Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Fig. S1 Selection of plant materials for DGE analysis. A, PCR amplification of hrf2 (1), part of the pCAMBIAI1301 vector (2), and hptII (3). M: marker; P: positive control, pCAMBIAI1301::hrf2; W, negative control (double distilled water); UT: negative control (untransformed plants); 1–6: individual transgenic plants. B, RT-PCR analysis of hrf2 (1) and actin genes (2). M: marker; UT: negative control (untransformed plants); 1–6: individual transgenic plants. C, Protein activity test of transgenic plants. P: positive control (purified harpinXooc); UT: negative control (untransformed plants); CK: lysis buffer; 1–4: individual transgenic plants. Fig. S2 Distribution of total tags and distinct tags among different tag abundance categories. (A) Distribution of total tags. Numbers in square brackets indicate the range of copy numbers for a specific category of tags. For example, [2, 5] indicates that all tags in this category are present in 2 to 5 copies. Numbers in parentheses indicate the total tag copy number for all tags in that category. (B) Distribution of distinct tags. Numbers in square brackets indicate the range of copy numbers for a specific category of tags. Numbers in parentheses indicate the total number of types of tags in that category. Fig. S3 Gene expression levels in untransformed Y4 and transgenic T-4 rapeseed. The upregulated and downregulated genes are shown in red and green, respectively. Genes not exhibiting changes in expression are shown in blue. FDR ≤ 0.001, |log2Ratio |≥ 1. Table S1 DEGs related to PCD in transgenic T-4 rapeseed Effection on PCD a Gene ID Description Log2Ratio P-value Bna39101002 Programmed cell death protein 1.36 3.15E-14 + Bna39242408 HR-like lesion-inducing protein 1.58 0 + Bna25434366 Development and cell death domain protein 1.18 2.46E-06 + Bna39248523 Development and cell death domain protein 0.94 5.11E-08 + Bna39239724 Disease resistance protein 2.07 6.43E-13 + Bna38904688 Disease resistance-responsive family protein 1.89 1.15E-04 + Bna36046487 Disease resistance protein 1.28 2.75E-14 + Bna39276946 Disease resistance protein 0.12 3.88E-06 + Bna38891812 ADP-ribosylation factor 2.15 6.44E-06 + Bna39015143 ADP-ribosylation factor 1.72 4.47E-06 + Bna39186766 Fasciclin-like arabinogalactan protein 2.12 2.10E-07 + Bna25440452 Aspartic protease 0.58 1.07E-49 +/- Bna39237556 Aspartic protease 0.37 1.56E-13 +/- Bna39002684 OTU-like cysteine protease 1.14 1.65E-08 +/- Bna35033042 Cathepsin B-like cysteine protease 0.85 6.18E-05 +/- Bna39001308 Zinc finger protein LSD1 3.02 3.07E-07 - Bna39277289 MLO1 0.52 1.32E-137 - a ‘+’ represents genes with positive effects on plant PCD; ‘-’ represents genes with antagonistic effects on plant PCD; ‘+/-’ represents genes that play ambiguous roles in plant PCD Table S2 DEGs related to defense-related proteins, the phenylpropanoid defense pathway, and plant cell wall components in transgenic T-4 rapeseed Defense-related proteins Gene ID Description Bna52590269 Pathogenesis-related protein PR1-3 0.36 2.78E-07 Bna39248888 Pathogenesis-related family protein 1 0.33 4.34E-12 Bna39162989 Chitinase 8.84 1.06E-08 Bna38995176 Chitinase 0.34 8.22E-20 Bna25500170 Basic