Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Common sun star (Crossaster papposus) N omb res comu n es: Estrella de mar (Español) Si n ón i mos: Asterias helianthemoides, Asterias affinis, Solaster affinis, Crossaster neptuni, Solaster papposus, Asterias papposus ¿Tienes alguna duda, sugerencia o corrección acerca de este taxón? Envíanosla y con gusto la atenderemos. Ver todas las fotos etiquetadas con Crossaster papposus en Banco de Imagénes » Descripción de EOL Ver en EOL (inglés) → Morphology 1,2 Crossaster papposus ranges from 8" to 14" in diameter. It has many arms (between 8 and 14) the length of one-half its radius. It is scarlet on top with concentric bands of white, pink, yellow, or dark red, and it is white on the underside. Its entire upper surface is sparsely covered with brushlike bristles. (McConnaughey and McConnaughey, 1985) These bristles, called pseudopaxillae, consist of bundles of fine spines atop short stumps. The mouth area is bare, and it has two rows of sucker-tipped sensory tube feet. (Gosner, 1978) Oth er Ph ysi cal Featu res: ectothermic Taxon biology 3 The common sunstar is named after the fact that it looks like a sun with its 8 to 14 arms. Its colorful, sunny appearance makes you think it has a nice character, but nothing is farther from the truth. It is a fearsome predator, which scares the daylights out of common starfish and other smaller marine animals. The common sunstar is quite fast for a starfish, reaching top speeds of 70 centimeters per minute. There are films where you see how brittle stars and sea urchins run away as soon as a sunstar is in the vicinity. If they are not fast enough, they are inevitably consumed. Description 4,5 A very distinctive sun star that grows up to 34 cm in diameter. The colour varies but is usually red, brown-red with white markings above, yellow-white below, often with beautiful patterns. It has 10-12 arms (rarely 8-16) and the whole surface of the animal is covered with small but distinct spines. Biology 6 Bi ol ogy/N atu ral Hi story: Diet includes sea pens, nudibranchs such as Archidoris odhneri and Coryphella sp, the scallops Chlamys hastata and C. rubida, bryozoans, and tunicates. Has been known to attack the seastar Evasterias troschelii and Leptasterias sp. Predators include the seastars Solaster dawsoni and Pycnopodia helianthoides. May have the symbiotic polychaete worm Arctonoe vittata. This species can move relatively fast for a seastar--up to 70 cm/minute. Spawns March to April. Juveniles often cluster subtidally in masses of the tubedwelling polychaete Phyllochaetopterus prolifica. Grow slowly--maximum size is achieved after about 10 years. Description 7 A starfish with many arms, usually 13 but occasionally from 8-14. Colour is variable from dirty brown through dirty purple to a beautiful red form with concentric rings of white. The texture is very spiny with large groups of bristly spines over the dorsal surface. Typically 25cm up to 35cm diameter. The only other sunstar to be found in shallow water is Solaster endeca. Distribution 8,9 From low intertidal to more than 200 m depth, mainly on coarse sand and gravel, all round the British Isles Look alikes 6 How to Di sti n gu i sh from Si mi l ar Sp eci es: Solaster stimpsoni and S. dawsoni have much smaller central disks in relation to their total diameter and do not have the abundant aboral spines nor this coloration. Pycnopodia helianthoides has more rays (when mature), grows larger, and has abundant pedicellariae, plus its rays are very flabby. Habitat Depth range based on 1230 specimens in 1 taxon. Water temperature and chemistry ranges based on 552 samples. Environmental ranges Depth range (m): 0 - 45627 Temperature range (°C): -1.770 - 11.851 Nitrate (umol/L): 0.504 - 44.769 Salinity (PPS): 27.165 - 35.352 Oxygen (ml/l): 0.545 - 8.971 Phosphate (umol/l): 0.091 - 3.312 Silicate (umol/l): 1.791 - 175.486 Graphical representation Depth range (m): 0 - 45627 Temperature range (°C): -1.770 - 11.851 Nitrate (umol/L): 0.504 - 