Download Is a Risk Factor for Diabetic Nephropathy in Type 1

Pathophysiology/Complications
O R I G I N A L
A R T I C L E
The Xylosyltransferase I Gene
Polymorphism c.343G>T (p.A125S) Is a
Risk Factor for Diabetic Nephropathy in
Type 1 Diabetes
SYLVIA SCHÖN, PHD1
CHRISTIAN PRANTE, MS1
CLAUDIA BAHR, MS1
LISE TARNOW, MD, DMSC2
JOACHIM KUHN, PHD1
KNUT KLEESIEK, MD1
CHRISTIAN GÖTTING, PHD1
OBJECTIVE — Xylosyltransferase I (XT-I) is the chain-initiating enzyme in the biosynthesis
of proteoglycans in basement membranes. It catalyzes the transfer of xylose to selected serine
residues in the core protein. The XYLT-II gene codes for a protein highly homologous to XT-I.
Proteoglycans are important components of basement membranes and are responsible for their
permeability properties. Type 1 diabetic patients have an altered proteoglycan metabolism,
which results in microvascular complications. Thus, genetic variations in the xylosyltransferase
genes might be implicated in the initiation and progression of these complications.
RESEARCH DESIGN AND METHODS — Genotyping of four genetic variations in the
genes XYLT-I and XYLT-II was performed in 912 type 1 diabetic patients (453 with and 459
without diabetic nephropathy) using restriction fragment–length polymorphism.
RESULTS — The distribution of the c.343G⬎T polymorphism in XYLT-I is significantly
different between patients with and without diabetic nephropathy (P ⫽ 0.03). T-alleles were
more frequent in patients with diabetic nephropathy (odds ratio 2.47 [95% CI 1.04 –5.83]). The
allelic frequencies of the other investigated XYLT-I and XYLT-II variations (XYLT-I: c.1989T⬎C
in exon 9; XYLT-II: IVS6 –9T⬎C and IVS6 –14_IVS6 –13insG in intron 5; and c.2402C⬎G: p.T801R
in exon 11) were not different between patients with and without diabetic nephropathy.
CONCLUSIONS — The XYLT-I c.343G⬎T polymorphism contributes to the genetic susceptibility to development of diabetic nephropathy in type 1 diabetic patients.
Diabetes Care 29:2295–2299, 2006
T
ype 1 diabetic patients have a high
risk of developing several microand macrovascular complications
such as diabetic nephropathy, diabetic
retinopathy, and cardiovascular disease
(1). Diabetic nephropathy affects 23–
40% of type 1 diabetic patients, and peak
onset is within 10 –20 years of duration of
diabetes (2– 4). The molecular mechanisms of this microvascular complication
still remain unclear, and present studies
suggest a multifactorial etiology with contributions from hemodynamic alterations, metabolic abnormalities, and
various growth factors as modifiable risk
factors acting on a genetic background
(5,6). Consequently, multiple genetic factors are thought to affect susceptibility to
the pathogenesis of diabetic nephropathy
(5,7,8).
Factors associated with microangiopathy include the thickening of the cap-
● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●
From the 1Institut für Laboratoriums und Transfusionsmedizin, Herz und Diabeteszentrum NordrheinWestfalen, Universitätsklinik der Ruhr-Universität Bochum, Bad Oeynhausen, Germany; and the 2Steno
Diabetes Center, Gentofte, Denmark.
Address correspondence and reprint requests to Christian Götting, Institut für Laboratoriums und Transfusionsmedizin, Herz und Diabeteszentrum Nordrhein-Westfalen, Georgstra␤e 11, 32545 Bad Oeynhausen,
Germany. E-mail: [email protected].
Received for publication 10 February 2006 and accepted in revised form 13 July 2006.
Abbreviations: SNP, single nucleotide polymorphism.
A table elsewhere in this issue shows conventional and Système International (SI) units and conversion
factors for many substances.
DOI: 10.2337/dc06-0344
© 2006 by the American Diabetes Association.
