Download SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURE

SUPPLEMENTARY INFORMATION
SUPPLEMENTARY FIGURE LEGENDS
Figure S1. RITA is expressed in various tumor cell lines, it coats MTs and affects their
structure in vitro.
(A) HeLa cells were treated with control siRNA (sicon) or siRNA targeting RITA (siRITA 1)
and lysates were prepared for Western blot analysis with RITA antibody. β-actin served as
loading control. (B) HeLa cells were transfected with Flag- or GFP-tagged RITA and cellular
extracts were prepared for Western blot analysis with RITA antibody. β-actin served as
loading control. (C) Western blot analysis of RITA from tumor cell lines. Cells were nontreated (C), treated with a double thymidine block to the G1/S boundary (T) or with
nocodazole to prometaphase (N). Cyclin B1 and β-actin served as synchronization and
loading control, respectively. (D) HeLa cells were stained for DNA and endogenous RITA
(upper panel) or α-tubulin (lower panel). Scale: 5 µm. (E) In vitro depolymerization assay.
Stabilized MTs were incubated with 25 nM GST control protein, GST-RITA Δtub or GSTRITA and pictures were taken after 30 seconds. Examples are shown. Scale: 5 µm. Red arrow
indicates the box, which is 6-fold amplified and shown as the rightmost panel. (F)
Rhodamine-labeled MTs were incubated with wild type GST-RITA and then stained with
antibody against RITA. Representatives are depicted. Scale: 5 µm. Red arrows indicate the
boxes, which are 6-fold amplified and shown in the rightmost panels.
Figure S2. Depletion of RITA increases acetylated α-tubulin and prolongs mitosis.
(A) HeLa cells were treated with increased concentrations of control siRNA (sicon) or siRNA
against RITA (siRITA 1) and cellular lysates were prepared for Western blot analyses with
indicated antibodies. The ratio of acetylated α-tubulin and α-tubulin is shown. β-actin served
as loading control. (B) Evaluation of mitotic duration. HeLa cells stably marked with H2B1
tdTomato, treated with control siRNA (sicon), siRITA 1 or siRITA 2 were examined by timelapse imaging at 4 min image intervals. Time (min) for mitosis was evaluated (60 cells for
each condition). Non-treated HeLa cells were taken as control (con). The results are presented
as mean ± SD and statistically analyzed. ***p < 0.001. (C) The duration of mitotic subphases, namely prophase, prometaphase (prometa), metaphase (meta), anaphase (ana),
telophase (telo) and cytokinesis, captured by time-lapse imaging at 4 min image intervals, was
evaluated (60 cells for each condition). The results are presented as mean ± SD. ***p < 0.001.
(D) Western blot analysis for siRNA treatment control. β-actin served as loading control. (E)
Representatives for each condition are shown. White arrow: defective chromosome
congression/segregation. Scale: 10 µm.
Figure S3. Mitotic defects are observed in RITA depleted HCT116 cells or tubacin treated
HeLa cells.
(A) HCT116 cells were treated with control siRNA (sicon) or siRNA targeting RITA
(siRITA 1) and stained for centromere (ACA, anti-centromere antibody), pericentrin, αtubulin and DNA for confocal laser scanning microscopy. Representatives are shown. White
arrows designate misaligned chromosomes or defective segregation. Scale: 5 μm. (B) Control
Western blot analysis of HCT116 cells treated with siRNA. β-actin served as loading control.
(C and D) Quantification of misaligned chromosomes (C) and failed segregation (D) in
HCT116 cells depleted of RITA. The results are from three independent experiments (n = 3,
60 mitotic cells for each condition in each experiment) and presented as mean ± SEM. *p <
0.05, **p < 0.01, ***p < 0.001. (E) HeLa cells were treated with either vehicle DMSO or
HDAC6 inhibitor tubacin (50 or 100 nM) for 48 h and stained for α-tubulin, acetylated αtubulin and DNA. Metaphase cells with defective chromosome congression or anaphase cells
with abnormal chromosome segregation were evaluated by microscopy. The results (n = 2, 60
meta- or anaphase cells for each condition in each experiment) are presented as mean ± SEM.
