cai S, Dai F, Jin X, Wu F, Zhang G (2011) Evaluation of salinity tolerance and analysis of allelic function of HvHKT1 and HvHKT2 in Tibetan wild barley. TAG Theoretical and Applied Genetics 122: 695-703 Qiu Q-S, Guo Y, Dietrich MA, Schumaker KS, Zhu J-K (2002) Regulation of SOS1, a plasma membrane Na+/H+ exchanger in Arabidopsis thaliana, by SOS2 and SOS3. Proceedings of the National Academy of Sciences 99: 8436-8441 Ren Z-H, Gao J-P, Li L-G, Cai X-L, Huang W, Chao D-Y, Zhu M-Z, Wang Z-Y, Luan S, Lin H-X (2005) A rice quantitative trait locus for salt tolerance encodes a sodium transporter. Nature Genetics 37: 1141-1146 Rengasamy P (2002) Transient salinity and subsoil constraints to dryland farming in Australian sodic soils: an overview. Australian Journal of Experimental Agriculture 42: 351-361 Rengasamy P (2006) World salinization with emphasis on Australia. Journal of Experimental Botany 57: 1017-1023 Roberts SK (1998) Regulation of K+ channels in maize roots by water stress and abscisic acid. Plant Physiology 116: 145-153 Roberts SK, Snowman BN (2000) The effects of ABA on channel-mediated K+ transport across higher plant roots. Journal of Experimental Botany 51: 1585-1594 Roy SJ, Gilliham M, Berger B, Essah PA, Cheffings C, Miller AJ, Davenport RJ, Liu LH, Skynner MJ, Davies JM, Richardson P, Leigh RA, Tester M (2008) Investigating glutamate receptor-like gene co-expression in Arabidopsis thaliana. Plant, Cell & Environment 31: 861-871 Downloaded from on June 14, 201730 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 Roy, SJ, Huang W, Wang XJ, Evrard E, Schmöckel SM, Zafar ZU, Tester M (2013) A novel protien kinase involved in Na+ exclusion revealed from positional cloning. Plant, Cell & Environment 36: 553-568 Roy SJ, Negrão S, Tester M (2014) Salt resistant crop plants. Current Opinion in Biotechnology 26: 115-124 Sali A, Blundell T (1994) Comparative protein modelling by satisfaction of spatial restraints. Protein Structure by Distance Analysis 64: C86 Sanders D (1980) The mechanism of Cl− transport at the plasma membrane of Chara corallina I. Cotransport with H+. The Journal of Membrane Biology 53: 129-141 Schachtman DP, Tyerman SD, Terry BR (1991) The K+/Na+ selectivity of a cation channel in the plasma membrane of root cells does not differ in salt-tolerant and salt-sensitive wheat species. Plant Physiology 97: 598-605 Schwab R, Ossowski S, Riester M, Warthmann N, Weigel D (2006) Highly specific gene silencing by artificial microRNAs in Arabidopsis. Plant Cell 18: 1121-1133 Segonzac C, Boyer JC, Ipotesi E, Szponarski W, Tillard P, Touraine B, Sommerer N, Rossignol M, Gibrat R (2007) Nitrate efflux at the root plasma membrane: Identification of an Arabidopsis excretion transporter. Plant Cell 19: 3760-3777 Shelden MC, Howitt SM, Kaiser BN, Tyerman SD (2009) Identification and functional characterisation of aquaporins in the grapevine, Vitis vinifera. Functional Plant Biology 36: 1065-1078 Shen M-y, Sali A (2006) Statistical potential for assessment and prediction of protein structures. Protein Science 15: 2507-2524 Shi H, Quintero FJ, Pardo JM, Zhu J-K (2002) The putative plasma membrane Na+/H+ antiporter SOS1 controls long-distance Na+ transport in plants. Plant Cell 14: 465-477 Shi HZ, Ishitani M, Kim CS, Zhu JK (2000) The Arabidopsis thaliana salt tolerance gene SOS1 encodes a putative Na+/H+ antiporter. Proceedings of the National Academy of Sciences 97: 6896-6901 Simpson SD, Nakashima K, Narusaka Y, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Two different novel cis-acting elements of ERD1, a CLPA homologous Arabidopsis gene function in induction by dehydration stress and dark-induced senescence. The Plant Journal 33: 259-270 Skerrett M, Tyerman SD (1994) A channel that allows inwardly directed fluxes of anions in protoplasts derived from wheat roots. Planta 192: 295-305 Stacey G, Koh S, Granger C, Becker JM (2002) Peptide transport in plants. Trends in Plant Science 7: 257-263 Storey R, Walker RR (1999) Citrus and salinity. Scientia Horticulturae 78: 39-81 Subramanian C, Woo J, Cai X, Xu X, Servick S, Johnson CH, Nebenführ A, Von Arnim AG (2006) A suite of tools and application notes for in vivo protein interaction assays using bioluminescence resonance energy transfer (BRET). The Plant Journal 48: 138152 Sun J, Bankston JR, Payandeh J, Hinds TR, Zagotta WN, Zheng N (2014) Crystal structure of the plant dual-affinity nitrate transporter NRT1.1. Nature 507: 73-77 Sunarpi, Horie T, Motoda J, Kubo M, Yang H, Yoda K, Horie R, Chan W-Y, Leung HY, Hattori K, Konomi M, Osumi M, Yamagami M, Schroeder JI, Uozumi N (2005) Enhanced salt tolerance mediated by AtHKT1 transporter-induced Na+ unloading from xylem vessels to xylem parenchyma cells. The Plant Journal 44: 928938 Takano J, Noguchi K, Yasumori M, Kobayashi M, Gajdos Z, Miwa K, Hayashi H, Yoneyama T, Fujiwara T (2002) Arabidopsis boron transporter for xylem loading. Nature 420: 337-340 Downloaded from on June 14, 201731 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 Tamura K, Peterson D, Peterson N, Stecher G, Nei M and Kumar S (2011) MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731-2739. Taochy C, Gaillard I, Ipotesi E, Oomen R, Leonhardt N, Zimmermann S, Peltier JB, Szponarski W, Simonneau T, Sentenac H (2015) The Arabidopsis root stele transporter NPF2. 3 contributes to nitrate translocation to shoots under salt stress. The Plant Journal DOI:10.1111/tpj.12901 Tavakkoli E, Fatehi F, Coventry S, Rengasamy P, McDonald GK (2011) Additive effects of Na+ and Cl– ions on barley growth under salinity stress. Journal of Experimental Botany 62: 2189-2203 Teakle NL, Flowers TJ, Real D, Colmer TD (2007) Lotus tenuis tolerates the interactive effects of salinity and waterlogging by 'excluding' Na+ and Cl– from the xylem. Journal of Experimental Botany 58: 2169-2180 Teakle NL, Tyerman SD (2010) Mechanisms of Cl– transport contributing to salt tolerance. Plant, Cell & Environment 33: 566-589 Tester M, Davenport R (2003) Na+ tolerance and Na+ transport in higher plants. Annals of Botany 91: 503-527 Tilman D, Balzer C, Hill J, Befort BL (2011) Global food demand and the sustainable intensification of agriculture. Proceedings of the National Academy of Sciences 108: 20260-20264 Tregeagle JM, Tisdall JM, Blackmore DH, Walker RR (2006) A diminished capacity for chloride exclusion by grapevine rootstocks following long-term saline irrigation in an inland versus a coastal region of Australia. Australian Journal of Grape and Wine Research 12: 178-191 Tsay YF, Chiu CC, Tsai CB, Ho CH, Hsu PK (2007) Nitrate transporters and peptide transporters. FEBS Letters 581: 2290 - 2300 Tyerman SD (1992) Anion channels in plants. Annual Review of Plant Physiology and Plant Molecular Biology 43: 351-373 Uozumi N, Kim EJ, Rubio F, Yamaguchi T, Muto S, Tsuboi A, Bakker EP, Nakamura T, Schroeder JI (2000) The Arabidopsis HKT1 gene homolog mediates inward Na+ currents in Xenopus laevis oocytes and Na+ uptake in Saccharomyces cerevisiae. Plant Physiology 122: 1249-1260 Urao T, Yamaguchi-Shinozaki K, Urao S, Shinozaki K (1993) An Arabidopsis myb homolog is induced by dehydration stress and its gene product binds to the conserved MYB recognition sequence. Plant Cell 5: 1529-1539 Vahisalu T, Kollist H, Wang YF, Nishimura N, Chan WY, Valerio G, Lamminmaki A, Brosche M, Moldau H, Desikan R, Schroeder JI, Kangasjarvi J (2008) SLAC1 is required for plant guard cell S-type anion channel function in stomatal signalling. Nature 452: 487-491 Vahisalu T, Puzõrjova I, Brosché M, Valk E, Lepiku M, Moldau H, Pechter P, Wang YS, Lindgren O, Salojärvi J, Loog M, Kangasjärvi J, Kollist H (2010) Ozonetriggered rapid stomatal response involves the production of reactive oxygen species, and is controlled by SLAC1 and OST1. The Plant Journal 62: 442-453 Waters S, Gilliham M, Hrmova M (2013) Plant high-affinity potassium (HKT) transporters involved in salinity tolerance: structural insights to probe differences in ion selectivity. International Journal of Molecular Sciences 14: 7660-7680 Weigel D, Glazebrook J (2002) Arabidopsis: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Downloaded