endochitinase CHB4 0.32 4.00E-305 Bna38911151 Chitinase 0.11 2.09E-07 Thaumatin-like, PR-5 Bna25470693 Pathogenesis-related thaumatin family protein 0.90 2.69E-18 Protease inhibitor, PR-6 Bna39165915 Cysteine protease inhibitor CPI-1 1.79 0 Bna39164360 Protease inhibitor 9.56 7.75E-14 Bna39204491 protease inhibitor 9.08 3.98E-10 Bna39249683 Protease inhibitor 5.89 1.11E-06 Bna39292123 Protease inhibitor 2.88 1.51E-09 Bna39069238 Protease inhibitor 1.46 1.34E-06 Bna39242999 Protease inhibitor 0.83 1.59E-59 Bna39170555 Protease inhibitor 0.22 1.06E-15 Bna25413960 Peroxidase 2.37 1.21E-95 Bna39219121 Peroxidase 2.26 1.71E-20 Bna36046061 Peroxidase 2.17 0 Bna36045118 Peroxidase 2.12 6.43E-13 Ribonuclease, PR-10 Bna38972235 Ribonuclease H2 subunit C 2.74 5.54E-05 Defensin, PR-12 Bna39218572 Defensin-like protein 2 10.48 0 Bna39152633 Defensin-like protein 2 4.31 3.95E-05 Bna39167627 Defensin-like protein 1 2.15 0 Pathogenesis-related protein, PR-1 Chitinase, PR-3 Peroxidase, PR-9 Log2Ratio P-value Lioid transfer protein, PR-14 Bna39234498 Defensin 1.2 1.73 3.75E-13 Bna39298875 Defensin 0.27 3.37E-29 Bna53136534 Plant defensin PDF1.3 0.73 1.12E-05 Bna39237828 Lipid transfer protein 8.12 1.46E-05 Bna39234607 Lipid transfer protein 5 2.47 0 Bna36045110 Nonspecific lipid-transfer protein precursor-like 2.04 1.8E-04 protein Oxalic acid oxidase; OXO, PR-15 Polygalacturonase inhibitory Bna38885837 Lipid transfer protein 1.77 0 Bna39243338 Lipid transfer protein 0.57 0 Bna39240733 Lipid transfer protein 0.35 5.59E-45 Bna32888249 Nonspecific lipid-transfer protein 3 0.34 1.64E-25 Bna39171614 Nonspecific lipid-transfer protein precursor 0.33 2.85E-189 Bna39250032 Nonspecific lipid-transfer protein 6 0.32 1.08E-37 Bna39256299 Lipid transfer protein 0.30 3.66E-87 Bna39162760 Oxalic acid oxidase 1.56 2.84E-14 Bna39267991 Oxalic acid oxidase 1.01 9.68E-09 Bna39206653 Polygalacturonase inhibitory protein 3.93 3.95E-05 Bna25484467 Polygalacturonase inhibitor protein 3.50 1.29E-05 Bna36045639 Myrosinase 2.81 2.21E-08 Bna25477544 Myrosinase 1.48 1.40E-13 Bna25494861 Myrosinase-associated protein 10.14 0 Bna39244710 Myrosinase-associated protein 9.82 0 Bna25494844 Myrosinase-associated protein 9.62 2.04E-14 Bna39249134 Myrosinase-associated protein 9.28 1.49E-11 protein, PGIP Myrosinase Myrosinase-associated protein, MyAP Myrosinase-binding protein Phenylpropanoid defence pathway Plant cell wall components Pectin acetylesterase Pectin esterase Cellulose synthase Expansin Bna25419266 Myrosinase-associated protein 0.43 9.53E-07 Bna25477510 Myrosinase-binding protein 4.68 5.62E-13 Bna39282653 Myrosinase-binding protein 0.72 7.53E-06 Bna39230744 Myrosinase-binding protein 0.24 5.80E-09 Bna39230798 Myrosinase-binding protein 0.18 2.61E-25 Bna25439452 4-coumarate—CoA ligase, 4CL 4.12 1.08E-04 Bna38432659 Flavanone 3-hydroxylase, F3H 0.36 4.06E-12 Bna39206171 Flavone synthase, FNS 0.14 1.61E-11 Bna38994658 Caffeic acid 3-O-methyltransferase, COMT 0.12 7.22E-05 Bna39168141 Pectin acetylesterase 10.43 0 Bna39250453 Pectin acetylesterase family protein 1.12 1.18E-11 Bna39254181 Pectin esterase like protein 2.59 1.18E-04 Bna25464532 Pectin esterase family protein 1.05 6.51E-06 Bna39298688 Cellulose synthase 0.31 4.27E-21 