2
(F) Control Western blot analysis for (E) with indicated antibodies. β-actin served as loading
control.
Figure S4. Wild type RITA but not RITA ∆tub rescues mitotic defects.
HeLa cells were depleted of endogenous RITA with siRNA against the 3’-untranslated region
(siRITA 2) and re-transfected with 0.5 µg of wild type GFP-RITA (RITA WT, aa 1-269) or
GFP-RITA Δtub (aa 1-257), lacking the last 12 amino acids. 24 h later cells were stained for
microscopy. (A) Representatives are shown. White arrows indicate misaligned chromosomes
or failed segregation. Scale: 5 μm. (B and C) Evaluation of defective chromosome
congression (B) and segregation (C). The results (n = 2, 60 mitotic cells for each condition in
each experiment) are presented as mean ± SEM. *p < 0.05, **p < 0.01. (D) Control Western
blot analysis of siRNA treated and rescued HeLa cells. β-actin served as loading control. (E
and F) The rescue experiment was also performed with Flag-tagged RITA and its mutant in
HeLa cells. Evaluation of defective chromosome congression (E) and segregation (F) are
depicted. The results (n = 2, 50 mitotic cells for each condition in each experiment) are
presented as mean ± SEM. *p < 0.05. Control Western blotting is shown as Figure 4J.
Figure S5. Information of knockout RITA-/- mice.
(A) Knockout illustration. RITA wild type allele is shown above illustrating the 4 exons (E2,
E2b, E3 and E4) of RITA in black and the coding region in light blue. The targeted allele
below contains a -galactosidase gene (purple) and neomycin resistance gene (yellow). The
splice acceptor (SA, middle grey) links the transcript of E3 to the -galactosidase transcript
and prevents the splicing of E3 and E4 to synthesize functional RITA mRNA for translation.
Abbreviations: FRT, FLP recognition target; H, HindIII restriction site; IRES, Internal
ribosomal entry site; lac Z, lacZ (-galactosidase) gene; neo, neomycin resistance gene; pA,
3
polyadenylation signal sequence; PGK, mouse phosphoglycerate kinase 1 promotor; X, XbaI
restriction site. (B) Genotyping of RITA knockout mice. Primer binding sites are shown in
(A) for detection of the wild type allele (wt PCR) and the gene targeting allele (tm PCR),
respectively. (C) mRNA levels of RITA measured by quantitative real-time PCR. Total RNA
was isolated from wild type (RITA+/+), heterozygous (RITA+/-) and homozygous (RITA-/-)
MEFs. After reverse transcription of 1 µg of total RNA, real-time PCR reaction was
performed. Expression levels of RITA mRNA were normalized to endogenous -actin mRNA
levels (ΔΔ-CT method) and expression levels of mRNA derived from wild type (RITA+/+)
MEFs were set as one.
SUPPLEMENTARY MATERIALS AND METHODS
Reagents and siRNA sequence
Cycloheximide (CHX) and tubacin were obtained from Sigma-Aldrich (Taufkirchen) and
Selleckchem (Munich), respectively. siRNA against the coding region or the 3’-untranslated
region
of
RITA
are
GGAAGAAGAACAAAUACAG
(siRITA
1)
or
AGGGAACCCCAGGUAUUAAUU (siRITA 2), respectively. Control siRNA was from
Qiagen (Hilden).