from on June 14, 201732 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 White PJ, Broadley MR (2001) Chloride in soils and its uptake and movement within the plant: A review. Annals of Botany 88: 967-988 Wu S, Zhang Y (2007) LOMETS: A local meta-threading-server for protein structure prediction. Nucleic Acids Research 35: 3375-3382 Wu SJ, Ding L, Zhu JK (1996) SOS1, a genetic locus essential for salt tolerance and potassium acquisition. Plant Cell 8: 617-627 Xu G, Magen H, Tarchitzky J, Kafkafi U (1999) Advances in chloride nutrition of plants. In LS Donald, ed, Advances in Agronomy, Vol Volume 68. Academic Press, pp 97150 Yamashita T, Shimada S, Guo W, Sato K, Kohmura E, Hayakawa T, Takagi T, Tohyama M (1997) Cloning and functional expression of a brain peptide/histidine transporter. Journal of Biological Chemistry 272: 10205-10211 Yoo S-D, Cho Y-H, Sheen J (2007) Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nature Protocols 2: 1565-1572 Zhou J-J, Theodoulou FL, Muldin I, Ingemarsson B, Miller AJ (1998) Cloning and functional characterization of a Brassica napus transporter that is able to transport nitrate and histidine. Journal of Biological Chemistry 273: 12017-12023 Downloaded from on June 14, 201733 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 987 Figure legends and Tables 988 989 Figure 1 Bioinformatic analysis of NPF2.4. Phylogenetic tree shows relationships between 990 the 7 members of the NAXT subfamily and 7 other NPF2s. Multiple amino acid sequence 991 alignment was performed with ClustalW2 with a gap open of 10 and a gap extension of 0.1. 992 Phylogenetic tree was generated using program MEGA package 5.0 using default settings. 993 Names are shown for proteins that are available in literature. Scale bar indicates the 994 maximum like-hood distance. 995 996 Figure 2 NPF2.4 is likely to form a membrane embedded ion transporter. A 3D homology 997 model of NPF2.4 998 oneidensis (PDB accession 2XUT) and (B) a H+/NO3– transporter from Arabidopsis (PDB 999 accession 4OH3) as structural templates. Putative binding site for Cl– ions is enclosed in a 1000 pocket (arrow), and is delineated by four amino acid residues Tyr37, Val41, Asn67 and 1001 Met334 coloured in atomic colours. Left and right arrowheads indicate NH2- and COOH- 1002 termini that are predicted to face intracellular sides. (C) Superposition of both models 1003 showing very similar folds and positions of residues participating in binding of Cl–. (D) A 1004 detail of the putative Cl– binding pocket, signifying residues that are likely to bind Cl–, and 1005 their predicted structural shift upon binding Cl–. Sticks in magenta and atomic colours 1006 indicate residues in the NPF2.5 apo- and Cl–-complexed models, respectively. Dashed lines 1007 specify distances between the four binding residues and the Cl– ion. (A) a proton dependent oligo-peptide transporter from Shewanella 1008 1009 Figure 3 NPF2.4 expression is down-regulated by both salt and ABA. Four-week old Col-0 1010 Arabidopsis plants were treated with NaCl or ABA as indicated before their whole roots were 1011 harvested for qRT-PCR analysis. (A) NPF2.4 transcripts detected in the root of plants treated 1012 with 2 mM (control), 50 mM or 100 mM NaCl for 24 h. (B) NPF2.4 transcripts detected in 1013 the root of plants treated with 2 mM (control) or 75 mM NaCl for 5 days before harvest (C) 1014 NPF2.4 transcripts detected in the root of plants treated with 20 µM +/– cis, trans ABA for 4 1015 h or 16 h. Results are presented as mean ± SEM (n = 4 or 5), expression levels were Downloaded from on June 14, 201734 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 1016 normalized to controls. Significance is indicated by the asterisks (One way ANOVA and 1017 Tukey test, *P ≤ 0.05; **P ≤ 0.01; ***P ≤ 0.001). 1018 1019 Figure 4 NPF2.4 is predominantly expressed in the root stelar cells. (A) A non-transformed 1020 Col-0 plant showing no GUS activity. (B and C) Strong proNPF2.4 driven GUS activity was 1021 detected in the cells associated with mature root stele after 1-h of histochemical staining. (D) 1022 GUS activity was detected in root-shoot junction. (E and F) GUS activity was detected 1023 mainly in the root and the vascular cells in both cotyledon and true leaves. (G) Root cross 1024 sections prepared from 7-d old proNPF2.4:GUS plants showing GUS activity in the stelar 1025 cells. (H and I) GUS activity was detected in the flower and siliques. 1026 1027 Figure 5 proNPF2.4 driven GUS activity in roots is reduced by salt treatments. Two-week 1028 old T2 proNPF2.4:UidA plants were GUS-stained for 1 h after salt treatments as indicated for 1029 5 d. Roots were subjected to MUG assay. Absorbance measured using a spectrophotometer at 1030 366 mm to measure MU concentrations. Error bars represent mean ± SEM (n = 3). 1031 Significance is indicated by the asterisks (One-way ANOVA and Tukey test, *P ≤ 0.05; **P 1032 ≤ 0.01). 1033 1034 Figure 6 NPF2.4 protein localizes to the plasma membrane. (A and B) Constitutive stable 1035 expression of GFP::NPF2.4 in the Arabidopsis root, scale bars = 20 µm. (A) Confocal image 1036 of root cells of 10-d old GFP::NPF2.4 expressing plants showing the plasma membrane 1037 localization of GFP tagged NPF2.4. (B) Plasmolysis performed on the GFP::NPF2.4 1038 expressing plants showing Hechtian strands as indicated by the white arrows. (C to E) 1039 Transient expression of YFP::NPF2.4 fusion construct in Arabidopsis mesophyll protoplasts, 1040 scale bars = 100 µm. (C) Confocal image of YFP::NPF2.4 fusion protein in Arabidopsis 1041 mesophyll protoplasts. (D) Cyan fluorescence of plasma membrane marker ECFP::ROP11. 1042 (E) Bright image of the transformed protoplast. (F) Merged image showing the co- 1043 localization of YFP::NPF2.4 fusion protein and the plasma membrane marker. 1044 Figure 7 NPF2.4 generates Na+- and K+- dependent Cl– transport when expressed in Xenopus 1045 laevis oocytes. NPF2.4-cRNA injected oocytes were exposed to different solutions as Downloaded from on June 14, 201735 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 1046 indicated. (A) Currents over time for NPF2.4-cRNA injected oocytes, 2 d after injection, 1047 clamped at –60 mV, in the presence of 45 mM Na-glutamate (45 Na) and 45 mM Na- 1048 glutamate plus 50 mM NMDG-Cl (45 Na + 50 Cl). (B) Currents elicited by NPF2.4-cRNA 1049 when oocytes, held at –140 mV in 50 mM NaCl, were exposed to pH 7.5 or 5.5 (n = 4) (C). 1050 Currents elicited by NPF2.4-cRNA when oocytes were exposed to different concentrations of 1051 NaCl (n = 3). (D) Currents elicited by NPF2.4-cRNA when oocytes were exposed to different 1052 concentrations of NaNO3 (n = 3). (E) Currents elicited by NPF2.4-cRNA when oocytes were 1053 exposed to a constant concentration of Na+ (45 mM) with varying concentrations of Cl– (0, 5, 1054 10, 25, 50 mM). (F) Currents elicited by NPF2.4-cRNA when oocytes were exposed to a 1055 constant concentration of Cl– (45 mM) with varying concentrations of Na+ (0, 5, 10, 25, 50 1056 mM). (G) Conductance of NPF2.4-cRNA injected oocytes exposed to solutions containing 1057 various different ions; conductance was calculated for –80 mV to –100 mV, dots are means, 1058 maximum and minimum values ± SEM are represented by a vertical bar (n = 3) or box (n = 1059 3–8); horizontal bars indicate the median; columns with different letters indicate statistically 1060 significant differences (P < 0.05). (H) Concentrations of Cl–, Na+ and K+ measured in the 1061 NPF2.4-cRNA injected oocytes and water controls pre-incubated in Ca2+ ringer solution for 2 1062 d. n = 16 samples for NPF2.4-cRNA injected oocytes; n = 10 samples for water controls; 1063 each sample contained 10 oocytes; One way ANOVA and Tukey test, ***P ≤ 0.001. (I) 36Cl– 1064 uptake measured in oocytes injected with either NPF2.4-cRNA or water, in a background of 1065 100 mM Cl– for 60 min; results are presented as mean ± SEM (n = 20); columns with 1066 different letters indicate statistically significant differences (P < 0.05). (B-D, F) Data were 1067 plotted after subtraction of currents measured in water-injected oocytes; water-injected 1068 control data and total currents in NPF2.4-cRNA injected oocytes are included in 1069 Supplemental Figure 2. 