Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
UNIT 2 STUDY GUIDE – Genetics Basics Date: _____________________ Block: ______________ GENETIC MATERIAL 1. SIMILARITIES & DIFFERENCES BETWEEN DNA & RNA Complete the table below by using check marks to indicate to which molecule each characteristic applies DNA Deoxyribonucleic acid Ribonucleic acid Ribose sugar present Deoxyribose sugar present Phosphate group present Adenine nucleotide present Thymine nucleotide present Uracil nucleotide present Guanine nucleotide present Cytosine nucleotide present Formed from nucleotides Double stranded Single stranded Remains in the nucleus Moves out of the nucleus Contains a chemical message code types Containsormultiple RNA 2. Name the three (3) main types of RNA and describe their function: Type of RNA Function 3. Using the information above; complete the VenDiagram below comparing and contrasting DNA & RNA. On your test you will be asked to either complete a VenDiagram or write an essay comparing and contrasting them. 4. What are the three parts of a nucleotide? a. ________________________________ (color brown below) b. ________________________________ (color purple below) c. ________________________________ (color green below) According to the above list… color-code each of the three parts on the nucleotide picture below (see above for colors). 5. Label and color code (you pick the colors) each specific nucleotide below: DNA REPLICATION 1. What is the PURPOSE of DNA Replication? ________________________________________________________________________ ________________________________________________________________________ __________________________________ 2. When does DNA Replication occur? ________________________________________________________________________ _________________ 3. Fill in the table below with the enzymes we discussed that are involved in DNA Replication (in order) and their functions: Step Enzyme Function(s) # 1 2 1. Using the table below; describe the two steps of Protein synthesis… answering the questions as you go… Step # Description of Process Location of Process 1. _________________________ 2. _________________________ 1. If you were given the following DNA strands; complete the protein synthesis of each… a. Strand #1 DNA strand: ATGGAGTGCAGTCGAGGGCTGGGCTAG _________:_____________________________________ _________: _____________________________________ b. Strand #2 DNA strand: ATGCCCGGTTTAGCTATGGTAAA _________: _____________________________________ _________: _____________________________________ 2. When comparing different organisms, you can see that they all have the same bases in DNA (A, T, G, and C)… what accounts for the differences between the organisms? ________________________________________________________________________ ________________________________________________________________________ __________________________________ MUTATIONS 1. What is a Mutation? ________________________________________________________________________ ________________________________________________________________________ __________________________________ 2. Describe the four main types of mutations using the table below: Type of Mutation Cause(s) Example Insertion Deletion Trisomy Spontaneous 3. Describe the statement that “all mutations are not bad.” Describe in the space provided how a mutation may be a helpful thing in an organism ________________________________________________________________________ ________________________________________________________________________ _______________________________________________________________________ Be able to complete and interpret a punnett square for the following types of traits Simple Mendelian Inheritance Cross a heterozygous plant with a homozygous wrinkled plant. R = Round r = wrinkled Parents: ___________ x ___________ Percentages of: Homozygous round plant: _________ Heterozygous round plant: _________ Homozygous wrinkled plant: _________ If 430 offspring results… how many would be wrinkled? ________ Dihybrid cross Make the key… Tall is dominant to short and blue is recessive to purple… Cross a short, blue with a heterozygous tall, homozygous purple wrinkled plant. Parents: ___________ x ___________ Percentages of: Short, blue plant: _________ Short, purple plant: _________ Tall, blue plant: _________ Tall, purple plant: _________ If 1247 offspring results… how many would be tall and blue? ________ Incomplete dominance R = Red W = White Cross a pink flower with a white flower. Parents: ___________ x ___________ Percentage of: White flowers: __________ Red flowers: __________ Pink flowers: ________ If 625 offspring results… how many would be pink? ________ Multiple Alleles Allele Combinations: Type A = _____ & _____ Type B = _____ & _____ Type O = _____ Type AB = _____ Cross a parent who is heterozygous Type A with a parent who is homozygous Type B Parents: ___________ x ___________ Percentage of: Type A blood: __________ Type B blood: __________ Type AB blood: __________ Type O blood: __________ Sex-linked Inheritance Female Sex Chromosomes: _______ Male Sex Chromosomes: _______ G = Green Eyes g = Blue Eyes Cross a father with blue eyes with a mother who is heterozygous for Green eyes Parents: ___________ x ___________ Percentage of: Females with Green Eyes: _____________ Females with Blue Eyes: _____________ Males with Green Eyes: ____________ Males with Blue Eyes: ____________ General Questions 1.) 2.) 3.) 4.) 5.) 6.) 7.) 8.) 9.) 10.) 11.) 12.) 13.) 14.) 15.) What is the normal chromosome number for a human? What are the sex chromosomes for a male? What are the sex chromosomes for a female? The autosomes are the first ________ chromosomes. What chromosome #s represent the sex chromosomes? Who is the father of genetics? What does the principle of dominance state? What does the principle of independent assortment state? What does the principle of segregation state? Why are males more likely to have a sex-linked disorder? How are the many different skin colors produced? What blood types can receive from blood type B? What blood type(s) can give to all others? What blood types can type A receive from? Mom is type A and baby is type O. If the suspected father is type B, can he truly be the child’s father?