Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Establishment of a Cell-Based Assay Specific for a Growth Factor that Shares a Common Receptor Chain and Overlapping Biological Activities with Other Cytokines and Growth Factors Michael G Tovey, INSERM Director of Research, Laboratory of Biotechnology & Applied Pharmacology, ENS CACHAN [email protected] Granulocyte-Macrophage ColonyStimulating Factor (GM-CSF) ¾ GM-CSF is a hematopoietic growth factor that plays a central role in in the generation of neutrophils, macrophages, and DCs ¾ GM-CSF acts together with IL-3 and IL-5 to regulate the survival proliferation, differentiation, and functional activation of hematopoietic cells ¾ GM-CSF also regulates its own activity by via the induction of CIS, a SOCS family member SH2-domain protein that inhibits Jak2/STAT5 phosphorylation & signaling. ¾ CIS and SOCS3 also regulate EPO induced Jak2/STAT5 signaling Quantification of GM-CSF Activity ¾ Current methods for quantifying human GM-CSF activity, are bioassays based on the ability of GM-CSF to support the proliferation of cell lines such as TF-1, or UT-7, that require GM-CSF for their growth ¾ Due to overlapping biological activities, IL-3 or EPO, can also support the proliferation of these cells and act synergistically together with GM-CSF. ¾ M-CSF & IL-1 can also enhance GM-CSF dependent cell proliferation ¾ TGF-β and IFNα, or IFN β, can antagonize this activity ¾ IL-3 & IL-5 share a common receptor βc chain with GM-CSF ¾ Thus, proliferation based assays for GM-CSF are subject to non specific interference. Development of a Cell-based Assay Specific for GM-CSF: Strategy ¾ Use a cell line that possesses functional GM-CSF receptors, but does not require GM-CSF or other related growth factors for proliferation ¾ U937 cells possess functional GM-CSF receptors but not express functional EPO receptors ¾ U937 cells do not require GM-CSF, EPO or other related growth factors for proliferation ¾ Transfect U937 cells with a GM-CSF responsive reportergene construct Reporter-Gene Assay: Construction SV40 CM-CSF-Specific Regulatory Element Min. prom. Luciferase SV40 Poly A Intron Human β-globine However, GM-CSF, IL-3, & IL-5 share a common receptor βc chain GM-CSF Receptor ¾ GM-CSF binds to a heterodimeric receptor comprised of a GM-CSF specific α subunit and a common receptor βc chain that is shared with IL-3 & IL-5 ¾ GM-CSF receptor does not possess intrinsic tyrosine kinase activity; associates with Jak2 required for βc transphosphorylation, initiation of signaling, & biological activity ¾ Receptors for GM-CSF, IL-3, & IL-5 are expressed at very low levels (100-1,000 receptors/cell) ¾ GM-CSF, IL-3, & IL-5 each bind with low affinity to their specific Rα chain (Kd = 0.2 – 100 nM) ¾ In the presence of the βc receptor chain each cytokine binds with high affinity (Kd = 100 pM) resulting in dimerization of both sub-units and receptor activation Development of a Cell-based Assay Specific for GM-CSF: Strategy ¾ Overexpress the GMRα, GM-CSF ligand-specific binding subunit, of the human GM-CSF receptor ¾ Hypothesis, GMRα receptor chain will compete with IL-3 or IL5 specific binding sub-units for the pool of the βc signaling receptor sub-unit common to the GM-CSF, IL-3, and IL-5 heterodimeric receptors. GM-CSF Receptor Structure and Signal Transduction STAT5 STAT5 P STAT5 P STAT5 IL5 IL3 IL5Rα IL3Rα GMRα IL5 IL3 IL5R α IL3R α GM-CSF Gene Reporter Assay (FireFly Luciferase) GM-CSF Stat5 Stat5 +1 (T/A)TTCnnnGAA(T/A) FireFly Luciferase SV40 Poly A TATA Intron STAT5 Consensus Sequence: (T/A)TTCnnnGAA(T/A) STAT5 con. Ax4 TTCCCCGAAATGATGAGCTAGGAGCCTGATTTCCCCGAAATGATGAGCTAGGAGCCTGATTTCCCCGAAATGATGCTAGGAGCCTGATTTCC CCGAAATGATctGtTAG STAT5 con. Bx6 GAGGCTCTGATTTCCGGGAAACTGATTCCCGGAATACGTTTTCCGGGAATACGTTTCCGGGAAACGTATTCCGGGAAAACTGATT