Bna39163311 Cellulose synthase-like protein B3 0.25 3.18E-16 Bna39170396 ATEXPA10, Arabidopsis Thaliana Expansin A 4.78 2.21E-08 1.29 3.40E-07 3.71 1.09E-04 2.79 3.88E-06 2.37 1.07E-05 1.80 1.26E-06 10 Bna39004961 ATEXLB1, Arabidopsis Thaliana Expansin-like B1 Hydroxyproline-rich glycoprotein, Bna37283313 HRGP Late embryogenesis abundant hydroxyproline-rich glycoprotein Bna39186972 Hydroxyproline-rich glycoprotein family protein Bna39184710 Hydroxyproline-rich glycoprotein family protein Bna39167482 Hydroxyproline-rich glycoprotein family protein Proline-rich protein, PRP Glycine-rich protein, GRP Arabinogalactanprotein, AGP Bna39140702 Proline-rich family protein 2.31 0 Bna38922708 Proline-rich family protein 1.62 3.75E-05 Bna32888220 Glycine-rich protein 3.21 3.95E-05 Bna39199521 Glycine-rich protein 2.13 7.49E-05 Bna39237806 Glycine rich protein-like 1.93 3.02E-05 Bna39230134 Glycine-rich protein 1.72 0 Bna39166293 Glycine-rich protein 23 1.58 1.23E-12 Bna39297845 Glycine-rich protein 0.84 4.18E-13 Bna25466355 Glycine-rich protein 0.59 4.13E-36 Bna36047368 Arabinogalactan-protein 8.20 7.59E-06 Bna39186766 Fasciclin-like arabinogalactan protein 2.12 2.10E-07 Table S3 DEGs related to plant hormone biosynthesis, catabolism, and signal transduction in transgenic T-4 rapeseed Gene ID Description Fold P-value SA biosynthesis Bna39167207 Isochorismate synthase 2, ICS2 1.32 2.69E-07 SA signalling Bna39248803 NPR1-like protein 3, NPR3 0.66 1.07E-04 JA biosynthesis Bna39187958 Phospholipase family protein 2.09 2.00E-10 Bna52587885 Phospholipase A2-alpha 1.75 9.16E-09 Bna39173182 Lipoxygenase, LOX 8.79 2.05E-08 Bna39169601 Lipoxygenase 4.23 1.08E-04 Bna25485078 Lipoxygenase 2 1.93 0 Bna39250058 12-oxophytodienoate reductase, OPR 2.38 3.49E-14 Bna39186998 Enoyl-CoA hydratase 1.49 6.29E-07 Bna39297304 Thiolase 1.57 8.45E-06 Bna25477588 2-hydroxyacyl-CoA dehydrogenase 0.58 1.37E-21 Bna52594427 protein TIFY 7; Jasmonate ZIM-domain protein 2.89 4.26E-05 Bna52593600 protein TIFY 10B; Jasmonate ZIM-domain 2.86 1.51E-13 2.73 1.30E-05 change JA signalling protein Bna39238037 protein TIFY 11B; Jasmonates ZIM-domain protein ET biosynthesis Bna39163192 ACC oxidase 1.68 6.40E-05 ET signalling Bna39188380 APETALA2 and EREBP, ethylene responsive 9.49 2.89E-13 element binding protein Auxin biosynthesis Auxin signaling Bna39187786 Ethylene response sensor 7.74 2.03E-04 Bna39242827 EIN3-Binding F BOX Protein 2, EBF2 3.34 6.64E-13 Bna38894261 Ethylene-responsive transcription factor ERF069 0.72 1.70E-05 Bna44672452 Ethylene-responsive transcription factor ERF060 0.45 4.78E-06 Bna25414333 Ethylene-responsive transcription factor ERF023 0.44 2.16E-09 Bna39240712 CYP83B1 3.48 3.99E-13 Bna25486014 Nitrilase-like protein 0.34 0 Bna39240426 Nitrilase activity 0.21 5.02E-14 Bna39242071 Aldehyde oxidase 0.87 1.73E-07 Bna39233668 Auxin response factor 8, ARF 1.18 1.61E-05 Bna38920344 Auxin responsive protein IAA 8.43 1.06E-06 Bna39296834 Auxin reponsive protein 4.63 6.57E-05 Bna37279562 Auxin responsive protein 3.86 6.57E-05 Bna53139981 Auxin responsive protein 2.07 1.77E-06 Bna39163068 Auxin responsive protein 0.39 7.07E-15 Bna39166254 SAUR; Auxin-induced protein-like 0.09 1.28E-29 Bna39166442 SAUR-like; Auxin-responsive