1070 1071 Figure 8 Shoot Cl- concentration was significantly reduced in the NPF2.4 artificial 1072 microRNA knockdowns under low salt conditions (2 mM NaCl), whereas the shoot NO3– 1073 concentration of the NPF2.4 knockdowns was similar to null segregants. 4-week old 1074 hydroponically grown plants were treated with 2 mM NaCl for 5 days. (A) NPF2.4 1075 expression in the roots of NPF2.4 knockdowns. (B) Cl– concentrations in the shoot of 1076 NPF2.4 knockdowns and null segregants. (C) Shoot NO3– concentrations of NPF2.4 1077 knockdowns and null segregants. Results are presented as mean ± SEM, n = 4-7. Significance Downloaded from on June 14, 201736 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 1078 is indicated by the asterisks (One way ANOVA and Tukey test, * P ≤ 0.05; **P ≤ 0.005; 1079 ***P ≤ 0.001). 1080 1081 Figure 9 Shoot accumulation of Cl– was increased in the NPF2.4 over expression lines, while 1082 NO3- content remained unaffected. (A) Cl– concentrations in the shoot of NPF2.4 over- 1083 expression lines and null segregants after high salt treatment (75 mM NaCl). (B) NO3– 1084 concentrations in the shoot of NPF2.4 over-expression lines and null segregants after high 1085 salt treatment. (C) Cl– concentrations in the shoot of NPF2.4 over-expression lines and null 1086 segregants after low salt treatment (2 mM NaCl). (D) NO3– concentrations in the shoot of 1087 NPF2.4 over-expression lines and null segregants after low salt treatment. Error bars 1088 represent mean ± SEM. n = 4. Significance is indicated by the asterisks (Single factor 1089 ANOVA and Tukey test, * P ≤ 0.05. 1090 1091 Supplemental Figure 1 Multiple sequence alignment of NPF2.4, NPF2.3 and NPF2.1/ 1092 NAXT1, protein sequence alignment was performed using ClustalW2 program with a gap 1093 open of 10 and a gap extension of 0.1. The black and shaded regions represent identical 1094 residues and conservative substitutions, respectively. 1095 1096 Supplemental Figure 2 Raw and control data for expression of NPF2.4 in Xenopus laevis 1097 oocytes. (A) Currents over time for water injected control oocytes, 2 d after injection, 1098 clamped at –60 mV, in the presence of 45 mM Na-glutamate (45 Na) and 45 mM Na- 1099 glutamate plus 50 mM NMDG-Cl (45 Na + 50 Cl). (B) Total currents (i.e. without leak 1100 subtraction) in oocytes expressing NPF2.4-cRNA, held at -140 mV in 50 mM NaCl, when 1101 exposed to pH 7.5 or 5.5 (n = 4). (C) Currents for water injected control oocytes, held at -140 1102 mV in 50 mM NaCl, and exposed to pH 7.5 or 5.5 (n = 4). (D) Non-control subtracted 1103 currents elicited by NPF2.4-cRNA when oocytes were exposed to different concentrations of 1104 NaCl (n = 3). (E) Currents for water injected oocytes exposed to different concentrations of 1105 NaCl (n = 3). (F) Total currents (i.e. without leak subtraction) in oocytes expressing NPF2.4- 1106 cRNA when oocytes were exposed to different concentrations of NaNO3 (n = 3). (G) 1107 Currents for water injected oocytes exposed to different concentrations of NaNO3 (n = 3). (H) 1108 Total currents (i.e. without leak subtraction) in oocytes expressing NPF2.4-cRNA when Downloaded from on June 14, 201737 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 1109 oocytes were exposed to 45 mM Na-glutamate and varying concentrations of NMDG-Cl (n = 1110 3–6). (I) Currents for water injected oocytes exposed to 45 mM Na-glutamate and varying 1111 concentrations of NMDG-Cl (n = 3–4). (J) Total currents (i.e. without leak subtraction) in 1112 oocytes expressing NPF2.4-cRNA when oocytes were exposed to 45 mM NMDG-Cl and 1113 varying concentrations of Na-glutamate (n = 5). (K) Currents for water injected oocytes 1114 exposed to 45 mM NMDG-Cl and varying concentrations of Na-glutamate (n = 5). (L) 1115 Conductance for water injected oocytes exposed to solutions containing various different ions; 1116 conductance was calculated for –80 mV to –100 mV, dots are means, maximum and 1117 minimum values ± SEM are represented by a vertical bar (n = 3) or box (n = 4–6); horizontal 1118 bars indicate the median; columns with different letters indicate statistically significant 1119 differences (P ≤ 0.05). (M) 1120 cRNA or water, in a background of 100 mM Na+ for 60 min; results are scintillation counts 1121 per minute, presented as mean ± SEM (n = 22 to 30). 22 Na+ uptake measured in oocytes injected with either NPF2.4- 1122 1123 Supplemental Figure 3 NPF2.4 transcript levels of lines SALK_111056 and SALK_111071 1124 annotated as T-DNA knockouts for NPF2.4 showed the failed disruption of NPF2.4 1125 expression in both lines. (A) T-DNA insertions of both obtained SALK lines and results of 1126 genotyping PCRs showed that S_111056 line lost its T-DNA insertion within the ORF of 1127 NPF2.4. (B) Quantitative RT-PCR was performed on 11 and 14 progenies of T3 1128 SALK_111056 and SALK_111071, respectively and 4 Col-0 WT Arabidopsis plants. Plants 1129 were grown hydroponically for 4 weeks. Results are presented as mean ± SEM. 1130 1131 Supplemental Figure 4 Under low salt condition, shoot concentration of both Na+ and K+ 1132 were similar between NPF2.4 knockdowns and null segregants. Expression of NPF2.5 was 1133 not affected in the roots of NPF2.4 knockdowns. Under high salt condition, shoot Cl- 1134 concentration of knockdowns remained similar to that of null segregants when NPF2.4 1135 expression in the knockdowns was down-regulated to similar low levels as null segregants. 4- 1136 week old hydroponically grown plants were treated with salt for 5 d. (A) concentrations of Cl-, 1137 Na+ and K+ in the shoot of NPF2.4 knockdowns and null segregants after low salt treatment, 1138 data was normalized relative to nulls. (B) Expression levels of NPF2.4 in knockdowns and 1139 null segregants after low salt treatment. (C) NPF2.4 expression in the roots of NPF2.4 1140 knockdown lines after high salt treatment. (D) Cl- concentrations in the shoot of NPF2.4 Downloaded from on June 14, 201738 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 1141 knockdowns and null segregants after high salt treatment. (E) Expression levels of NPF2.5 in 1142 the roots of NPF2.4 knockdowns after low salt treatment. Results are presented as mean ± 1143 SEM, n = 3 or 4. Significance is indicated by the asterisks (Single factor ANOVA and Tukey 1144 test, * P ≤ 0.05). 1145 1146 Supplemental Figure 5 Expression validation of NPF2.4 in the root of NPF2.4 over- 1147 expression lines under both low salt and high salt conditions. (A) Quantitative RT-PCR on 1148 the cDNA samples prepared from roots of NPF2.4 over expression lines after high salt 1149 treatment (75 mM NaCl). (B) Quantitative RT-PCR on the cDNA samples prepared from 1150 roots of NPF2.4 over expression lines after low salt treatment (2 mM NaCl). Results are 1151 presented as mean ± SEM, n = 4. Significance is indicated by the asterisks (Single factor 1152 ANOVA and Tukey test, * P ≤ 0.05; ***P ≤ 0.001). 1153 Supplemental Figure 6 Biomass of NPF2.4 knockdowns was unaffected by low salt 1154 condition compared to null segregants. 4-week old hydroponically grown plants were treated 1155 with salt for 5 days. Result is presented as mean ± SEM, n = 3 or 4. Downloaded from on June 14, 201739 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 1156 Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 40 AT3G45720 AT3G45690 AT3G45680 AT3G45700 NPF2.4 AT3G45710 AT3G45660 AT3G45650 AT1G18880 AT3G47960 AT5G62680 NPF2.7/NAXT1 NPF2.9/NRT1.9 NPF2.10/GTR1 NPF2.11/GTR2/NRT1.10 AT5G28470 AT1G27080 AT1G69870 NPF2.12/NRT1.6 NPF2.13/NRT1.7 AT1G69860 0.2 Figure 1 Bioinformatic analysis of NPF2.4. Phylogenetic tree shows relationships between the 7 members of the NAXT subfamily and 7 other NPF2s. Multiple amino acid sequence alignment was performed with ClustalW2 with a gap open of 10 and a gap extension of 0.1. Phylogenetic tree was generated using program MEGA package 5.0 using default settings. Names are shown for proteins that are available in literature. Scale bar indicates the maximum like-hood distance. Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. A B C D Figure 2 NPF2.4 is likely to form a membrane embedded ion transporter. A 3D homology model of NPF2.4 (A) a proton dependent oligo-peptide transporter from Shewanella oneidensis (PDB accession 2XUT) and (B) a H+/NO3– transporter from Arabidopsis (PDB accession 4OH3) as structural templates. Putative binding site for Cl– ions is enclosed in a pocket (arrow), and is delineated by four amino acid residues Tyr37, Val41, Asn67 and Met334 coloured in atomic colours. Left and right arrowheads indicate NH2- and COOH-termini that are predicted to face intracellular sides. (C) Superposition of both models showing very similar folds and positions of residues participating in binding of Cl–. (D) A detail of the putative Cl– binding pocket, signifying residues that are likely to bind Cl–, and their predicted structural shift upon binding Cl–. Sticks in magenta and atomic colours indicate residues in the NPF2.5 apo- and Cl–-complexed models, respectively. Dashed lines specify distances between the four binding residues and the Cl– ion. Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 1.5 1.0 * 0.5 *** Relative expression of NPF2.4 1.5 1.5 10 0 1.0 0.5 ** d 0.0 75 m M N aC l5 C on tr ol B Relative expression of NPF2.4 50 m M m M N aC l2 N aC l2 4h 4h 0.0 C on tr ol Relative expression of NPF2.4 A 1.0 * 0.5 *** 16 h A B M 20 20 M A B A A 4h 0.0 C on tr ol C Figure 3 NPF2.4 expression is down-regulated by both salt and ABA. Four-week old Col-0 Arabidopsis plants were treated with NaCl or ABA as indicated before their whole roots were harvested for qRT-PCR analysis. (A) NPF2.4 transcripts detected in the root of plants treated with 2 mM (control), 50 mM or 100 mM NaCl for 24 h. (B) NPF2.4 transcripts detected in the root of plants treated with 2 mM (control) or 75 mM NaCl for 5 days before harvest (C) NPF2.4 transcripts detected in the root of plants treated with 20 M +/– cis, trans ABA for 4 h or 16 h. Results are presented as mean ± SEM (n = 4 or 5), expression levels were normalized to controls. Significance is indicated by the asterisks (One way ANOVA and Tukey test, *P 0.05; **P 0.01; ***P 0.001). Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. A D G B C E F H I Figure 4 NPF2.4 is predominantly expressed in the root stelar cells. (A) A non-transformed Col-0 plant showing no GUS activity. (B and C) Strong proNPF2.4 driven GUS activity was detected in the cells associated with mature root stele after 1-h of histochemical staining. (D) GUS activity was detected in root-shoot junction. (E and F) GUS activity was detected mainly in the root and the vascular cells in both cotyledon and true leaves. (G) Root cross sections prepared from 7-d old proNPF2.4:GUS plants showing GUS activity in the stelar cells. (H and I) GUS activity was detected in the flower and siliques. Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. Figure 5 proNPF2.4 driven GUS activity in roots is reduced by salt treatments. Two-week old T2 proNPF2.4:UidA plants were GUS-stained for 1 h after salt treatments as indicated for 5 d. Roots were subjected to MUG assay. Absorbance measured using a spectrophotometer at 366 mm to measure MU concentrations. Error bars represent mean ± SEM (n = 3). Significance is indicated by the asterisks (One-way ANOVA and Tukey test, *P 0.05; **P 0.01). Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. A AA A C E B B B D F Figure 6 NPF2.4 protein localizes to the plasma membrane. (A and B) Constitutive stable expression of GFP::NPF2.4 in the Arabidopsis root, scale bars = 20 m. (A) Confocal image of root cells of 10-d old GFP::NPF2.4 expressing plants showing the plasma membrane localization of GFP tagged NPF2.4. (B) Plasmolysis performed on the GFP::NPF2.4 expressing plants showing Hechtian strands as indicated by the white arrows. (C to E) Transient expression of YFP::NPF2.4 fusion construct in Arabidopsis mesophyll protoplasts, scale bars = 100 m. (C) Confocal image of YFP::NPF2.4 fusion protein in Arabidopsis mesophyll protoplasts. (D) Cyan fluorescence of plasma membrane marker ECFP::ROP11. (E) Bright image of the transformed protoplast. (F) Merged image showing the co-localization of YFP::NPF2.4 fusion protein and the plasma membrane marker. Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. A 45 Na 45 Na 45 Na 45 Na 45 Na + 50 Cl 45 Na + 50 Cl 45 Na + 50 Cl Currents (nA) at -140 mV B 200 nA 1 min C 0 -200 -400 -600 -800 -1000 pH 7.5 pH 5.5 D 500 100 mM NaCl pH 7.5 50 mM NaCl pH 7.5 5 mM NaCl pH 7.5 1000 100 mM NaNO3 pH 7.5 50 mM NaNO3 pH 7.5 Current (nA) Current (nA) 5 mM NaNO3 pH 7.5 500 -150 -100 -50 50 Voltage (mV) Voltage (mV) -150 -100 -50 50 -500 -500 -1000 -1000 E F 1000 45 mM Na + 0 mM NMDG-Cl 45 mM Na + 5 mM NMDG-Cl 45 mM Na + 10 mM NMDG-Cl 45 mM Na + 25 mM NMDG-Cl 45 mM Na + 50 mM NMDG-Cl Voltage (mV) -150 -100 -50 1000 45 mM NMDG-Cl + 0 mM Na 45 mM NMDG-Cl + 5 mM Na 45 mM NMDG-Cl + 10 mM Na 45 mM NMDG-Cl + 25 mM Na 45 mM NMDG-Cl + 50 mM Na Current (nA) 50 -150 Voltage (mV) -100 -50 50 -1000 -1000 -2000 -2000 H 20 bcd 15 abc 10 5 abc abc a 50 50 m M N agl m uta m M a N M te 50 DG m -C l M 50 Na C 25 mM l K m C M 25 M l g m C l2 M C 10 a C 0 l 10 mM 2 0 K m C l M N aC l 0 100 Cl- *** 80 Na+ K+ 60 40 20 0 4 d N PF 2. d 2O cd H Conductance (nS) 25 mM [Cl-], [Na+ ] or [K+ ] per oocyte G Current (nA) Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. Uptake of 36Cl - (nmol/oocyte/h) I 20 pH 5.5 pH 7.5 25 NaCl NMDG b b NaCl NMDG 15 10 a a 5 a a C C 2O H 2O N PF 2. 4 H H 2O N PF 2. 4 2O N PF 2. 4 H N PF 2. 4 0 Figure 7 NPF2.4 generates Na+- and K+- dependent Cl– transport when expressed in Xenopus laevis oocytes. NPF2.4-cRNA injected oocytes were exposed to different solutions as indicated. (A) Currents over time for NPF2.4-cRNA injected oocytes, 2 d after injection, clamped at –60 mV, in the presence of 45 mM Na-glutamate (45 Na) and 45 mM Na-glutamate plus 50 mM NMDG-Cl (45 Na + 50 Cl). (B) Currents elicited by NPF2.4-cRNA when oocytes, held at –140 mV in 50 mM NaCl, were exposed to pH 7.5 or 5.5 (n = 4) (C). Currents elicited by NPF2.4-cRNA when oocytes were exposed to different concentrations of NaCl (n = 3). (D) Currents elicited by NPF2.4-cRNA when oocytes were exposed to different concentrations of NaNO3 (n = 3). (E) Currents elicited by NPF2.4-cRNA when oocytes were exposed to a constant concentration of Na+ (45 mM) with varying concentrations of Cl- (0, 5, 10, 25, 50 mM). (F) Currents elicited by NPF2.4-cRNA when oocytes were exposed to a constant concentration of Cl- (45 mM) with varying concentrations of Na+ (0, 5, 10, 25, 50 mM). (G) Conductance of NPF2.4cRNA injected oocytes exposed to solutions containing various different ions; conductance was calculated for –80 mV to –100 mV, dots are means, maximum and minimum values ± SEM are represented by a vertical bar (n = 3) or box (n = 3–8); horizontal bars indicate the median; columns with different letters indicate statistically significant differences (P < 0.05). (H) Concentrations of Cl-, Na+ and K+ measured in the NPF2.4-cRNA injected oocytes and water controls pre-incubated in Ca2+ ringer solution for 2 d. n = 16 samples for NPF2.4-cRNA injected oocytes; n = 10 samples for water controls; each sample contained 10 oocytes; One way ANOVA and Tukey test, ***P 0.001. (I) 36Cl– uptake measured in oocytes injected with either NPF2.4-cRNA or water, in a background of 100 mM Cl– for 60 min; results are presented as mean ± SEM (n = 20); columns with different letters indicate statistically significant differences (P < 0.05). (B-D, F) Data were plotted after subtraction of currents measured in water-injected oocytes; water-injected control data and total currents in NPF2.4-cRNA injected oocytes are included in Supplemental Figure 2. Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 8000 6000 4000 *** 2000 45 44 K D -N PF 2. 43 K D -N PF 2. 42 K D -N PF 2. 41 -N PF 2. K D -N PF 2. N ul l ** ** * 10 * 5 45 44 K D -N PF 2. 