Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Slides for Final
Document related concepts
no text concepts found
Transcript
Question: How do we know where a particular protein is located in the cell? Principle of Fluorescence Cell with fluorescent molecule Experimental Approaches for Protein Localization 1. Small Molecule Dyes (e.g. DAPI) 2. Immunostaining (dye-conjugated antibodies) 3. Green Fluorescent Protein (GFP) “Tagging” Aequorea victoria Green Fluorescent Protein (GFP) GFP Excitation Wavelength (e.g. 490 nm) Emission Wavelength (e.g. 510 nm) Gene Expression DNA (Gene X) Transcription mRNA Translation Protein X GFP Tagging Approach DNA (Gene X -GFP “Fusion”) Transcription mRNA Translation Protein X-GFP “Fusion” GFP Tagging Experiments Nuclei Histone-GFP Mitotic Spindle Tubulin-GFP Question: Where is the Cdc10 protein located in a yeast cell? Septin Protein Family * GFP Tagging Approach DNA (CDC10 -GFP “Fusion”) Transcription mRNA Translation Cdc10-GFP “Fusion” Project Overview Isolation of CDC10 gene Open Reading Frame Purification of Genomic DNA from yeast Polymerase Chain Reaction (PCR) Construction of CDC10-GFP “fusion” gene Restriction endonuclease/Ligase Cloning DNA in E. coli Introduction of CDC10-GFP “fusion” gene into yeast cells Observe Cdc10 protein localization in living cells with fluorescence microscopy GFP Tagging of Cdc10 DNA (CDC10 -GFP “Fusion”) Transcription mRNA Translation Cdc10-GFP “Fusion” Saccharomyces cerevisiae (Yeast) Eukaryotic cell 15 million bp DNA ~ 6000 genes Complete genome sequence known! Lab #1 & 2 Purify genomic DNA 15 million bp ~ 6000 genes PCR Pg. 350 Copies of CDC10 Gene Open Reading Frame Taq DNA Polymerase Primer Pg. 202 DNA Synthesis CDC10 Gene Primers CDC10-Forward 5’ – GTGGTGAAGCTTATGTCCATCGAAGAACCTAG – 3’ CDC10-Reverse 5’ – GTGGTGAAGCTTTCTAGCAGCAGCAGTACCTGT – 3’ CDC10 Gene Sequence (non-template strand sequence) First Cycle of PCR 5’ 3’ Rev 5’ 3’ CDC10 3’ 5’ (52o C.) (94o C.) (72o C.) For 3’ Pg. 349 5’ Three Cycles of PCR Pg. 349 Three Cycles of PCR Pg. 349 Lab #1 & 2 Purify genomic DNA 15 million bp ~ 6000 genes PCR Pg. 350 Copies of CDC10 Gene Open Reading Frame Agarose Gelidium comeum (kelp) Ethidium Bromide Lab #1 Purify genomic DNA 15 million bp ~ 6500 genes PCR Pg. 350 Copies of CDC10 Gene Open Reading Frame + + Restriction Endonuclease Reaction 5’ 3’ 3’ 5’ HindIII (37o C.) 5’ 3’ 3’ 3’ 5’ 5’ 3’ 5’ Ligation Reaction 5’ 3’ 3’ 5’ “Compatible” ends 5’ 3’ 3’ 5’ 1. Annealing 2. Phosphodiester bond formation DNA Ligase + ATP (15o C.) 5’ 3’ 3’ 5’ HindIII recognition site is reconstituted Construction of a Recombinant DNA Plasmid (insert) Pg. 344 CDC10 Gene Primers CDC10-For 5’ – GTGGTGAAGCTTATGTCCATCGAAGAACCTAG – 3’ CDC10-Rev 5’ – GTGGTGAAGCTTTCTAGCAGCAGCAGTACCTGT – 3’ CDC10 ORF DNA from PCR 5’ GTGGTGAAGCTTATGTCCATCGAAGAA 3’ CACCACTTCGAATACAGGTAGCTTCTT