protein 0.39 1.63E-59 Bna39201713 Dormancy/Auxin associated protein 4.50 6.57E-05 Bna39224187 Dormancy/Auxin associated protein 1.61 7.62E-11 Bna38997093 Auxin-induced atb2-like protein 0.12 1.5E-04 ABA biosynthesis Bna46922371 Zeaxanthin epoxidase, ZEP 0.30 1.36E-15 Bna39227479 NCED4, 9-cis-epoxycarotenoid dioxygenase 4 0.34 5.06E-21 Bna39126794 NCED3, 9-cis-epoxycarotenoid dioxygenase 3 0.11 5.41E-09 Bna44680032 Short-chain dehydrogenase/reductase family 3.53 3.95E-05 1.89 1.91E-05 1.75 1.11E-13 protein, SDR Bna38903535 Short-chain dehydrogenase/reductase family protein Bna25429379 Short-chain dehydrogenase/reductase family protein ABA catabolism ABA signaling Bna39242071 Aldehyde oxidase, AAO 0.87 1.73E-07 Bna39181541 (+)-abscisic acid 8'-hydroxylase 2.89 1.27E-04 Bna39208628 (+)-abscisic acid 8'-hydroxylase 0.09 1.82E-19 Bna38999997 Abscisic acid receptor PYL5; ABI1-binding 10.26 0 3.70 6.57E-05 protein 3 Bna39003260 Abscisic acid receptor PYL4; ABI1-binding protein 2 Bna25461271 Abscisic acid receptor PYL7 3.32 1.28E-13 Bna39003811 Abscisic acid receptor PYL8 2.09 0 Bna32888989 Protein phosphatase 2C, PP2C 1.80 1.26E-06 Bna38993743 Phosphatase 2C family protein, PP2C 1.38 2.29E-09 Bna52593230 Serine/threonine phosphatases family 2C, PP2C 1.14 2.02E-06 Bna38971261 Phosphatase 2C, PP2C 0.74 8.38E-08 Bna39185822 Protein phosphatase 2C 41; PP2C41 0.58 4.71E-06 Bna39280151 Protein phosphatase 2C 16; PP2C16 0.34 1.19E-15 Bna37268194 SnRK; SNF1 related protein kinase 0.37 3.31E-208 Bna39211698 AFP3; ABI 5 Binding Protein 3 0.46 7.15E-11 Bna39202750 ABA-induced-like protein 0.12 1.87E-06 Bna39003448 ABA-responsive protein (GRAM domain) 3.41 3.95E-05 Bna39283498 hb-6-like protein 0.52 7.44E-32 Table S4 DEGs related to G protein signaling, Ca2+ signaling, and ubiquitination signaling in transgenic T-4 rapeseed G protein signaling Ca2+ signaling Gene ID Description Fold change P-Value Bna39005343 Ran-binding protein 1-a 7.84 1.05E-04 Bna37281287 GTP binding protein 3.22 6.78E-05 Bna44678152 Ras-related protein RABA1b 2.48 1.80E-05 Bna38993100 GTP binding / GTPase 2.74 2.60E-13 Bna44687568 RabGTPase-like protein A5B 2.37 3.08E-07 Bna39240837 GTP-binding protein; Ran3E-1 1.99 4.11E-13 Bna39126676 RabGTPase Homolog A4B 1.65 6.59E-07 Bna39162467 GTP-binding protein subunit beta-like protein 1.49 2.91E-13 Bna39064011 Ran-binding protein 1 domain-containing protein 1.46 0 Bna39167534 Rac-like GTP-binding protein ARAC4 1.37 1.52E-05 Bna39164803 GTP-binding protein 1.19 1.83E-05 Bna39237762 RabGTPase Homolog A2C 1.14 3.07E-13 Bna52602738 Ras-related small GTP-binding family protein 1.10 2.05E-13 Bna38998453 GTP-binding family protein 0.94 6.34E-08 Bna38993578 RabGTPase homolog G3d 0.52 2.68E-21 Bna39170190 GTP-binding protein 0.41 8.55E-05 Other G protein signaling Bna36047404 Rho-GTPase-activating protein 5.34 6.64E-13 components Bna38891812 GTPase-activating protein, GAP 2.15 6.44E-06 Bna39163118 Ras-GTPase-activating protein 1.27 0 Bna38997321 Regulator of G protein signaling, RGS 3.67 2.29E-05 Bna39003001 G protein-coupled receptor, GPCR 2.12 3.00E-09 Bna39278860 Extracellular ligand-gated ion channel 0.12 3.48E-05 Bna25424071 Extracellular ligand-gated ion channel 0.12 8.06E-06 G