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby
marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
DIABETES CARE, VOLUME 29, NUMBER 10, OCTOBER 2006
illary basement membrane, which
represents the central hallmark of the disease (9). Thickening of the basement
membrane results in an increased capillary permeability of the microcirculation
and is correlated with the degree of vasodilatory impairment (10).
The capillary basement membrane
contains heparan sulfate, chondroitin sulfate, and dermatan sulfate proteoglycans.
The sulfate groups of these proteoglycans
confer an anionic charge that contributes
to the charge-dependent permeability of
the vessels, especially in the glomerular
basement membrane (11,12). Perlecan is
the predominant heparan sulfate proteoglycan in the basement membrane (13),
which is important for its structural integrity and appears to play a role in all diabetes complications (14). Diabetic
patients have an altered proteoglycan metabolism leading to a decreased content of
heparan sulfate proteoglycans in the capillary and glomerular basement membranes (12).
Proteoglycans are macromolecules
composed of a protein core to which glycosaminoglycans are covalently attached.
The biological function of proteoglycans
is intimately related to these anionic glycosaminoglycan chains. The glycosylation of core proteins in heparan sulfate,
chondroitin sulfate, and dermatan sulfate
proteoglycans is initiated by xylosyltransferase I (XT-I; EC 2.4.2.26), which catalyzes the transfer of xylose from UDPxylose to selected serine residues in the
core protein. This is the first and ratelimiting step in the formation of the glycosaminoglycan chains. The XYLT-II gene
codes for a protein highly homologous to
the XT-I (15). Both are type II transmembrane proteins with a highly conserved
COOH-terminal region, where the catalytic domain is located in glycosyltransferases. These findings led us to conclude
that the XYLT-II gene encodes another xylosyltransferase, although the catalytic activity and the biological function of XT-II
are not yet known in detail (15).
The impaired function of basement
membranes is associated with the patho2295
Xylosyltransferase and diabetic nephropathy
Table 1—Clinical characteristics of 912 Caucasian type 1 diabetic patients subdivided into patients with and without nephropathy
Type 1 diabetic patients
n
Sex (male/female)
Age (years)
Duration of diabetes (years)
Duration of nephropathy (years)
Retinopathy (nihil/simplex/proliferative)
BMI (kg/m2)
Insulin dosage (IU/24 h)
Hypertension
Antihypertensive treatment
Systolic blood pressure (mmHg)
Diastolic blood pressure (mmHg)
A1C (%)
Urinary albumin excretion rate (mg/24 h)
Serum creatinine (␮mol/l)
Statin treatment
Cholesterol (mmol/l)
HDL cholesterol (mmol/l)
With nephropathy
Without nephropathy
P
453
274/179
42.5 ⫾ 10.9
28.1 ⫾ 8.7
6.8 ⫾ 4.9
9/131/313
24.4 ⫾ 3.5
43.0 ⫾ 14.5
342 (75.5)
329 (72.6)
143 ⫾ 20
81 ⫾ 12
9.3 ⫾ 1.5
614 (3–7,974)
103 (54–706)
383 (84.5)
5.6 ⫾ 1.2
1.52 ⫾ 0.64
459
255/204
46.0 ⫾ 12.2
25.9 ⫾ 9.6
—
172/183/104
24.3 ⫾ 3.5
44.5 ⫾ 15.4
109 (23.7)
91 (19.8)
134 ⫾ 18
77 ⫾ 10
8.4 ⫾ 1.0
7 (1–30)
79 (40–134)
312 (68.0)
4.9 ⫾ 1.0
1.63 ⫾ 0.48
—
0.19
⬍0.01
⬍0.01
—
⬍0.01
0.78
0.17
⬍0.01
⬍0.01
⬍0.01
⬍0.01
⬍0.01
⬍0.01
⬍0.01
⬍0.01
⬍0.01
⬍0.01
Data are means ⫾ SD, median (range) (urinary albumin excretion rate and serum creatinine), or n (%) unless otherwise indicated.
genesis of hypertension and microvascular complications in type 1 diabetic
patients. Therefore, we have now investigated variations in the XYLT genes to analyze the hitherto unknown impact of the
xylosyltransferases, the initial and committing step enzymes in proteoglycan homeostasis, in diabetic nephropathy. This
follow-up study was carried out to elucidate the importance of four recently described XYLT variations conferring
genetic susceptibility to microvascular
complications in type 1 diabetic patients
(16).