Antibodies used for Western blot analysis, immunoprecipitation and indirect immunostaining
Following antibodies were used for Western blot analysis and immunoprecipitation: mouse
monoclonal antibodies against cyclin B1, GST, Plk1 and MCAK (Santa Cruz Biotechnology,
Heidelberg), mouse monoclonal antibodies against Flag-tag, β-actin, α-tubulin and acetylated
α-tubulin (6-11B1) (Sigma-Aldrich), rabbit polyclonal antibodies against GAPDH, α-tubulin,
Mec-17 and detyrosinated α-tubulin (Abcam, Cambridge), mouse monoclonal antibody
against polyglutamylated modifications (GT335, Adipogen, Hamburg), rabbit polyclonal
antibody against HDAC6 (Cell Signaling, New England Biolabs GmbH, Frankfurt) and
4
mouse monoclonal antibody against lamin B1 (MBL, Woburn). About 800 µg of lysates from
HeLa or HCT116 cells were used for immunoprecipitation. Corresponding primary antibody
and 25 µl Protein G SepharoseTM 4 Fast Flow beads (GE Healthcare, Uppsala) or M2 Flagbeads (Sigma Aldrich) were added and incubated overnight on a rotator at 4°C. The beads
were washed three times before SDS-PAGE. Cytosolic and nuclear extracts were prepared
from HeLa cells for Western blot analysis using Cell Fractionation Kit (Cell Signaling, New
England Biolabs GmbH). After testing all available antibodies, we have chosen our own
designed and commercially produced RITA antibody (rabbit monoclonal IgG, Epitomics,
Burlingame) due to its best specificity (Figures S1A and 1B).
Following primary antibodies were used for immunofluorescence staining: mouse
monoclonal or rabbit polyclonal antibody against pericentrin (Abcam), human ACA (human
anti-centromere antibody, ImmunoVision, Springdale), mouse monoclonal antibody against
acetylated α-tubulin (6-11B1) and mouse monoclonal FITC-conjugated antibody against αtubulin (Sigma-Aldrich), rabbit polyclonal antibody against α-tubulin (Abcam), rat antibody
against α-tubulin (Biozol, Eching) and rabbit polyclonal antibody against RITA (Atlas
Antibodies, Stockholm; homemade). FITC-, Cy3- and Cy5-conjugated secondary antibodies
were obtained from Jackson Immunoresearch (Newmarket). DNA was stained using DAPI
(4’,6-diamidino-2-phenylindole-dihydrochloride, Roche).
MT fraction, soluble and polymerized tubulin preparation and pull down assay
For preparing MT fraction, cells were washed with PBS, collected with a scraper in 1 ml PBS
and divided in two portions. After centrifugation (1,000 rpm, 3 min), one part of the cell pellet
was gently resuspended in 1 ml MT-stabilizing buffer (MSB; 85 mM Pipes, pH 6.93, 1 mM
EGTA, 1 mM MgCl2, 2 M glycerol) and the other part in 1 ml MSB containing 0.1% TritonX-100. After incubating at 37°C for 5 min and centrifugation (2,500 rpm, 3 min), an equal
5
volume of lysis buffer was added to both pellets containing either whole cellular protein (i.e.
extracted in MSB alone) or MT polymer (i.e. extracted in MSB with Triton-X-100).
For preparing fractions of soluble and polymerized tubulin, cell pellets were resuspended
in soluble tubulin extraction buffer A (137 mM NaCl, 20 mM Tris-HCl, 1% Triton-X-100,
and 10% glycerol) and rotated at 4°C for 4 min. After centrifugation, suspension was removed
and saved as soluble fraction. The remained pellet was immediately lysed in RIPA buffer and
further incubated on ice for 30 min.
For pull down assay, GST-RITA and GST-RITA Δtub were expressed in E.coli (BL21,
DE3, Codon Plus). After cell lysis with CelLytic™ B buffer (Sigma Aldrich), recombinant
proteins were purified using glutathione-Sepharose 4B beads (Amersham Biosciences). Beadcoupled proteins were then incubated overnight with either soluble or polymerized MT
fraction lysates from mitotic HCT116 cells in binding buffer (50 mM Tris, pH 8.0, 150 mM
NaCl, 1 % NP-40, 1 mM DTT, 100 μM Na3VO4, 400 μM PMSF, 1x protease inhibitor
complete). Beads were washed three times and proteins were loaded on SDS-PAGE followed
by Western blot analysis.