protein, GTP-binding protein Generation of ‘ Ca2+ signature’ Ca2+ sensors Bna38969315 Metal transport protein 3.61 3.95E-05 Bna39279444 Ion transmembrane transporter 2.00 6.67E-07 Bna39244563 Ion transmembrane transporter 1.18 1.61E-13 Bna39189656 Ca2+-transporting ATPase like protein 8.43 1.06E-06 Bna38958555 Ca2+-transporting ATPase 0.38 8.35E-05 Bna38956719 H+ 2.44 4.08E-06 Bna39201211 H+-transporting 1.77 3.97E-14 Bna39197711 H+-transporting ATP 0.57 4.59E-41 Bna39179237 Calcium-binding EF-hand protein 4.29 7.59E-14 Bna39244053 Calcium-binding EF-hand protein 3.30 4.29E-08 Bna39244947 Calcium-binding EF hand family protein 2.81 7.14E-06 Bna25488162 Calcium-binding protein 1.85 1.86E-12 Bna37278469 Calcineurin B-like protein, CBL 1.22 2.60E-06 Bna39250210 Calmodulin, CaMs 2.33 5.95E-07 Bna44681667 Calmodulin 2.18 4.78E-06 Bna39248612 Calmodulin- 2.1 0 Bna39204571 Calmodulin 1.75 3.37E-13 Bna39237836 Calmodulin 1.52 1.84E-12 Bna39187620 Calmodulin 1.01 8.63E-05 Bna39212315 Calmodulin 0.52 3.12E-07 Bna38992493 Calmodulin-binding protein 2.38 5.80E-09 Bna25485403 Calmodulin-binding protein 1.52 1.97E-13 Bna38909508 Calmodulin-binding protein 1.41 6.30E-07 Bna39244829 Calmodulin-binding protein 1.27 9.02E-05 Bna39184517 Calmodulin-binding protein 1.23 1.18E-06 Bna39004149 Calmodulin-binding family protein 0.75 1.28E-27 transporting ATP synthase two-sector ATPase synthase ubiquitination signaling Ub Bna37296759 Ubiquitin-like proteins, Ub 0.90 0 SUMO Bna39229781 Small ubiquitin-related modifier 3 3.04 1.29E-05 E2 Bna39076839 Ubiquitin-conjugating enzyme E2 2.49 4.73E-13 Bna39189083 Ubiquitin-conjugating enzyme E2 1.39 2.90E-12 Bna52585743 Ubiquitin-conjugating enzyme E2 0.78 1.72E-07 UCH Bna38992999 Ubiquitin carboxyl-terminal hydrolase-related protein 1.65 6.59E-07 E3 Bna25416785 Cullin-RING ubiquitin ligase complex 2.38 1.51E-09 Bna44669387 Cullin-RING ubiquitin ligase complex 2.08 2.01E-10 Bna38908200 Ubiquitin-protein ligase 8.03 2.82E-05 Bna32880464 Ubiquitin-protein ligase 3.29 7.70E-10 Bna38909755 Ubiquitin-protein ligase 2.12 2.02E-12 Bna39292037 Ubiquitin-protein ligase 1.87 8.97E-10 Bna38909176 Ubiquitin-protein ligase 2.01 2.26E-13 Bna44672740 Ubiquitin-protein ligase 0.40 4.85E-05 Bna39171470 Kelch repeat-containing F-box family protein 2.15 2.22E-15 Bna39267303 F-box family protein 2.09 2.66E-11 Bna38978210 F-box family protein 1.89 1.91E-05 Bna39238218 F-box/kelch-repeat protein 1.77 5.55E-13 Bna39167932 F-box family protein 0.26 8.17E-194 Bna25485650 F-box protein 0.26 0 Bna39209444 U-box domain-containing protein 2.05 0 Bna52607229 RING/U-box domain-containing protein 1.57 1.69E-11 Bna39203619 PUB18,,Plant U-BOX 18 0.34 4.00E-17 F-box protein U-box protein Table S5 DEGs related to protein kinases in transgenic T-4 rapeseed Gene ID Description Fold change P-value Calcium dependent protein kinase, CDPK Bna39171028 Calcium-dependent protein kinase 9 0.96 1.14E-05 Mitogen activated protein kinase , MAPK Bna51749245 MAP kinase 4 2.48 1.13E-12 Bna52602272 MAP kinase 6 1.09 1.42E-04 Bna39182231 MAP kinase 9 0.58 4.90E-53 Bna39278589 MAP kinase 19 0.68 1.19E-34 Bna39185837 MKK9, MAP KINASE KINASE 9 2.15 9.10E-08 Bna25477586 MAPKKK beta 1 protein kinase 1.46 7.74E-10 Bna37215836 Feronia