RESEARCH DESIGN AND
METHODS — We examined DNA
samples from 912 type 1 diabetic patients, 453 with and 459 without diabetic
nephropathy, from the Steno Diabetes
Center (Gentofte, Denmark). All adult
Danish Caucasian type 1 diabetic patients
who were suffering from diabetic nephropathy and were attending the outpatient clinic at Steno Diabetes Center since
1993 were asked to participate in a study
of genetic risk factors for development of
diabetic nephropathy (17). Of these,
⬎70% was accepted and a corresponding
control group of patients with type 1 diabetes and persistent normal urinary albumin excretion rates was recruited from
the outpatient clinic (17). The previously
described 96 patients (16) were not considered in this study. The clinical characteristics of the investigated patients are
2296
summarized in Table 1. All type 1 diabetic
patients included in this study had duration of diabetes of at least 11 years. The
patients had been dependent on insulin
treatment from the time of diagnosis and
received multiple injections of insulin per
day. The average daily insulin dosage is
given in Table 1. Of the patients, 438 were
suffering from diabetic nephropathy in
the predialysis state (96.7%), 3 were on
maintenance dialysis (0.7%), and 12 received a kidney transplant (2.6%). A total
of 268 of the diabetic nephropathy patients with antihypertensive treatment
and 56 of the corresponding patients
without diabetic nephropathy received an
antihypertensive treatment with blockade
of the renin-angiotensin-aldosterone system (ACE inhibitors, ␤-blockers, spironolactone, and ␣2 agonists).
The clinical examination of the patients occurred at the Steno Diabetes Center since 1993 (17). The investigations
were performed on the same day as the
drawing of the blood samples without any
required pretreatment or fasting. Diabetic
nephropathy was manifested if the following criteria were fulfilled: persistent
albuminuria of ⱖ300 mg/24 h in at least
two of three consecutive 24-h urine collections, presence of retinopathy, and no
clinical or laboratory evidence of kidney
or renal tract disease other than diabetic
glomerulosclerosis (18,19). If no signs of
retinopathy were observed, a kidney biopsy was required for diabetic nephropa-
thy diagnosis. Diabetic retinopathy was
determined by fundus photography after
papillary dilatation and graded: nihil,
simplex, and proliferative diabetic retinopathy (17,20). Hypertension was defined as systolic blood pressure of ⬎140
mmHg and/or diastolic blood pressure
⬎90 mmHg and/or use of antihypertensive medication. Standard methods were
used for clinical laboratory analysis as described previously (20). The experimental design was approved by the local
ethics committee, and all patients gave
their informed consent.
Genotyping
Genotyping of XYLT polymorphisms was
performed by restriction fragment–length
polymorphism. Therefore, we amplified
the exons of interest from genomic DNA
by PCR. PCR was performed in a 25-␮l
reaction volume, containing ⬃30 ng
genomic DNA, 12.5 pmol of each primer
(Invitrogen, Leek, the Netherlands),
0.125 mmol/l of each dNTP (Promega,
Madison, WI), and 0.75 units HotStarTaq-DNA-Polymerase (Qiagen, Hilden,
Germany) in 1⫻ PCR buffer. For the amplification of exon 1 (XYLT-I), the addition of betaine (Sigma, St. Louis, MO) was
necessary. We generated a restriction site
for the analysis of c.2402C⬎G with the
described primer. The primer sequences,
annealing temperatures, and sizes of the
PCR products are summarized in Table 2.