43 -N PF 2. K D K D -N PF 2. K D 42 41 -N PF 2. N ul l 0 -N PF 2. moles NO3 /g FW in the shoot ** 15 40 30 20 - C *** 0 K D moles Cl /g FW in the shoot - B ** *** *** K D Copy number per g NPF2.4 cDNA under normal condition A 10 N K ul D l -N PF 2. K 4D 1 -N PF 2. K 4D 2 -N PF 2. K 4D 3 -N PF 2. K 4D 4 -N PF 2. 45 0 Figure 8 Shoot Cl- concentration was significantly reduced in the NPF2.4 artificial microRNA knockdowns under low salt conditions (2 mM NaCl), whereas the shoot NO3– concentration of the NPF2.4 knockdowns was similar to null segregants. 4-week old hydroponically grown plants were treated with 2 mM NaCl for 5 days. (A) NPF2.4 expression in the roots of NPF2.4 knockdowns. (B) Cl– concentrations in the shoot of NPF2.4 knockdowns and null segregants. (C) Shoot NO3– concentrations of NPF2.4 knockdowns and null segregants. Results are presented as mean ± SEM, n = 4-7. Significance is indicated by the asterisks **P 0.001). (One way ANOVA and Tukey test, *from P on0.05; Downloaded June 14, 2017 - 0.005; Published***P by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. 10 5 .4 -2 E X -N P F2 O O E X -N P F2 .4 -1 0 X -N P O E 80 60 40 20 0 N ul O l E X -N P F2 .4 -1 O E X -N P F2 .4 -2 D F2 .4 -2 .4 -2 .4 -1 O E X -N P F2 15 N ul l moles Cl-/g FW in the shoot C 0 E X -N P F2 N ul l O 0 10 X -N P 50 O E 100 20 F2 .4 -1 * 150 30 N ul l B moles NO3-/g FW in the shoot 200 moles NO3-/g FW in the shoot moles Cl-/g FW in the shoot A Figure 9 Shoot accumulation of Cl– was increased in the NPF2.4 over expression lines, while NO3content remained unaffected. (A) Cl– concentrations in the shoot of NPF2.4 over-expression lines and null segregants after high salt treatment (75 mM NaCl). (B) NO3– concentrations in the shoot of NPF2.4 over-expression lines and null segregants after high salt treatment. (C) Cl– concentrations in the shoot of NPF2.4 over-expression lines and null segregants after low salt treatment (2 mM NaCl). (D) NO3– concentrations in the shoot of NPF2.4 over-expression lines and null segregants after low salt treatment. Error bars represent mean ± SEM. n = 4. Significance is indicated by the asterisks (Single factor ANOVA and Tukey test, * P 0.05. Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. Parsed Citations Abel GH (1969) Inheritance of the capacity for chloride inclusion and chloride exclusion by soybeans. Crop Sciences 9: 697-698 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell 15: 63-78 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Abe H, Yamaguchi-Shinozaki K, Urao T, Iwasaki T, Hosokawa D, Shinozaki K (1997) Role of Arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression. Plant Cell 9: 1859-1868 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Apse MP, Blumwald E (2007) Na+ transport in plants. FEBS Letters 581: 2247-2254 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Barrett T, Wilhite SE, Ledoux P, Evangelista C, Kim IF, Tomashevsky M, Marshall KA, Phillippy KH, Sherman PM, Holko M, Yefanov A, Lee H, Zhang N, Robertson CL, Serova N, Davis S, Soboleva A. (2013) NCBI GEO: archive for functional genomics data sets-update. Nucleic Acids Research 41, D991-D995 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Bassil E, Blumwald E (2014) The ins and outs of intracellular ion homeostasis: NHX-type cation/H+ transporters. Current Opinion in Plant Biology 22: 1-6 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Beilby MJ, Walker NA (1981) Chloride transport in Chara: I. Kinetics and current-voltage curves for a probable proton symport. Journal of Experimental Botany 32: 43-54 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Berthomieu P, Conejero G, Nublat A, Brackenbury WJ, Lambert C, Savio C, Uozumi N, Oiki S, Yamada K, Cellier F, Gosti F, Simonneau T, Essah PA, Tester M, Very A-A, Sentenac H, Casse F (2003) Functional analysis of AtHKT1 in Arabidopsis shows that Na+ recirculation by the phloem is crucial for salt tolerance. The EMBO Journal 22: 2004-2014 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Burton RA, Jobling SA, Harvey AJ, Shirley NJ, Mather DE, Bacic A, Fincher GB (2008) The genetics and transcriptional profiles of the cellulose synthase-like HvCslF gene family in barley. Plant Physiology 146: 1821-1833 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Byrt CS, Platten JD, Spielmeyer W, James RA, Lagudah ES, Dennis ES, Tester M, Munns R (2007) HKT1;5-like cation transporters linked to Na+ exclusion loci in wheat, nax2 and kna1. Plant Physiology 143: 1918-1928 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Chen C-Z, Lv X-F, Li J-Y, Yi H-Y, Gong J-M (2012) Arabidopsis NRT1.5 is another essential component in the regulation of nitrate reallocation and stress tolerance. Plant Physiology 159: 1582-1590 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. The Plant Journal 16: 735-743. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Cole PJ (1985) Chloride toxicity in citrus. Irrigation Science 6: 63-71 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Downloaded from on June 14, 2017 - Published byTalon www.plantphysiol.org Colmenero-Flores JM, Martinez G, Gamba G, Vazquez N, Iglesias DJ, Brumos J, M (2007) Identification and functional Copyright © 2015 American Society of Plant Biologists. All rights reserved. characterization of cation-chloride cotransporters in plants. The Plant Journal 50: 278-292 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Conn SJ, Hocking B, Dayod M, Xu B, Athman A, Henderson S, Aukett L, Conn V, Shearer MK, Fuentes S (2013) Protocol: optimising hydroponic growth systems for nutritional and physiological analysis of Arabidopsis thaliana and other plants. Plant methods 9: 4 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Cotsaftis O, Plett D, Shirley N, Tester M, Hrmova M (2012) A two-staged model of Na+ exclusion in rice explained by 3D modeling of HKT transporters and alternative splicing. PLoS ONE 7: e39865 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Cram W, Pitman M (1972) The action of abscisic acid on ion uptake and water flow in plant roots. Australian Journal of Biological Sciences 25: 1125-1132 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Curtis MD, Grossniklaus U (2003) A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiology 133: 462-469 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Davenport RJ, Munoz-Mayor A, Jha D, Essah PA, Rus ANA, Tester M (2007) The Na+ transporter AtHKT1;1 controls retrieval of Na+ from the xylem in Arabidopsis. Plant, Cell & Environment 30: 497-507 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Evrard A (2013) Cell type-specific transcriptional responses of plants to salinity. PhD thesis, The University of Adelaide, Adelaide, Australia Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Evrard A, Bargmann BR, Birnbaum K, Tester M, Baumann U, Johnson AT (2012) Fluorescence-activated cell sorting for analysis of cell type-specific responses to salinity stress in Arabidopsis and rice. In S Shabala, TA Cuin, eds, Plant Salt Tolerance, Vol 913. Humana Press, pp 265-276 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Felle HH (1994) The H+/Cl- symporter in root-hair cells of Sinapis alba (an electrophysiological study using ion-selective microelectrodes). Plant Physiology 106: 1131-1136 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Gaymard F, Pilot G, Lacombe B, Bouchez D, Bruneau D, Boucherez J, Michaux-Ferriere N, Thibaud JB, Sentenac H (1998) Identification and disruption of a plant shaker-like outward channel involved in K+ release into the xylem sap. Cell 94: 647-655 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Geiger D, Scherzer S, Mumm P, Marten I, Ache P, Matschi S, Liese A, Wellmann C, Al-Rasheid KAS, Grill E, Romeis T, Hedrich R (2010) Guard cell anion channel SLAC1 is regulated by CDPK protein kinases with distinct Ca2+ affinities. Proceedings of the National Academy of Sciences 107: 8023-8028 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Geiger D, Scherzer S, Mumm P, Stange A, Marten I, Bauer H, Ache P, Matschi S, Liese A, Al-Rasheid KAS, Romeis T, Hedrich R (2009) Activity of guard cell anion channel SLAC1 is controlled by drought-stress signaling kinase-phosphatase pair. Proceedings of the National Academy of Sciences 106: 21425-21430 