Time-lapse imaging
For time-lapse imaging, HeLa cells were stably transfected with the plasmid pCAG-H2BtdTOMATO-IRES-Puro, coding for a fusion protein of human histone H2B and tdTomato.
The cells were then transiently transfected with control siRNA or siRNA targeting RITA
(siRITA 1/siRITA 2). Time-lapse imaging was performed with a CellObserver system (Carl
Zeiss, Hallbergmoos) at constant 37°C and 5% CO2 for three days. Phase-contrast and
fluorescence images were taken every 4 min with a 10× Neofluar objective (Carl Zeiss) and
an AxioCam HRm camera at 1388×1040 pixel resolution with Carl Zeiss AxioVision 4.8
software. Data analysis was performed with AxioVision 4.8 software.
6
Tubulin regrowth assay, measurement of polymerized α-tubulin in vivo and depolymerization
assay in vitro
For tubulin regrowth assay, slides with HeLa cells treated with control siRNA or siRNA
targeting RITA were incubated for 45 min on ice to depolymerize MTs. To allow MT
regrowth, cells were then incubated with warm medium at 37°C for 0, 2 and 4 min, followed
by fixation and permeabilization with 4 % PFA with 0.2 % Triton-X-.100 in PBS. The cells
were stained for α-tubulin, pericentrin and DNA. The intensity of α-tubulin in a 4.06 µm
diameter circle around the centrosomes was evaluated from background corrected Z-stack
images using a confocal laser scanning microscope (Leica CTR 6500). At least 25 cells per
condition were measured and the experiments were independently performed twice.
For the measurement of polymerized α-tubulin in vivo, cells were depleted of endogenous
RITA using siRITA 1. 24 h later cells were synchronized with nocodazole and prometaphase
cells were collected by shake-off. The cells were released for 1 h in fresh medium to reach
metaphase for analysis of cellular MT polymer content after extraction, fixation and staining
for α-tubulin using FACSCalibur (Becton Dickinson, Heidelberg). Briefly, cellular soluble
tubulin was pre-extracted in a saponin containing MT stabilizing buffer (0.1% saponin, 2 mM
EGTA, 5 mM MgCl2, 0.1 M PIPES pH 7.4 and 25 nM paclitaxel). Resuspended cells were
then fixed with an equal volume of 4% paraformaldehyde solution at 37°C for 15 min. Cells
were then washed and stained for α-tubulin with a specific mouse monoclonal antibody
(Sigma-Aldrich) and FITC-conjugated rabbit anti-mouse antibody (Dako, Hamburg). More
than 95% of all cells were included in the acquisition gate and 30,000 to 50,000 cells were
examined. Fluorescence intensity was quantified using the Cell Quest software (Becton
Dickinson). The polymer content in control siRNA transfected cells was assigned as 100%.
The experiments were independently performed two times and each in triplicates.
For depolymerization assay in vitro, X-rhodamine labeled bovine brain tubulin
heterodimers (Cytoskeleton Inc, Biomol, Hamburg) were polymerized in G-PEM buffer (80
7
mM PIPES pH 6.9, 2 mM MgCl2, 0.5 mM EGTA, 1 mM dGTP and 10% glycerol) for 20 min
at 37°C and then stabilized with 8 µM taxol for 5 min at 37°C. The assay was performed in a
50 µl reaction buffer containing 0.5 µl polymerized MTs, G-PEM buffer with 30% glycerol,
20 µM taxol and 25 nM GST-RITA or its mutant for 15 min at 37°C. After the reaction, 5 µl
of the reaction volume was immediately pipetted onto a glass slide, sealed for fluorescence
microscopy, and evaluated with the AxioVision SE64 Re. 4.9 software.