The PCR conditions were as follows: ini-
DIABETES CARE, VOLUME 29, NUMBER 10, OCTOBER 2006
Schön and Associates
Table 2—Primer sequences, PCR conditions, and restriction enzymes for the investigated xylosyltransferase variations
DNA alteration
XYLT-I; exon 1
c.343G⬎T; p.A115S
XYLT-I; exon 9
c.1989T⬎C
XYLT-II; intron 5
IVS6–9T⬎C
IVS6–14_IVS6–13insG
XYLT-II; exon 11
c.2402C⬎G; p.T801R
rs number*
—
12708815
—
6504649
PCR primer (5⬘–3⬘)†
Annealing
temperature (°C)
Amplified size
(bp)
62
444
NmuCI
55
476
BsuRI
55
353
HpyF10VI
59
190
BtsI
Forward: GGG TCC CCG CGC CTC G
Reverse: CCT CCC TCC CTC GCC GC
Forward: GGA GGG TGG CGT TAG ATG
Reverse: CAA CCC CCA GCA CTC G
Forward: AAA GAG CTT AGA CCC CAC
Reverse: GCA AGG GAG AGT GGA AGG
Forward: CAGGGGGTGTGCTTACT
Reverse: GCCTCGAGCGCAGGGCCTGTGAGCAGT
Restriction
enzyme
Mutation numbering refers to the cDNA sequences with the A of the ATG translation initiation start site as nucleotide ⫹1. Numbering of the XYLT-I variations are
based on human cDNA sequence (GenBank accession no. NM_022166). Numbering of the XYLT-II variations were based on the human cDNA sequence (GenBank
accession no. NM_022167). *rs number according to data bank (http://www.ensembl.org and http://snpper.org). †For the generation of a restriction site, we
changed one nucleotide in the primer; the changed nucleotide is bold and underlined.
tial denaturation at 95°C for 15 min, followed by 35 cycles of denaturation at
94°C for 1 min, annealing at fragmentspecific temperature (Table 2) for 1 min,
extension at 72°C for 1 min, and a final
extension at 72°C for 15 min. The PCR
products were restricted with the enzymes listed in Table 2 obtained from MBI
Fermentas (St. Leon-Rot, Germany) and
New England BioLabs (Frankfurt, Germany), and digestions were performed for
12 h according to the manufacturer’s instructions. PCR products of restrictionpositive probes for the IVS6 –9T⬎C and
IVS6 –14_IVS6 –13insG in intron 5 of
XYLT-II were initially sequenced on an
Applied Biosystems 310 capillary sequencer using the BigDye Terminator
v1.1 cycle sequencing kit (Perkin Elmer,
Applied Biosystems, Foster City, CA) to
check for the state of both variations.
For the determination of the restriction fragment–length polymorphism assay characteristics, a set of 10 evaluation
samples containing wild-type, homozygous mutant, and heterozygous mutant
genotypes were analyzed over a period of
14 days. The intra- and interassay precision was 100% for all genotyping methods. All results were 100% in
concordance with the genotypes determined by DNA sequencing. To ensure the
accuracy of the used genotyping methods, 10% of the samples used in this study
were amplified by PCR again and reinvestigated by the restriction fragment–length
polymorphism method. Samples for reevaluation were selected by a randomaccess procedure. Furthermore, 10
samples of each genotype were independently amplified by PCR and doublestranded sequenced. No genotype
discrepancies were observed in any case.
variables, a Mann-Whitney U test was
used. Multiple logistic regression analysis
was performed to assess the independent
role of the c.343G⬎T (p.A115S) SNP in
XT-I and sex, age, HbA1c (A1C), duration
of diabetes, and nephropathy, retinopathy, hypertension, and BMI. The sample
size and the post hoc power of the study
were determined with the software CATS
power calculator for genetic studies (21)
and POWER (22), respectively.