CCGGGAAATGATCTGTTAG STAT5 con. Cx6 GATTTCTAGGAATTCttctcagaaGAATTCttctgagaaGAATTCttctcagaaGAATTCttctgagaaGAATTCttctcagaaGGAATTCAAATCG STAT5 con. Dx4 GATTTCTAGGAATTCAAATCGGATCTAGATTTCTAGGAATTCAAATCGGATCTAGATTTCTAGGAATTCAAATCGGATCT AGATTTCTAGGAATTCAAATCG STAT 5 Reporter Gene Constructs – Firefly luciferase A, B, C or D Transcient transfection in U937 cells 12 Fold induction luciferase 10 8 6 Ctl 500ng/ml rhGM-CSF 4 2 0 A B STAT5-luc C D STAT5-luc STAT5 Reporter Gene – Firefly luciferase (C or D) relative to Renilla luciferase expression Transcient transfection in K562 and U937 cells 1800 Ratio (Firefly / Renilla luciferase) 1600 1400 1200 1000 Ctl 800 500ng/ml rhGM-CSF 600 400 200 0 STAT5 - luc C D K562 STAT5 is expressed constitutively in K562 cells C D U937 Effect of rhEPO and rhIFNγ on STAT5 – luciferase (C or D) Reporter Gene Transcient transfection in U937 cells 12 10 Fold induction 8 Ctl 500ng/ml rhGM-CSF 6 500ng/ml rhEPO 10000 IU/ml IFNg 4 2 0 STAT5 C STAT5 D Analysis of Clones Transfected with the US5‐Luc Construct 16,0 14,0 FireFly Fo ld Induc o n 12,0 10,0 8,0 6,0 4,0 2,0 0,0 1 2 3 4 5 6 7 8 9 10 11 12 13 Clone N° 14 15 16 17 18 19 20 21 22 23 24 Selection of stable clones transfected by STAT5-luc C in U937 cell line 13 11 Fold induction 9 Clone 2 7 Clone 3 Clone 6 5 3 1 0.01 0.1 1 Log rh GM-CSF (ng/ml) 10 Firefly Luciferase induction in U937/STAT5-luc stable cell line 50 45 Firefly Luciferase Fold Induction 40 35 30 rh GM-CSF 4h 25 rh GM-CSF 18h rh EPO 4h 20 rh EPO 18h 15 10 5 0 0.0005 0.005 0.05 0.5 5 ng/ml 50 500 5000 Cell number optimisation for the GM-CSF assay Stimulation with 200ng/ml rhGM-CSF (Gibco®) 4.E+06 4.E+06 Firefly luciferase RLU 3.E+06 3.E+06 2.E+06 2.E+06 1.E+06 5.E+05 0.E+00 0.0E+00 5.0E+04 1.0E+05 1.5E+05 2.0E+05 cell number 2.5E+05 3.0E+05 3.5E+05 4.0E+05 GM-CSF Standard Curves 14 12 Fold Induction 10 Standard NIBSC 8 6 4 2 0 0.000001 0.00001 0.0001 0.001 0.01 0.1 GM-CSF ng/ml 1 10 100 1000 GM-CSF Gene Reporter Assay (FireFly / Renilla) GM-CSF Stat5 Stat5 +1 (T/A)TTCnnnGAA(T/A) FireFly Luciferase SV40 Poly A TATA Intron +1 CMV +1 GM-CSF-Rα Renilla Luciferase SV40 Poly A IRES Intron Double transcient transfection STAT5-luc (C or D) and pCMV-GM-CSF-Rα in U937 cells 20 18 16 Fold induction 14 12 Ctl 10 500ng/ml rhGM-CSF 8 6 4 2 0 Control GM-CSF-Rα STAT5 C Control GM-CSF-Rα STAT5 D Firefly Luciferase induction in the U937 cell line transciently tranfected with STAT5-luc and GMCSF-Rα treated with GM-CSF, IL-3 or IL-5 STAT5-luc STAT5-luc + GM-CSF-Ralpha 22 20 Firefly Luciferase fold induction 18 16 14 12 10 8 6 4 2 0 Ctl 100 500 rh GM-CSF Gibco® (ng/ml) 1000 100 500 rh IL-3 Immunotools® (ng/ml) 1000 100 500 1000 rh IL-5 Immunotools® (ng/ml) Analysis of US5-Luc Clones Expressing Renilla Luciferase and the GM-CSFRα Receptor Chain 4500 4000 3500 RLU Renilla 3000 2500 2000 1500 1000 500 0 1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 Clone N° 33 35 37 39 41 43 45 47 49 51 53 55 Analysis of RUS5-Luc clones Expressing Renilla Luciferase and GM-CSFα Receptor Chain 18 16 FireFly Fold Induction 14 12 10 8 6 4 2 0 1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 Clone N° 33 35 37 39 41 43 45 47 49 51 53 55 US5 Dose Response Curve (16h Incubation) 30 25 Fold 20 GM-CSF 15 IL-3 IL-5 10 5 0 0.001 0.01 0.1 1 ng/ml 10 100 US5 GM-CSF (4h incubation) 4.5 US5 GM-CSF (16h incubation) 12 4 10 3.5 Fold Induction Fold 3 2.5 2 1.5 8 6 4 1 2 0.5 0 0.00001 0.001 0.1 GMCSF ng/ml 10 0 0.00001 0.001 0.1 GMCSF ng/ml 10 GM-CSF Gene Reporter Assay (FireFly / Renilla) GM-CSF Stat5 Stat5 +1 (T/A)TTCnnnGAA(T/A) FireFly Luciferase SV40 Poly A TATA Intron +1 CMV +1 GM-CSF-Rα Renilla Luciferase SV40 Poly A IRES Intron Transient Cotransfection of U937 Cells 60 STAT5Luc+RGM-CSF/hRL 50 