ACTGCTGCTGCTAGAAAGCTTCACCAC 3’ TGACGACGACGATCTTTCGAAGTGGTG 5’ HindIII 5’ AGCTTATGTCCATCGAAGAA ATACAGGTAGCTTCTT 3’ ACTGCTGCTGCTAGAA TGACGACGACGATCTTTCGA 3’ 5’ Ori AmpR pGFP Plasmid HindIII Ori AmpR pGFP Plasmid HindIII CDC10 orf 5’ AGCTTATGTCCATCGAAGAA ATACAGGTAGCTTCTT 3’ ACTGCTGCTGCTAGAA TGACGACGACGATCTTTCGA 3’ 5’ pCDC10-GFP Plasmid ACT1p HindIII CDC10 orf HindIII GFP orf HindIII Site 5’ ACT GCT GCT GCT AGA AAG CTT ATG TCT AAA GGT - Thr - Ala - Ala - Ala - Arg - Lys - Leu - Met - Ser - Lys - Gly Cdc10 GFP 3’ DNA Cloning Bacterial Transformation (Lab #5) Plasmid Purification (Lab #5) pCDC10-GFP (AmpR) (Ampicillin sensitive) Pg. 344 (LB growth medium with ampicillin) DNA Cloning Plasmid Purification (Lab #6) (AmpR) (LB growth medium with ampicillin) Pg. 344 Ori AmpR pGFP Plasmid HindIII CDC10 orf 5’ AGCTTATGTCCATCGAAGAA ATACAGGTAGCTTCTT 3’ ACTGCTGCTGCTAGAA TGACGACGACGATCTTTCGA 3’ 5’ Transformation of E. Coli plasmid Ori AmpR pGFP Plasmid HindIII DNA Cloning pCDC10-GFP (LB-amp) (AmpR) (Ampicillin sensitive) (LB-amp Plate) Pg. 344 Transformation of E. Coli plasmid Log Phase Growth Cold (4oC) CaCl2 E. Coli Cell Wall Cell Membrane Cytoplasm (chromosome, plasmids) Ori AmpR pCDCGFP Plasmid CDC10GFP HindIII HindIII 1000 bp Morning section 1000 bp Afternoon section Transformation of Yeast Linear plasmid Ori AmpR Selectable Marker pCDC10GFP Plasmid “Targeting” sequence CDC10GFP Chromosome Integration “Targeting” Locus (RPS10) Yeast Chromosome Ori AmpR pCDC10GFP Plasmid CDC10GFP StuI Linear pCDC10GFP Plasmid URA3 RPS10 ACT1p-CDC10GFP RPS10 Chromosome Integration URA3 ACT1p-CDC10GFP RPS10 Yeast Chromosome Linear pCDCGFP Plasmid Chromosome Integration URA3 ACT1p-CDC10GFP Yeast Chromosome with CDC10-GFP and URA3 Genes! URA3 Gene Encodes Orotidine Decarboxylase Orotidine Decarboxylase Orotidine Monophosphate Uridine Monophosphate (RNA synthesis) Yeast ura3 Mutant Orotidine Decarboxylase Orotidine Monophosphate ura3 mutant can NOT make Uridine Monophosphate Question: Where is the Cdc10 protein located in a yeast cell? Lab #9 Yeast Transformation Plate Cells with the CDC10GFP “fusion” Gene URA3 Transformants Expression of CDC10GFP “Fusion” Gene Integrated in Yeast Chromosome ACT1p CDC10GFP Transcription/RNA Processing (nucleus) mRNA (CDC10-GFP orf) G AAAAAA Translation (cytosol) Cdc10-GFP Protein Observe Localization of Cdc10-GFP in Yeast Cells Pg. 10 Light Microscope (10X) (10-100X) GFP Excitation Wavelength (e.g. 490 nm) Emission Wavelength (e.g. 510 nm) 490 nm 510 nm Nikon TE200 Inverted Microscope Septin Proteins of Yeast * Lipid Bilayer Binding Domain http://en.wikipedia.org/wiki/Septins TEM Yeast Cells Yeast Mitotic Cell Cycle G2 ~ 3 Hours Cdc10 Protein in the Yeast Mitotic Cell Cycle G2 Cdc10 marks site of bud formation Cdc10 ring at the mother/bud neck Cdc10 ring splits into two Cdc10 De-polymerizes
Related documents