Statistical analysis
The distribution of the alleles of each single nucleotide polymorphism (SNP) was
tested for the Hardy-Weinberg equilibrium. Fisher’s two-tailed exact P test was
used to compare allele frequencies between patients with and without diabetic
nephropathy. P values of ⬍0.05 were
considered statistically significant. In
consideration of multiple testing, P values
were corrected according to the Bonferroni or Sidák method, if appropriate. For
normally distributed clinical characteristics, a comparison between the groups
was performed using an unpaired Student’s t test. For nonnormally distributed
Allele frequencies in type 1 diabetic
patients with and without diabetic
nephropathy
The allele frequencies of the investigated
XYLT-I and XYLT-II variations in DNA
samples from type 1 diabetic patients
with and without diabetic nephropathy
are summarized in Table 3. The genotype
distributions for these variations were all
in Hardy-Weinberg equilibrium. The allele frequencies of the XYLT-I SNP
c.343G⬎T are significantly different in
patients with and without diabetic nephropathy (P ⫽ 0.03) (Table 3). The Tallele occurs with a higher frequency in
diabetic nephropathy patients (2.4% in
RESULTS
Table 3—Allele frequencies of XYLT variations in type 1 diabetic patients with and without diabetic nephropathy
Type 1 diabetic patients
SNP
XYLT-I; c.343G⬎T
XYLT-I; c.1989T⬎C
XYLT-II; IVS6–9T⬎C/IVS6–14_IVS6–13insG*
XYLT-II; c.2402C⬎G
With nephropathy
(n ⫽ 453; 906 alleles)
Without nephropathy
(n ⫽ 459; 918 alleles)
P (nephropathy vs.
no nephropathy)
39 (4.3)
347 (38.3)
18 (2.0)
385 (42.5)
22 (2.4)
324 (35.3)
15 (1.6)
365 (39.8)
0.03
0.19
0.60
0.25
Data are n (%). *These variations were always detected together and only in the heterozygous state.
DIABETES CARE, VOLUME 29, NUMBER 10, OCTOBER 2006
2297
Xylosyltransferase and diabetic nephropathy
patients without diabetic nephropathy
and 4.3% in patients with diabetic nephropathy). Therefore, the carriage of this
variation is associated with the development of diabetic nephropathy in type 1
diabetic patients (odds ratio 1.83 [95% CI
1.08 –3.12]). After adjustment for sex,
age, duration of diabetes, and nephropathy, retinopathy, A1C, BMI, and hypertension, this SNP remained significant
(2.47 [1.04 –5.83], P ⫽ 0.03). Genotype
distributions of the other three analyzed
variations did not differ between patients
with and without diabetic nephropathy
(P ⬎ 0.1), indicating that they are not associated with the development of diabetic
nephropathy in type 1 diabetic patients.
Power estimations have shown that the
present study had a sufficient sample size
to confirm associations with a ⬎85%
power for a relative risk of ⱖ2.0 for the
more frequent variants (minor allele frequency 30 – 45%; significance level ␣ 5%)
assuming a recessive, multiplicative,
dominant, or additive model for diabetic
nephropathy. For the less abundant polymorphisms (minor allele frequency
2– 4%; significance level ␣ 5%), our study
had a power of ⬎80% if the relative risk
exceeds 2.0 for a dominant or additive
disease model. However, assuming a recessive model for these less frequent polymorphisms, the power was ⬍2%. The
allelic frequencies of the XYLT-I SNPs
c.343C⬎T and c.1989C⬎T and the
XYLT-II SNPs IVS6 –9T⬎C/IVS6 –
14_IVS6 –13insG and c.2402C⬎G in a
general nondiabetic Caucasian cohort
were 3.7% (23/630), 33.6% (218/648),
1.9% (17/862), and 38.7% (313/808), respectively.
Genotype-phenotype associations
To analyze if the investigated variations
are implicated in alterations of clinical
characteristics, we compared the phenotypes of patients with and without diabetic nephropathy with the dependency
of their genotype. This comparison
showed associations for the c.1989T⬎C
SNP in exon 9 of XYLT-I and patients’
blood pressure and serum creatinine values. Nephropathy patients with the detected SNP in the homo- or heterozygous
state at position c.1989T⬎C in exon 9 of
XYLT-I had significantly lower systolic
and diastolic blood pressures (systolic
blood pressure, 141 ⫾ 1 mmHg; diastolic
blood pressure, 80 ⫾ 1 mmHg, n ⫽ 291;
P ⫽ 0.03) compared with the wild-type
allele carriers (systolic blood pressure,
146 ⫾ 2 mmHg; diastolic blood pressure,
2298
83 ⫾ 1 mmHg, n ⫽ 162). No further relevant genotype-phenotype correlations
were detected.