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Geilfus C-M, Mithöfer A, Ludwig-Müller J, Zörb C, Muehling KH (2015) Chloride-inducible transient apoplastic alkalinizations induce stomata closure by controlling abscisic acid distribution between leaf apoplast and guard cells in salt-stressed Vicia faba. New Phytologist DOI: 10.1111/nph.13507 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. Gille C, Birgit W, Gille A (2014) Sequence alignment visualization in HTML5 without Java. Bioinformatics 30: 121-122 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Gilliham M, Tester M (2005) The regulation of anion loading to the maize root xylem. Plant Physiology 137: 819-828 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Gong H, Blackmore D, Clingeleffer P, Sykes S, Jha D, Tester M, Walker R (2011) Contrast in chloride exclusion between two grapevine genotypes and its variation in their hybrid progeny. Journal of Experimental Botany 62: 989-999 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Guan R, Qu Y, Guo Y, Yu L, Liu Y, Jiang J, Chen J, Ren Y, Liu G, Tian L, Jin L, Liu Z, Hong H, Chang R, Gilliham M, Qiu L (2014) Salinity tolerance in soybean is modulated by natural variation in GmSALT3. The Plant Journal 80: 937-950 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Henderson SW, Baumann U, Blackmore DH, Walker AR, Walker RR, Gilliham M (2014) Shoot chloride exclusion and salt tolerance in grapevine is associated with differential ion transporter expression in roots. BMC Plant Biology 14: 273 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Horie T, Hauser F, Schroeder JI (2009) HKT transporter-mediated salinity resistance mechanisms in Arabidopsis and monocot crop plants. Trends in Plant Science 14: 660-668 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title James RA, Davenport RJ, Munns R (2006) Physiological characterization of two genes for Na+ exclusion in durum wheat, Nax1 and Nax2. Plant Physiology 142: 1537-1547 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Jeong J, Suh S, Guan C, Tsay Y-F, Moran N, Oh CJ, An CS, Demchenko KN, Pawlowski K, Lee Y (2004) A nodule-specific dicarboxylate transporter from alder is a member of the peptide transporter family. Plant Physiology 134: 969-978 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Jha D, Shirley N, Tester M, Roy SJ (2010) Variation in salinity tolerance and shoot sodium accumulation in Arabidopsis ecotypes linked to differences in the natural expression levels of transporters involved in sodium transport. Plant, Cell & Environment 33: 793-804 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Kamphake LJ, Hannah SA, Cohen JM (1967) Automated analysis for nitrate by hydrazine reduction. Water Research 1: 205-216 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Kanno Y, Hanada A, Chiba Y, Ichikawa T, Nakazawa M, Matsui M, Koshiba T, Kamiya Y, Seo M (2012) Identification of an abscisic acid transporter by functional screening using the receptor complex as a sensor. Proceedings of the National Academy of Sciences 109: 9653-9658 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Kaplan B, Davydov O, Knight H, Galon Y, Knight MR, Fluhr R, Fromm H (2006) Rapid transcriptome changes induced by cytosolic Ca2+ transients reveal ABRE-related sequences as Ca2+-responsive cis elements in Arabidopsis. Plant Cell 18: 2733-2748 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Kohler B, Raschke K (2000) The delivery of salts to the xylem. Three types of anion conductance in the plasmalemma of the xylem parenchyma of roots of barley. Plant Physiology 122: 243-254 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Kohler B, Wegner LH, Osipov V, Raschke K (2002) Loading of nitrate into the xylem: apoplastic nitrate controls the voltage dependence of X-QUAC, the main anion conductance in xylem-parenchyma cells of barley roots. The Plant Journal 30: 133-142 Pubmed: Author and Title Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Kollist H, Jossier M, Laanemets K, Thomine S (2011) Anion channels in plant cells. FEBS Journal 278: 4277-4292 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Kong X-Q, Gao X-H, Sun W, An J, Zhao Y-X, Zhang H (2011) Cloning and functional characterization of a cation-chloride cotransporter gene OsCCC1. Plant Molecular Biology 75: 567-578 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Krouk G, Lacombe B, Bielach A, Perrine-Walker F, Malinska K, Mounier E, Hoyerova K, Tillard P, Leon S, Ljung K, Zazimalova E, Benkova E, Nacry P, Gojon A (2010) Nitrate-regulated auxin transport by NRT1.1 defines a mechanism for nutrient sensing in plants. Developmental Cell 18: 927-937 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Lauchli A, James RA, Huang CX, McCully M, Munns R (2008) Cell-specific localization of Na+ in roots of durum wheat and possible control points for salt exclusion. Plant, Cell & Environment 31: 1565-1574 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Lee SC, Lan W, Buchanan BB, Luan S (2009) A protein kinase-phosphatase pair interacts with an ion channel to regulate ABA signaling in plant guard cells. Proceedings of the National Academy of Sciences 106: 21419-21424 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Léran S, Varala K, Boyer J-C, Chiurazzi M, Crawford N, Daniel-Vedele F, David L, Dickstein R, Fernandez E, Forde B, Gassmann W, Geiger D, Gojon A, Gong J-M, Halkier BA, Harris JM, Hedrich R, Limami AM, Rentsch D, Seo M, Tsay Y-F, Zhang M, Coruzzi G, Lacombe B (2014) A unified nomenclature of NITRATE TRANSPORTER 1/PEPTIDE TRANSPORTER family members in plants. Trends in Plant Science 19: 5-9 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Li J-Y, Fu Y-L, Pike SM, Bao J, Tian W, Zhang Y, Chen C-Z, Zhang Y, Li H-M, Huang J, Li L-G, Schroeder JI, Gassmann W, Gong J-M (2010) The Arabidopsis nitrate transporter NRT1.8 functions in nitrate removal from the xylem sap and mediates cadmium tolerance. Plant Cell 22: 1633-1646 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Lin SH, Kuo HF, Canivenc G, Lin CS, Lepetit M, Hsu PK, Tillard P, Lin HL, Wang YY, Tsai CB, Gojon A, Tsay YF (2008) Mutation of the Arabidopsis NRT1.5 nitrate transporter causes defective root-to-shoot nitrate transport. Plant Cell 20: 2514 - 2528 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Luo GZ, Wang HW, Huang J, Tian AG, Wang YJ, Zhang JS, Chen SY (2005) A putative plasma membrane cation/proton antiporter from soybean confers salt tolerance in Arabidopsis. Plant Molecular Biology 59: 809-820 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Marcotte WR, Russell SH, Quatrano RS (1989) Abscisic acid-responsive sequences from the em gene of wheat. Plant Cell 1: 969976 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Martin PK, Koebner RMD (1995) Sodium and chloride ions contribute synergistically to salt toxicity in wheat. Biologia Plantarum 37: 265-271 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Mäser P, Hosoo Y, Goshima S, Horie T, Eckelman B, Yamada K, Yoshida K, Bakker EP, Shinmyo A, Oiki S, Schroeder JI, Uozumi N (2002) Glycine residues in potassium channel-like selectivity filters determine potassium selectivity in four-loop-per-subunit HKT transporters from plants. Proceedings of the National Academy of Sciences 99: 6428-6433 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Molendijk AJ, Ruperti B, Singh MK, Dovzhenko FA, Milia M, Westphal L, Rosahl S, Soellick TR, Uhrig J, Weingarten L, Huber M, Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. Palme K (2008) A cysteine-rich receptor-like kinase NCRK and a pathogen-induced protein kinase RBK1 are Rop GTPase interactors. Plant Journal 53: 909-923. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Møller IS, Gilliham M, Jha D, Mayo GM, Roy SJ, Coates JC, Haseloff J, Tester M (2009) Shoot Na+ exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na+ transport in Arabidopsis. Plant Cell 21: 2163-2178 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Møller IS, Tester M (2007) Salinity tolerance of Arabidopsis: a good model for cereals? Trends in Plant Science 12: 534-540 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Moya JL, Gomez-Cadenas A, Primo-Millo E, Talon M (2003) Chloride absorption in salt-sensitive Carrizo citrange and salt-tolerant Cleopatra mandarin citrus rootstocks is linked to water use. Journal of Experimental Botany 54: 825-833 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Munns R (2002) Comparative physiology of salt and water stress. Plant, Cell & Environment 25: 239-250 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Munns R, Gilliham M (2015) Salinity tolerance of crops - what is the cost? New Phytologist: DOI: 10.1111/nph.13519 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Munns R, James RA, Xu B, Athman A, Conn SJ, Jordans C, Byrt CS, Hare RA, Tyerman SD, Tester M, Plett D, Gilliham M (2012) Wheat grain yield on saline soils is improved by an ancestral Na+ transporter gene. Nature Biotechnology 30: 360-364 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Munns R, Tester M (2008) Mechanisms of salinity tolerance. Annual Review of Plant Biology 59: 651-681 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Nakashima K, Fujita Y, Katsura K, Maruyama K, Narusaka Y, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2006) Transcriptional regulation of ABI3- and ABA-responsive genes including RD29B and RD29A in seeds, germinating embryos, and seedlings of Arabidopsis. Plant Molecular Biology 60: 51-68 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Marcotte WR, Russell SH, Quatrano RS (1989) Abscisic acid-responsive sequences from the em gene of wheat. Plant Cell 1: 969976 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, Narusaka M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Interaction between two cis-acting elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis RD29A gene in response to dehydration and high-salinity stresses. The Plant Journal 34: 137-148 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Negi J, Matsuda O, Nagasawa T, Oba Y, Takahashi H, Kawai-Yamada M, Uchimiya H, Hashimoto M, Iba K (2008) CO2 regulator SLAC1 and its homologues are essential for anion homeostasis in plant cells. Nature 452: 483-486 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Newstead S, Drew D, Cameron AD, Postis VLG, Xia X, Fowler PW, Ingram JC, Carpenter EP, Sansom MSP, McPherson MJ, Baldwin SA, Iwata S (2011) Crystal structure of a prokaryotic homologue of the mammalian oligopeptide-proton symporters, PepT1 and PepT2. The EMBO Journal 30: 417-426 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Nour-Eldin HH, Andersen TG, Burow M, Madsen SR, Jorgensen ME, Olsen CE, Dreyer I, Hedrich R, Geiger D, Halkier BA (2012) NRT/PTR transporters are essential for translocation of glucosinolate defence compounds to seeds. Nature 488: 531-534 Pubmed: Author and Title Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Parker MB, Gascho GJ, Gaines TP (1983) Chloride toxicity of soybeans grown on atlantic coast flatwoods soils. Agronomy Journal 75: 439-443 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Peña L (2004) Transgenic Plants: Methods and Protocols Humana Press, Totowa, New Jersey Pitman M, Luttge U, Lauchli A, Ball E (1974) Effect of previous water stress on ion uptake and transport in barley seedlings. Functional Plant Biology 1: 377-385 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Pitman MG (1977) Ion transport into the xylem. Annual Review of Plant Physiology 28: 71-88 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Pitman MG (1982) Transport across plant roots. Quarterly Reviews of Biophysics 15: 481-554 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Plett D, Safwat G, Gilliham M, Skrumsager Møller I, Roy S, Shirley N, Jacobs A, Johnson A, Tester M (2010) Improved salinity tolerance of rice through cell type-specific expression of AtHKT1;1. PLoS ONE 5: e12571 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Plett DC, Møller IS (2010) Na+ transport in glycophytic plants: what we know and would like to know. Plant, Cell & Environment 33: 612-626 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Qiu L, Wu D, Ali S, Cai S, Dai F, Jin X, Wu F, Zhang G (2011) Evaluation of salinity tolerance and analysis of allelic function of HvHKT1 and HvHKT2 in Tibetan wild barley. TAG Theoretical and Applied Genetics 122: 695-703 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Qiu Q-S, Guo Y, Dietrich MA, Schumaker KS, Zhu J-K (2002) Regulation of SOS1, a plasma membrane Na+/H+ exchanger in Arabidopsis thaliana, by SOS2 and SOS3. Proceedings of the National Academy of Sciences 99: 8436-8441 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Ren Z-H, Gao J-P, Li L-G, Cai X-L, Huang W, Chao D-Y, Zhu M-Z, Wang Z-Y, Luan S, Lin H-X (2005) A rice quantitative trait locus for salt tolerance encodes a sodium transporter. Nature Genetics 37: 1141-1146 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Rengasamy P (2002) Transient salinity and subsoil constraints to dryland farming in Australian sodic soils: an overview. Australian Journal of Experimental Agriculture 42: 351-361 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Rengasamy P (2006) World salinization with emphasis on Australia. Journal of Experimental Botany 57: 1017-1023 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Roberts SK (1998) Regulation of K+ channels in maize roots by water stress and abscisic acid. Plant Physiology 116: 145-153 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Roberts SK, Snowman BN (2000) The effects of ABA on channel-mediated K+ transport across higher plant roots. Journal of Experimental Botany 51: 1585-1594 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Roy SJ, Gilliham M, Berger B, Essah PA, Cheffings C, Miller AJ, Davenport RJ, Liu LH, Skynner MJ, Davies JM, Richardson P, Leigh RA, Tester M (2008) Investigating glutamate gene co-expression in Arabidopsis thaliana. Plant, Cell & Downloaded fromreceptor-like on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. Environment 31: 861-871 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Roy, SJ, Huang W, Wang XJ, Evrard E, Schmöckel SM, Zafar ZU, Tester M (2013) A novel protien kinase involved in Na+ exclusion revealed from positional cloning. Plant, Cell & Environment 36: 553-568 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Roy SJ, Negrão S, Tester M (2014) Salt resistant crop plants. Current Opinion in Biotechnology 26: 115-124 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Sali A, Blundell T (1994) Comparative protein modelling by satisfaction of spatial restraints. Protein Structure by Distance Analysis 64: C86 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Sanders D (1980) The mechanism of Cl- transport at the plasma membrane of Chara corallina I. Cotransport with H+. The Journal of Membrane Biology 53: 129-141 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Schachtman DP, Tyerman SD, Terry BR (1991) The K+/Na+ selectivity of a cation channel in the plasma membrane of root cells does not differ in salt-tolerant and salt-sensitive wheat species. Plant Physiology 97: 598-605 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Schwab R, Ossowski S, Riester M, Warthmann N, Weigel D (2006) Highly specific gene silencing by artificial microRNAs in Arabidopsis. Plant Cell 18: 1121-1133 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Segonzac C, Boyer JC, Ipotesi E, Szponarski W, Tillard P, Touraine B, Sommerer N, Rossignol M, Gibrat R (2007) Nitrate efflux at the root plasma membrane: Identification of an Arabidopsis excretion transporter. Plant Cell 19: 3760-3777 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Shelden MC, Howitt SM, Kaiser BN, Tyerman SD (2009) Identification and functional characterisation of aquaporins in the grapevine, Vitis vinifera. Functional Plant Biology 36: 1065-1078 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Shen M-y, Sali A (2006) Statistical potential for assessment and prediction of protein structures. Protein Science 15: 2507-2524 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Shi H, Quintero FJ, Pardo JM, Zhu J-K (2002) The putative plasma membrane Na+/H+ antiporter