Fold Induction STAT5-Luc+EGFP 40 FireFly Activity 30 20 10 0 Control GM-CSF 100ng/ml 60 STAT5Luc+RGM-CSF/hRL Renilla Activity Fold Induction 50 STAT5-Luc+EGFP 40 30 20 10 0 Control GM-CSF 100ng/ml Normalized Reporter Gene Assay for GM-CSF ¾ Unexpectedly, constitutive expression of Renilla luciferase is influenced (2x) by STAT5 activation in response to GM-CSF treatment ¾ Consequence effective dynamic range of assay reduced ¾ Mechanism unclear, no Stat5 recognition sequences in promoter construct ¾ Solution change promoter use SV40 constitutive promoter & Herpes simplex TK promoter ¾ Use humanized Gaussia luciferase gene instead of Renilla luciferase GM-CSF Induced FL Expression Normalized Relative to Gaussia Expression (4 H Induction) 30 US5 17.5.21 SV US5 17.5.8 TK Normalized Fold Induction 25 20 15 10 5 0 0.000001 0.00001 0.0001 0.001 0.01 GM-CSF ng/ml 0.1 1 10 100 GM-CSF Induced FL Expression Normalized Relative to Gaussia Expression (16 H Induction) 50 US5 17.5.21 SV 45 US5 17.5.8 TK Normalized Fold Induction 40 35 30 25 20 15 10 5 0 0.000001 0.00001 0.0001 0.001 0.01 GM-CSF ng/ml 0.1 1 10 100 300000 0.6 250000 0.5 200000 0.4 RLU (FL/RL) RLU (FL) Relationship Between Drug Induced FL Expression and Cell Number 150000 0.2 50000 0.1 0.001 0.1 Drug (ng/ml) 10 40.000 20.000 100000 0 0.00001 80.000 cells 0.3 0 0.00001 10.000 0.001 0.1 Drug (ng/ml) 10 Response of Reporter Cells to Serum Matrix Effects 80 45 RA Sera 10% RA Sera 10% Fold Induction 60 50 RA sera 20% 35 Normal Sera 10% 30 Control Fold Induction 70 40 40 30 RA sera 20% Normal Sera 10% Control 25 20 15 20 10 10 0 0.0001 5 0.01 1 Drug (ng/ml) 100 0 0.0001 0.01 1 Drug (ng/ml) 100 Stability Studies: Sensitivity Time (Hrs) Passage # EC50 (pg/ml) LLOQ (pg/ml) 4 10 40 10 4 20 80 20 4 40 20 5 18 10 400 200 18 20 400 200 18 40 200 100 Stability Studies: Proliferation Passage # Doubling Time (Hrs) Max Cell Density (x106/ml) 4 27 1.0 10 25 0.95 20 24 1.2 40 24 1.1 Conclusions - I ¾ A cell-based assay specific for a growth factor can be established by the use of a cell-line that does not require the growth factor or other related grow factors for proliferation ¾ The cell does, however, contain a functional receptor/signal transduction system for the growth factor of interest ¾ The assay can be rendered specific by over-expression of a growth factor specific binding receptor sub-unit Conclusions - II ¾ When a growth factor signals through multiple pathways (MAPK, NFkB, STAT1-5 etc) it may be more useful to reconstitute a complete receptor-signaling transduction system in a cell that does not respond to the cytokine of interest. Reconstitution of a Functional Cytokine Signaling Pathway in Human U937 cells 16 14 Fold Induction 12 10 8 6 4 2 0 Stat4‐kozak ‐ + ‐ ‐ + ‐ + CX2RB1 ‐ ‐ + ‐ ‐ + + CX2RB2 ‐ ‐ ‐ + + + + STAT4‐Luc + + + + + + + Reconstitution of a Functional Cytokine Signaling Pathway in Human HEK cells 16 14 Fold Induction 12 10 8 6 4 2 0 Stat4‐kozak ‐ + ‐ ‐ + ‐ + CX2RB1 ‐ ‐ + ‐ ‐ + + CX2RB2 ‐ ‐ ‐ + + + + STAT4‐luc + + + + + + + Conclusions - III ¾ Reconstitution of a cellular receptor-signal transduction system in a cell that does not respond to the cytokine or growth factor of interest is a powerful tool for the establishment of Specific cell-based assays for the quantification of the activity and neutralizing antibody response to therapeutic proteins www.coralgablessymposia.org Gables Symposium 2012 provides a unique forum for thought leaders to address the principal concerns regarding the immunogenicity of biopharmaceuticals; in their development, regulation, and clinical use. www.coralgablessymposia.org Scientific Organizing Committee Dr. Michael Tovey, Chair Dr. Shalini Gupta, Amgen Dr. Susan Kirshner, FDA Dr. Daniel Kramer, Merck Serono Dr. Robin Thorpe, NIBSC