CONCLUSIONS — Hallmarks of microvascular complications in type 1 diabetic patients are alterations in the
structure and function of basement membranes (10). It was shown that the decreased content of heparan sulfate
proteoglycans in the capillary and glomerular basement membrane leads to impaired function (12). The altered
proteoglycan content in the basement
membrane is possibly caused by an impaired proteoglycan homeostasis.
Changes in proteoglycan degradation and
its resynthesis rates point to the enzymes
involved in proteoglycan biosynthesis
and to genetic variations in the corresponding genes. XT-I is the initial and apparently rate-limiting enzyme in the
biosynthesis of heparan sulfate proteoglycans. Therefore, we investigated in a large
cohort of type 1 diabetic patients with and
without diabetic nephropathy the distribution of four previously described variations in the XYLT-I and XYLT-II genes
(16). These variations included a combination of a nucleotide exchange and an
insertion in intron 5 of XYLT-II (IVS6 –
9T⬎C and IVS6 –14_IVS6 –13insG) and
three SNPs. Two of these SNPs were coding (c.343G⬎T; p.A115S in XYLT-I and
c.2402C⬎G; p.T801R in XYLT-II) and
one was synonymous (c.1989T⬎C in
XYLT-I).
The T-allele of the nonsynonymous
SNP c.343G⬎T (p.A115S) in exon 1 of
XYLT-I occurs with a significantly higher
frequency in diabetic nephropathy patients. This finding indicates that this
polymorphism is associated with the development of diabetic nephropathy in
type 1 diabetic patients. The amino acid
exchange p.A115S is located in the stem
region of XT-I, which contains the putative proteinase restriction site for the generation of the soluble form of XT-I (23).
Furthermore, it was discussed that the
stem region is an important part of the
signal sequence required for the Golgi localization of the enzyme. The localization
of XT-I in the Golgi compartment is crucial for the proper function of this enzyme, since the xylosylation of the core
proteins occurs in the early Golgi apparatus (24). The importance of the alanine
residue at position 115 is supported by a
phylogenetic comparison of the xylosyltransferase sequences of mus musculus,
pan troglodytes, canis familiaris, Xenopus
laevis, and other species. The alignment
reveals that the alanine residue at this position is highly conserved, although it is
located in a region that is characterized by
a minor degree of sequence homology.
Consequently, this amino acid exchange
is accused to effect the enzyme localization and to influence the proteoglycan resynthesis rate. This impact on the
proteoglycan homeostasis in the glomerular basement membrane gives a biochemical explanation of the statistical
association of p.A115S with the more
than twofold increased risk for developing diabetic nephropathy. Unfortunately,
information on the heparan sulfate content in the glomerular basement membrane of the T-allele carriers who suffer
from diabetic nephropathy was not available. However, the detailed elucidation of
the effects of the alteration from the unpolar amino acid alanine to the more reactive and hydrophile amino acid serine
on these processes is only possible after
the successful identification of the signal
sequence and the protease cleavage site.
Furthermore, follow-up studies should
investigate whether p.A115S is also a risk
factor for diabetic nephropathy in type 2
diabetic patients and for other chronic
kidney diseases.
The statistical associations of the
SNPs c.2402C⬎G and IVS6 –9T⬎C and
IVS6 –14_IVS6 –13insG in the XYLT-II
gene, which were detected in the pilot
study comprising 48 patients with diabetic nephropathy and 48 patients without diabetic nephropathy (16), could not
be approved in this follow-up study. This
result shows that positive findings in a
small group could be identified as falsepositive associations when larger sample
sets are studied.
However, the present study confirms
the previously detected connection between the variation c.1989T⬎C in exon 9
of XYLT-I and a reduced blood pressure.
Diabetic nephropathy patients carrying
the C-allele had significantly lower systolic and diastolic blood pressures than
diabetic nephropathy patients with the Tallele. We can only assume the way in
which this synonymous variation could
influence patients’ blood pressure. Probably, this SNP is only a marker SNP and
may be associated with the described effects in combination with other, to date
unknown, variations. The variations that
are responsible for the detected effects
could be located in the introns or in the
promoter region of the XYLT-I gene. They
could function as enhancers, silencers, or
DIABETES CARE, VOLUME 29, NUMBER 10, OCTOBER 2006
Schön and Associates
transcription factor binding sites and affect gene transcription or RNA splicing.