SOS1 controls long-distance Na+ transport in plants. Plant Cell 14: 465-477 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Shi HZ, Ishitani M, Kim CS, Zhu JK (2000) The Arabidopsis thaliana salt tolerance gene SOS1 encodes a putative Na+/H+ antiporter. Proceedings of the National Academy of Sciences 97: 6896-6901 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Simpson SD, Nakashima K, Narusaka Y, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Two different novel cis-acting elements of ERD1, a CLPA homologous Arabidopsis gene function in induction by dehydration stress and dark-induced senescence. The Plant Journal 33: 259-270 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Skerrett M, Tyerman SD (1994) A channel that allows inwardly directed fluxes of anions in protoplasts derived from wheat roots. Planta 192: 295-305 Pubmed: Author and Title CrossRef: Author and Title Downloaded Google Scholar: Author Only Title Only Author and Title from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. Stacey G, Koh S, Granger C, Becker JM (2002) Peptide transport in plants. Trends in Plant Science 7: 257-263 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Storey R, Walker RR (1999) Citrus and salinity. Scientia Horticulturae 78: 39-81 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Subramanian C, Woo J, Cai X, Xu X, Servick S, Johnson CH, Nebenführ A, Von Arnim AG (2006) A suite of tools and application notes for in vivo protein interaction assays using bioluminescence resonance energy transfer (BRET). The Plant Journal 48: 138152 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Sun J, Bankston JR, Payandeh J, Hinds TR, Zagotta WN, Zheng N (2014) Crystal structure of the plant dual-affinity nitrate transporter NRT1.1. Nature 507: 73-77 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Sunarpi, Horie T, Motoda J, Kubo M, Yang H, Yoda K, Horie R, Chan W-Y, Leung H-Y, Hattori K, Konomi M, Osumi M, Yamagami M, Schroeder JI, Uozumi N (2005) Enhanced salt tolerance mediated by AtHKT1 transporter-induced Na+ unloading from xylem vessels to xylem parenchyma cells. The Plant Journal 44: 928-938 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Takano J, Noguchi K, Yasumori M, Kobayashi M, Gajdos Z, Miwa K, Hayashi H, Yoneyama T, Fujiwara T (2002) Arabidopsis boron transporter for xylem loading. Nature 420: 337-340 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Tamura K, Peterson D, Peterson N, Stecher G, Nei M and Kumar S (2011) MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731-2739. Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Taochy C, Gaillard I, Ipotesi E, Oomen R, Leonhardt N, Zimmermann S, Peltier JB, Szponarski W, Simonneau T, Sentenac H (2015) The Arabidopsis root stele transporter NPF2. 3 contributes to nitrate translocation to shoots under salt stress. The Plant Journal DOI:10.1111/tpj.12901 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Tavakkoli E, Fatehi F, Coventry S, Rengasamy P, McDonald GK (2011) Additive effects of Na+ and Cl- ions on barley growth under salinity stress. Journal of Experimental Botany 62: 2189-2203 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Teakle NL, Flowers TJ, Real D, Colmer TD (2007) Lotus tenuis tolerates the interactive effects of salinity and waterlogging by 'excluding' Na+ and Cl- from the xylem. Journal of Experimental Botany 58: 2169-2180 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Teakle NL, Tyerman SD (2010) Mechanisms of Cl- transport contributing to salt tolerance. Plant, Cell & Environment 33: 566-589 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Tester M, Davenport R (2003) Na+ tolerance and Na+ transport in higher plants. Annals of Botany 91: 503-527 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Tilman D, Balzer C, Hill J, Befort BL (2011) Global food demand and the sustainable intensification of agriculture. Proceedings of the National Academy of Sciences 108: 20260-20264 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Tregeagle JM, Tisdall JM, Blackmore DH, Walker RR (2006) A diminished capacity for chloride exclusion by grapevine rootstocks following long-term saline irrigation in an inland versus a coastal region of Australia. Australian Journal of Grape and Wine Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. Research 12: 178-191 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Tsay YF, Chiu CC, Tsai CB, Ho CH, Hsu PK (2007) Nitrate transporters and peptide transporters. FEBS Letters 581: 2290 - 2300 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Tyerman SD (1992) Anion channels in plants. Annual Review of Plant Physiology and Plant Molecular Biology 43: 351-373 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Uozumi N, Kim EJ, Rubio F, Yamaguchi T, Muto S, Tsuboi A, Bakker EP, Nakamura T, Schroeder JI (2000) The Arabidopsis HKT1 gene homolog mediates inward Na+ currents in Xenopus laevis oocytes and Na+ uptake in Saccharomyces cerevisiae. Plant Physiology 122: 1249-1260 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Urao T, Yamaguchi-Shinozaki K, Urao S, Shinozaki K (1993) An Arabidopsis myb homolog is induced by dehydration stress and its gene product binds to the conserved MYB recognition sequence. Plant Cell 5: 1529-1539 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Vahisalu T, Kollist H, Wang YF, Nishimura N, Chan WY, Valerio G, Lamminmaki A, Brosche M, Moldau H, Desikan R, Schroeder JI, Kangasjarvi J (2008) SLAC1 is required for plant guard cell S-type anion channel function in stomatal signalling. Nature 452: 487491 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Vahisalu T, Puzõrjova I, Brosché M, Valk E, Lepiku M, Moldau H, Pechter P, Wang Y-S, Lindgren O, Salojärvi J, Loog M, Kangasjärvi J, Kollist H (2010) Ozone-triggered rapid stomatal response involves the production of reactive oxygen species, and is controlled by SLAC1 and OST1. The Plant Journal 62: 442-453 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Waters S, Gilliham M, Hrmova M (2013) Plant high-affinity potassium (HKT) transporters involved in salinity tolerance: structural insights to probe differences in ion selectivity. International Journal of Molecular Sciences 14: 7660-7680 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Weigel D, Glazebrook J (2002) Arabidopsis: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title White PJ, Broadley MR (2001) Chloride in soils and its uptake and movement within the plant: A review. Annals of Botany 88: 967988 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Wu S, Zhang Y (2007) LOMETS: A local meta-threading-server for protein structure prediction. Nucleic Acids Research 35: 33753382 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Wu SJ, Ding L, Zhu JK (1996) SOS1, a genetic locus essential for salt tolerance and potassium acquisition. Plant Cell 8: 617-627 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Xu G, Magen H, Tarchitzky J, Kafkafi U (1999) Advances in chloride nutrition of plants. In LS Donald, ed, Advances in Agronomy, Vol Volume 68. Academic Press, pp 97-150 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Yamashita T, Shimada S, Guo W, Sato K, Kohmura E, Hayakawa T, Takagi T, Tohyama M (1997) Cloning and functional expression of a brain peptide/histidine transporter. Journal of Biological Chemistry 272: 10205-10211 Pubmed: Author and Title CrossRef: Author and Title Downloaded Google Scholar: Author Only Title Only Author and Title from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved. Yoo S-D, Cho Y-H, Sheen J (2007) Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nature Protocols 2: 1565-1572 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Zhou J-J, Theodoulou FL, Muldin I, Ingemarsson B, Miller AJ (1998) Cloning and functional characterization of a Brassica napus transporter that is able to transport nitrate and histidine. Journal of Biological Chemistry 273: 12017-12023 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Downloaded from on June 14, 2017 - Published by www.plantphysiol.org Copyright © 2015 American Society of Plant Biologists. All rights reserved.