receptor-like kinase 3.79 3.95E-05 Bna39298115 Cysteine-rich receptor-like protein kinase 8 0.34 8.98E-11 Bna39179688 Wall-associated receptor kinase-like 10 0.27 3.81E-08 Bna39249379 Leucine-rich repeat receptor-like protein kinase 7.84 1.05E-04 Bna39004716 Leucine-rich repeat receptor-like protein kinase 1.35 3.78E-10 Bna39189036 Leucine-rich repeat receptor-like protein kinase 0.12 1.67E-05 Bna39162161 CBL-interacting protein kinase 1 3.97 2.29E-05 Bna39227495 CBL-interacting protein kinase 14 0.40 4.85E-05 Bna39232261 CBL-interacting protein kinase 25 0.27 4.04E-34 Bna32887901 Shaggy-related protein kinase 8.03 2.82E-05 Bna39004145 D6 protein kinase like 1 3.36 2.00E-10 Bna39238716 Sel1-like repeat-containing protein kinase 2.86 3.88E-06 Bna39078506 Leucine-rich repeat like serine/threonine protein kinase 2.59 1.18E-04 Bna39126918 LRR receptor-like serine/threonine protein kinase 1.15 1.29E-06 Bna32880127 CKI1, casein kinase I 1.56 3.29E-06 Receptor like protein kinase, RLK Leucine-rich repeat receptor-like protein kinase, LRR-PLK Serine/threonine protein kinase, STK Other protein kinase Bna39232167 Serine/threonine protein kinase-like protein 2.26 6.27E-07 Bna25486250 Serine/threonine kinase BNK1 2.01 2.15E-07 Bna39290547 Serine/threonine protein kinase ATPK10 1.65 1.55E-05 Bna53140005 Serine/threonine protein kinase family protein 1.59 3.50E-05 Bna39198824 Serine/threonine-protein kinase 0.62 1.60E-39 Bna32882415 Histidine kinase 7.84 1.05E-04 Bna39249952 Histidine kinase 3.58 7.13E-06 Bna39247965 Protein tyrosine kinase 1.86 1.08E-13 Bna39254452 Protein tyrosine kinase 1.38 1.82E-07 Bna39248161 Pyruvate kinase 2.13 1.17E-08 Bna39239811 Pyruvate kinase 1.36 2.18E-13 Bna39186063 Adenylate kinase family protein 2.20 9.55E-14 Bna34328859 Aspartate/glutamate/uridylate kinase family protein 2.19 1.72E-07 Bna39167637 Nucloside diphosphate kinase 2 2.10 5.15E-08 Bna39245257 S-methyl-5-thiribose kinase 1.93 1.16E-13 Bna53140005 Protein kinase family protein 1.59 3.50E-05 Bna39162792 Diacylglycerol kinase 1 0.40 7.84E-11 Table S6 DEGs related to transcription factors in transgenic T-4 rapeseed MYB transcription factor AP2/EREBP transcription factor Gene ID Description Log2Ratio P-value Bna29940217 MYB family transcription factor 10.38 0 Bna39004392 MYB-like transcription factor 2.08 9.99E-15 Bna39088037 MYB family transcription factor 0.54 1.52E-04 Bna37267028 MYB-related transcription factor 0.61 6.51E-05 Bna37216008 R2R3-MYB transcription factor 0.47 3.22E-23 Bna25462218 MYB domain protein 95 0.49 3.97E-30 Bna37277406 C-MYC binding protein 0.30 1.80E-06 Bna39244115 CCA1 (circadian clock associated 1) transcription factor 0.11 1.01E-07 Bna39248644 APL (Altered phloem development) transcription factor 1.34 0 Bna39188380 GCC box of the ethylene response element (ERE) 9.49 2.89E-13 Bna39093151 AP2/ERF transcription factor 7.94 5.44E-05 Bna39238487 AP2/ERF and B3 domain-containing transcription factor RAV2 2.54 4.08E-13 Bna37279577 AP2 transcription factor 1.13 2.98E-12 Bna39241287 AP2 domain containing protein RAP2.7 0.44 7.60E-19 Bna25484966 DREB2-19 0.43 1.25E-47 Bna39182169 ERF2 transcription factor 1.35 1.01E-04 Bna25414333 Ethylene-responsive transcription factor ERF023 0.44 