However, we can exclude the linkage with
exonic alterations because we screened all
XYLT-I exons and the exon/intron junctions (16).
The power of our present study was
adequate to reliably detect doubling effects of the diabetic nephropathy risk.
However, it cannot be totally excluded
that relationships of smaller magnitude
may have been missed in our analysis.
The power did not exceed 0.8, especially
for the low abundant variants with a minor allele frequency of ⬍4%, indicating
the possibility that the results may be
falsely negative. Furthermore, our cohort
size was not large enough to detect small
associations of these less frequent variants
when assuming a recessive disease model.
In conclusion, this follow-up study
pointed out an association between the
c.343G⬎T-SNP in the XYLT-I gene and
diabetic nephropathy. The identification
of major and minor risk factors for the
development of diabetic nephropathy in
diabetic patients is of importance due to
the high morbidity and mortality of this
chronic progressive kidney disease. Numerous genes and corresponding sequence variations were shown to have an
impact on the risk for developing diabetic
renal diseases. The gene products are involved in different physiological and
pathological pathways including glucose
metabolism, hemodynamic regulation, or
extracellular matrix production (7,8,24 –
26). The identification of these new risk
factors for diabetic nephropathy together
with an insistent treatment (27,28) is crucial to delay or prevent end-stage renal
disease and improve survival. The higher
appearance of the c.343T allele in diabetic
nephropathy patients detected in this
study should be evaluated as an early
marker for risk assessment of developing
diabetic nephropathy in type 1 diabetic
patients in further investigations.
Acknowledgments — The authors thank Alexandra Adam and Oliver Jungmann for excellent assistance and Sarah L. Kirkby for
linguistic advice.
References
1. van Ittersum FJ, de Man AM, Thijssen S, de
Knijff P, Slagboom E, Smulders Y, Tarnow
L, Donker AJ, Bilo HJ, Stehouwer CD: Genetic polymorphisms of the renin-angiotensin system and complications of insulin-
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
DIABETES CARE, VOLUME 29, NUMBER 10, OCTOBER 2006
dependent diabetes mellitus. Nephrol Dial
Transplant 15:1000 –1007, 2000
Martinez-Castelao A, De Alvaro F, Gorriz
JL: Epidemiology of diabetic nephropathy
in Spain. Kidney Int 68:S20 –S24, 2005
Fox CS, Larson MG, Leip EP, Meigs JB,
Wilson PW, Levy D: Glycemic status and
development of kidney disease: the Framingham Heart Study. Diabetes Care 28:
2436 –2440, 2005
Parving HH, Osterby R, Ritz E: Diabetic
nephropathy. In The Kidney. 6th ed. Brenner BM, Ed. Philadelphia, WB Saunders,
2000, p. 1731–1773
Parving HH: Renoprotection in diabetes:
genetic and non-genetic risk factors and
treatment. Diabetologia 41:745–759, 1998
Raskin P: Risk factors for the development
of diabetic complications. J Diabetes Complications 8:195–200, 1994
Krolewski AS: Genetics of diabetic nephropathy: evidence for major and minor
gene effects. Kidney Int 55:1582–1596,
1999
Merta M, Reiterova J, Rysava R, Kmentova
D, Tesar V: Genetics of diabetic nephropathy. Nephrol Dial Transplant 18:v24 –
v25, 2003
Johnson PC, Brendel K, Meezan E: Human diabetic perineurial cell basement
membrane thickening. Lab Invest 44:265–
270, 1981
Rayman G, Malik RA, Sharma AK, Day JL:
Microvascular response to tissue injury
and capillary ultrastructure in the foot
skin of type 1 diabetic patients. Clin Sci
89:467– 474, 1995