44.769 Salinity (PPS): 27.165 - 35.352 Oxygen (ml/l): 0.545 - 8.971 Phosphate (umol/l): 0.091 - 3.312 Silicate (umol/l): 1.791 - 175.486 Note: this information has not been validated. Check this *note*. Your feedback is most welcome. Trophic strategy 1,2 In its habitat, C. papposus is considered to be the dominant predator, along with Solaster endece, another species of predacious sea star. As a dominant predator, C. papposus plays an important role in determining community structure. (Himmelman and Dutil, 1991) Its abundance and frequent predatory activity suggests that it belongs to an important predatory guild. C. papposus has often been observed feeding on urchins, as well as on numerous other invertebrates, including echinoderms, bivalves, cnidarians, and tunicates. (Coleman, 1991) Cannibalism in C. papposus is rare, observed only after long starvation in captivity. (Sloan, 1984) Breeding 8,9 Direct development? Winter Reproduction 1,2 Crossaster papposus, like most sea stars, has separate sexes, and fertilization is external. (Hickman and Roberts, 1995) Sexual reproduction produces lecithotropic larva in late winter. One-year-old individuals measure 1.8 to 4.0 cm in diameter, and there is a 2 cm annual growth increment during the following few years. (Himmelman and Dutil, 1991) Juvenile C. papposus tend to prefer sediment bottoms of the sea. Upon growing to 5cm in diameter, C. papposus migrates to shallow water (4-8cm in diameter) and then, with increasing size, it gradually moves to greater depths. (Himmelman and Dutil, 1991) Like other sea stars, C. papposus can regenerate injured or missing arms, as long as a portion of the central disc, where the arms converge, is intact. (Hickman and Roberts, 1995) Barcode data: crossaster papposus 10 The following is a representative barcode sequence, the centroid of all available sequences for this species. There are 20 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences. AGACGATGACTATTTTCTACTAAACACAAGGATATTGGGACTCTATATTTAATATTTGGTGCATGAGCCGGAATGACCGGAAC -GACCAAATATATAAAGTANTTGTAACCGCGCATGCTCTAGTAATGATATTTTTTATGGTGATGCCCATAATGATAGGAGGATT -- end -Download FASTA File Uses 1,2 Unfortunately, information regarding the economic importance of C. papposus and its value to humans is either not well-studied, not well-documented, or simply inaccessible. As an aggressive predator high on its food web and as an agent of dispersal of both its competitors and prey, C. papposus clearly has a significant impact on its ecosystem. References 1. Grush, H. 1999. "Crossaster papposus" (On-line), Animal Diversity Web. Accessed April 27, 2013 at http://animaldiversity.ummz.umich.edu/site/accounts/information/Crossaster_papposus.html 2. © The Regents of the University of Michigan and its licensors, some rights reserved 3. © Copyright Ecomare, some rights reserved 4. Emily Wilson 2008. Crossaster papposus. Common sun star. Marine Life Information Network: Biology and Sensitivity Key Information Sub-programme [on-line]. Plymouth: Marine Biological Association of the United Kingdom. [cited 26/01/2011]. Available from: 5. © The Marine Biological Association of the United Kingdom, some rights reserved 6. © Rosario Beach Marine Laboratory, some rights reserved 7. © National Museums Northern Ireland and its licensors, some rights reserved 8. Southward, E.C.; Campbell, A.C. (2006). [Echinoderms: keys and notes for the identification of British species]. <i>Synopses of the British fauna (new series)</i>, 56. Field Studies Council: Shrewsbury, UK. ISBN 1-85153-269-2. 272 pp. Southward, E.C.; Campbell, A.C. (2006). [Echinoderms: keys and notes for the identification of British species]. <i>Synopses of the British fauna (new series)</i>, 56. Field Studies Council: Shrewsbury, UK. ISBN 1-85153-269-2. 272 pp. North-West Atlantic Ocean species (NWARMS) North-West Atlantic Ocean species (NWARMS) Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication. 9. © WoRMS for SMEBD, some rights reserved 10. © Barcode of Life Data Systems, some rights reserved