2.16E-09 Bna44672452 Ethylene-responsive transcription factor ERF060 0.45 4.78E-06 Bna38894261 Ethylene-responsive transcription factor ERF069 0.72 1.70E-05 Bna39140511 VAM3; SNAP receptor 1.5 1.15E-04 Bna38995243 TINY transcription factor 8.79 2.05E-08 Bna39004503 TINY transcription factor 2.16 3.81E-07 Bna34817726 Baby boom interacting protein 2 1.83 1.04E-12 NAC-domain protein bZIP transcription factor Zinc finger protein Bna39006051 NAC domain-containing protein 5 4.61 1.08E-04 Bna25479726 NAC-domain protein 5-8 2.95 0 Bna39288059 NAC domain-containing protein 2.08 0 Bna25478767 NAC-domain protein 14 1.47 8.62E-09 Bna25479707 NAC-domain protein 5-11 0.84 2.32E-28 Bna25479785 NAC-domain protein 1-1 0.8 1.78E-06 Bna39180164 NAM/CUC2-like protein 0.43 4.81E-05 Bna35033058 NAC domain containing protein 47 0.32 1.99E-37 Bna39249308 NAC-domain protein 3 0.12 8.06E-06 Bna39168304 bHLH32 ( Basic helix-loop-helix 32) transcription factor 2.52 1.59E-05 Bna38996261 bHLH148 transcription factor 2.42 1.60E-07 Bna36045964 bHLH family protein 2.35 3.77E-12 Bna39169220 bHLH60 transcription factor 2.24 4.08E-13 Bna39293241 bHLH transcription factor 1.59 3.50E-05 Bna25418073 bHLH transcription factor like protein 1.20 3.61E-06 Bna39162682 bHLH64 transcription factor 0.25 4.72E-40 Bna48316871 bHLH DNA-binding domain transcription factor 0.60 1.47E-04 Bna39164403 bHLH93 transcription factor 0.66 4.93E-06 Bna39240049 bHLH family protein 47 0.76 1.56E-04 Bna38996145 bHLH family protein 0.85 9.60E-05 Bna38993093 bZIP transcription factor-like protein 2.57 4.57E-14 Bna39002380 bZIP transcription factor-like protein 2.26 1.16E-13 Bna25470935 Homeobox leucine zipper protein HAT4 0.44 5.67E-254 Bna38972292 Cox19-like CHCH family protein 2.03 8.46E-06 Bna37220088 Coiled-coil-helix-coiled-coil-helix domain containing protein 2.48 1.80E-05 Bna39231727 Constans-like 1 protein 8.36 2.04E-06 Bna25465836 CSL zinc finger domain-containing protein 8.84 1.06E-08 Bna39234598 CSL zinc finger domain-containing protein 2.58 1.41E-13 Bna39264037 B-box type Zinc finger family protein 8.20 7.59E-06 Bna39225597 B-box type Zinc finger family protein 8.03 2.82E-05 Bna39264828 B-box type Zinc finger family protein 0.44 2.68E-05 Bna52586232 Zim17-type zincfingerprotein 2.51 1.56E-13 Bna37215566 Zim17-type zincfingerprotein 0.95 3.84E-06 Bna39166435 C3HC4-type RING finger family protein 2.44 4.08E-06 Bna37610386 C3HC4 type family protein, 1.18 2.89E-05 Bna39201747 C3HC4-type RING finger family protein 0.88 2.18E-113 Bna39072927 C2H2-like zinc finger protein 2.31 5.12E-05 Bna52594307 C2H2-type zincfingerprotein 1.12 3.70E-05 Bna39272387 C2H2-like zinc finger protein 0.46 7.83E-05 Bna25459686 C2H2 zinc finger protein 1 0.61 3.47E-05 Bna39179208 Dof-type zinc finger domain-containing protein 2.23 3.24E-07 Bna39241433 Dof-zinc finger protein 0.09 2.27E-21 Bna39245449 Dof zinc finger protein 0.35 2.21E-88 Bna39284837 CCCH-type zinc finger family protein 1.58 1.81E-11 Bna39240170 CCCH-type zinc finger family protein 1.42 8.64E-05 Bna36047913 CCCH-type zinc finger family protein 0.50 2.08E-05 Bna38995502 BTB and TAZ domain protein 1 3.53 1.13E-12 Bna38994782 BTB and TAZ domain protein 5 2.23 1.80E-13 Bna39170153 BTB/POZ domain-containing