Scott PG: Macromolecular constituents of
basement membranes: a review of current
knowledge on their structure and function. Can J Biochem Cell Biol 61:942–948,
1983
Vernier RL, Steffes MW, Sisson-Ross S,
Mauer SM: Heparan sulfate proteoglycan
in the glomerular basement membrane in
type 1 diabetes mellitus. Kidney Int 41:
1070 –1080, 1992
Conde-Knape K: Heparan sulfate proteoglycans in experimental models of diabetes: a role for perlecan in diabetes
complications. Diabetes Metab Res Rev 17:
412– 421, 2001
Raats CJ, Van Den Born J, Berden JH: Glomerular heparan sulfate alterations:
mechanisms and relevance for proteinuria. Kidney Int 57:385– 400, 2000
Götting C, Kuhn J, Zahn R, Brinkmann T,
Kleesiek K: Molecular cloning and expression of human UDP-D-xylose: proteoglycan core protein ␤-D-xylosyltransferase
and its first isoform XT-II. J Mol Biol 304:
517–528, 2000
Schön S, Prante C, Müller S, Schöttler M,
Tarnow L, Kuhn J, Kleesiek K, Götting C:
Impact of polymorphisms in the genes encoding xylosyltransferase I and a homologue in type 1 diabetic patients with and
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
without nephropathy. Kidney Int 68:
1483–1490, 2005
Lajer M, Tarnow L, Fleckner J, Hansen
BV, Edwards DG, Parving HH, Boel E: Association of aldose reductase gene Z⫹2
polymorphism with reduced susceptibility to diabetic nephropathy in Caucasian
type 1 diabetic patients. Diabet Med 21:
867– 873, 2004
Parving HH, Andersen AR, Smidt UM,
Svedsen PA: Early aggressive antihypertensive treatment reduces rate of decline
in kidney function in diabetic nephropathy. Lancet 28:1175–1179, 1983
Mogensen CE, Chachati A, Christensen
CK, Close CF, Deckert T, Hommel E, Kastrup J, Lefevre P, Mathiesen ER, FeldtRasmussen B, Schmitz A, Viberti GC:
Microalbuminuria: an early marker of renal involvement in diabetes. Uremia Invest
9:85–95, 1985
Tarnow L, Cambien F, Rossing P, Nielsen
FS, Hansen BV, Lecerf L, Poirier O, Danilov S, Parving HH: Lack of relationship
between an insertion/deletion polymorphism in the angiotensin I-converting enzyme gene and diabetic nephropathy and
proliferative retinopathy in IDDM patients. Diabetes 44:489 – 494, 1995
Skol AD, Scott LJ, Abecasis GR, Boehnke
M: Joint analysis is more efficient than
replication-based analysis for two-stage
genome-wide association studies. Nat
Genet 38:209 –213, 2006
Dupont WD, Plummer WD: Power and
sample size calculations. Control Clin Trials 11:116 –128, 1990
Götting C, Kuhn J, Brinkmann T, Kleesiek
K: Xylosylation of alternatively spliced isoforms of Alzheimer APP by xylosyltransferase. J Protein Chem 17:295–302, 1998
Schön S, Prante C, Bahr C, Kuhn J,
Kleesiek K, Götting C: Cloning and recombinant expression of active fulllength xylosytransferase I (XT-I) and
characterization of subcellular localization of XT-I and XT-II. J Biol Chem 281:
14224 –14231, 2006
Jacobsen P, Tarnow L, Carstensen B, Hovind P, Poirier O, Parving HH: Genetic variation in the rennin-angiotensin system and
progression of diabetic nephropathy. J Am
Soc Nephrol 14:2843–2850, 2003
Marre M: Genetics and the prediction of
complications in type 1 diabetes. Diabetes
Care 22:B53–B58, 1999
Astrup AS, Tarnow L, Rossing P, Pietraszek L, Riis Hansen P, Parving HH:
Improved prognosis in type 1 diabetic patients with nephropathy: a prospective
follow-up study. Kidney Int 68:1250 –
1257, 2005
Hovind P, Tarnow L, Rossing P, Carstensen
B, Parving HH: Improved survival in patients obtaining remission of nephrotic
range albuminuria in diabetic nephropathy.
Kidney Int 66:1180 –1186, 2004
2299