Information of RITA knockout mice and preparation of embryonic fibroblasts
Cryo recovered embryos were derived from clone Rita1tm1e(KOMP)Mbp inheriting a gene
targeting allele including a β-galactosidase and neomycin resistance cassette (Figure S7). The
RITA+/- mice were mated and wild type (RITA+/+), heterozygous (RITA+/-) and homozygous
(RITA-/-) were selected by genotyping using the following primer pairs: RITA_wt_F
GGGGAGGAGGGGAACTATTCAAGC
and
RITA_wt_R
CACTTCCCACGATAAAGTAAGGCAGC for detection of RITA wild type allele or
RITA_tm_F: CACACCTCCCCCTGAACCTGAAA and RITA_wt_R, respectively.
For isolation of mouse embryonic fibroblasts, pregnant females were sacrificed after 14
days post-coitum. The uterine horns were dissected in a tissue culture hood under aseptic
conditions. After dissection, the uterine horns were placed into a petri dish containing PBS
and each embryo was separated from its placenta and embryonic sac. The head, limbs and red
organs were removed and each embryo was placed in one well of a 6 well plate. The heads
were used for genotyping. The tissue was minced until proper removal of chunks. 1 ml of
0.05% trypsin/EDTA was added to each well including 100 units of DNaseI (Qiagen) and the
tissue was incubated for 10 min at 37°C. After incubation, the cells were dissociated by
pipetting thoroughly. The incubation and dissociation step was repeated. The cells were then
separated by using a cell strainer ( 70 µm) and the single cell suspensions were centrifuged
with low speed (300 g) for 3 min. The supernatants were aspirated and the cell pellets were
8
resuspended in freshly prepared MEF medium containing DMEM with 15% FCS, Lglutamine (200 mM), penicillin (10,000 U/ml) and streptomycin (10,000 µg/ml), nonessential amino acids (100x) (1% (v/v)), sodium pyruvate (1000x) (1% (v/v)) and βmercaptoethanol (1000x) (1% (v/v), Millipore Specialty Media). The reagents for preparation
were from Gibco, if not else indicated. Each embryo was plated on a T25 flask and was
expanded up to 80-90% of confluence for passaging. The cells were frozen after passage 2 for
further usage.
Total RNA was isolated from wild type (RITA+/+), heterozygous (RITA+/-) and
homozygous (RITA-/-) MEFs by using the RNeasy Mini Kit (Qiagen). After reverse
transcription of 1 µg of total RNA via SuperScriptTM II Reverse Transcriptase (Life
Technologies), real-time PCR reaction (LightCycler 480 II, Roche, Penzberg) was
performed by using the QuantiFastTM SYBR Green PCR Kit (Qiagen). Expression levels of
RITA mRNA were normalized to endogenous -actin mRNA levels (ΔΔ-CT method) and
expression levels of mRNA derived from wild type (RITA+/+) MEFs were set to one. The
following primers were used: mRITA-615F, CAA ACC TCA CAC CAA GGA AGA AA;
mRITA-689R, ACA GTG ACT CAT CGC AGT AGG ATG; -actin forward and reverse
primers: Actb, mouse β-actin, Real-time PCR Primer Set (Biomol).
Direct stochastic optical reconstruction microscopy (dSTORM)
For this analysis, HeLa cells were plated on fibronectin coated cover slips in 12-well plates
(Roth). After 24 h, the cells were transiently transfected with 0.5 µg of pcDNA3-GFP-RITA
by using Lipofectamine 3000 (Life Technologies). For immunofluorescence staining, the cells
were fixed with 4 % paraformaldehyde, permeabilized with 0.1 % Triton-X-100, blocked with
PBS containing 0.2 % fish skin gelatin (Sigma-Aldrich). The following antibodies and
antisera were used: anti α-tubulin, mouse monoclonal IgG, (T9026, Sigma-Aldrich),
9
secondary antibody, Alexa Flour® 532 coupled goat anti-mouse IgG (A11002, Life
Technologies), ATTO 647N coupled nanobody GFP-Booster_ATTO647N (gba647N,
Chromotek).
Experiments were performed on a home built inverted microscope applying an objectivetype total internal reflection fluorescence (TIRF) or highly inclined and laminated optical
sheet (HILO) configuration. Three or four continuous-wave laser sources (640 nm, 490 nm
and 402 nm, Toptica Photonics and 532 nm, Cobolt) were combined, controlled in intensity
by an acousto-optical tunable filter (AOTF) (TF-525-250-6-3-GH18A, Gooch&Housego) and
reflected into an oil-immersion objective (APO TIRF 60x, NA 1.49 Oil, Nikon) by a
multiband dichroic (HC545/650, AHF Analysentechnik, Tübingen). Single molecule
fluorescence signals were separated into the two detection channels by a dichroic (645dcxr,
AHF Analysentechnik), and filtered using two band-pass emission filters (HQ585/80m and
HQ710/100m, AHF Analysentechnik). Fluorescence light was finally passed on to two halves
of an EMCCD camera (iXon 897, Andor Technology). The magnification of the microscope
yielded an effective pixel size of 132 nm. A series of 30,000-50,000 images was acquired for
the red channel and followed by another series of 30,000-50,000 images for the green channel
if dual color images were acquired, each taken at a frequency of 46 Hz with typical laser
intensities of 0.4 - 0.7 kW/cm2 for excitation and 0-3 W/cm2 for activation. In some
experiments RITA-GFP was labeled with nanobooster-Atto647N in conjunction with Alexa
Fluor 532 staining of α-tubulin; in this case the sample was pre-bleached for 1 min with a
high intensity 490 nm laser light to erase the unwanted eGFP signal prior to taking the images
for the green channel. Z-drift was automatically corrected during image acquisition by a home
built autofocus system. A series of 30,000-50,000 images was acquired for each channel.
Prior to imaging, cells were placed in a degassed PBS imaging buffer containing 100 U/ml
glucose oxidase, 400 U/ml catalase, 4% (wt/vol) glucose and 100 mM cysteamine (SigmaAldrich) at pH 7.5.
10
The acquired images were analyzed using custom written MATLAB software
(MathWorks, Natick). The image series was background corrected by applying a running
temporal median filtering1 with a window size of 101 frames. The center position of
fluorescent spots above a certain threshold were identified by fitting a Gaussian function and
filtered according to intensity, width and asymmetry criteria. The set of fluorophore
localizations was reconstructed in a pixel raster of 10 nm and weighted with the intensity of
the individual localization. The second channel of a two color image was transformed onto the
first channel according to a transformation function obtained by imaging fluorescent beads
(TetraSpeck Microspheres, Life Technologies) in both color channels. XY-drift was
compensated by applying a redundant cross correlation algorithm to the identified
localizations.2
The reconstructed high resolution images were analyzed with ImageJ (NIH). For the
analysis of the mean width of microtubules in cells with endogenous expression levels of
RITA, 160 line selections with a width of 300 nm were applied perpendicular to the
filamentous structures and the resulting intensity profiles along these selections were fitted
with a Gaussian function, yielding the full width at half maximum (FWHM) of the fitted
intensity profiles. Selections were rejected if the corresponding R2-value was below 0.9. All
presented super resolution images were processed with a Gaussian blur (sigma = 5 nm) for a
smoother rendering.
Reference List
1. Hoogendoorn E, Crosby KC, Leyton-Puig D, Breedijk RM, Jalink K, Gadella TW et al. The fidelity
of stochastic single-molecule super-resolution reconstructions critically depends upon robust
background estimation. Sci Rep. 2014; 4:3854.
2. Wang Y, Schnitzbauer J, Hu Z, Li X, Cheng Y, Huang ZL et al. Localization events-based sample
drift correction for localization microscopy with redundant cross-correlation algorithm. Opt
Express. 2014; 22(13):15982-15991.
11