protein 3.13 0 Bna38999342 BTB-POZ and math domain 1 1.79 7.02E-05 Bna38992332 RING-H2 type zinc finger protein-related 1.87 2.11E-12 Bna39130810 Vascular plant one zinc finger protein 2 1.83 7.65E-06 WRKY transcription factor Cupin domain protein Bna44666214 RING-H2 zinc finger protein-like 1.81 0 Bna39292590 Zinc finger helicase family protein 1.80 2.38E-08 Bna39223553 RING/U-box protein with C6HC-type zinc finger 1.75 3.47E-08 Bna25470625 AN1-like Zinc finger family protein 1.21 3.15E-13 Bna32878817 Iron-binding zinc finger CDGSH type domain-containing protein 0.17 3.78E-211 Bna38895002 LZF1, Light-regulated zinc finger protein1 0.25 5.91E-18 Bna39163520 GATA type zinc finger family protein 0.59 1.77E-07 Bna37292167 GATA transcription factor 1 1.68 0 Bna39222792 C3H4 type zincfingerprotein 0.96 7.34E-05 Bna39273016 Zinc finger family protein 7.84 1.05E-04 Bna36047585 Zinc finger protein 2.53 1.13E-08 Bna38944840 Zinc finger family protein 2.35 5.80E-09 Bna32883654 Zinc finger family protein 2.04 7.12E-12 Bna39224430 Zinc finger family protein 1.94 0 Bna39288231 Zinc finger family protein 1.70 2.63E-05 Bna39005516 Zinc finger family protein 1.29 0 Bna53140263 Zinc finger family protein 1.21 1.49E-05 Bna38993118 Zinc finger family protein 1.13 5.64E-06 Bna39029510 Zinc finger family protein 1.03 5.52E-05 Bna39261055 Zinc finger family protein 0.12 3.88E-06 Bna39017485 Zinc finger family protein 0.91 5.26E-05 Bna38961641 WRKY DNA-binding protein 21 1.83 2.22E-15 Bna52434848 WRKY70-1 transcription factor 1.47 2.36E-06 Bna52434864 WRKY26-1 transcription factor 0.72 2.74E-20 Bna39167495 Cupin domain-containing protein 1.67 5.06E-09 Bna39167830 Cupin domain-containing protein 0.55 1.10E-227 Ankyrin repeat protein WD repeat protein Pentatricopeptide repeat-containing protein, PPRs Nuclear transport factor, NTF G-box binding factor MADS-box protein Bna39252971 Cupin superfamily protein 1.04 2.91E-13 Bna32887604 Cupin, RmlC-type protein 2.89 1.29E-05 Bna38957218 Cupin, RmlC-type protein 8.12 1.46E-05 Bna52584676 Ankyrin repeat family protein 8.43 1.06E-06 Bna39238666 Ankyrin repeat family protein 2.19 2.22E-15 Bna25462898 Ankyrin repeat family protein 1.14 5.07E-13 Bna39068259 Ankyrin repeat family protein 0.92 6.64E-11 Bna52594010 Ankyrin repeat family protein 0.87 5.66E-05 Bna39255739 WD-repeat protein 4.74 0.000107518 Bna38901381 WD40 domain-containing protein 1.51 3.59E-13 Bna37294233 Notchless protein-like protein 0.60 9.67E-07 Bna39164037 Pentatricopeptide repeat-containing protein 2.28 0 Bna38889670 Pentatricopeptide repeat-containing protein 1.54 7.77E-05 Bna39242797 Pentatricopeptide repeat-containing protein 1.39 8.15E-14 Bna39242741 Pentatricopeptide repeat-containing protein 1.35 8.34E-08 Bna38967185 Pentatricopeptide repeat-containing protein 0.71 7.66E-14 Bna39211712 Pentatricopeptide repeat-containing protein 0.45 8.39E-20 Bna39285860 Pentatricopeptide repeat-containing protein 0.46 1.56E-06 Bna38886972 Nuclear transport factor 2 superfamily 1.20 3.13E-09 Bna39220246 Nuclear transport factor 2A 1.17 3.87E-06 Bna39173773 Nuclear transport factor 2 family protein 0.54 0 Bna39163779 Nuclear transport factor 2 family protein 0.54 4.40E-17 Bna25500472 G-box binding factor 2A 2.25 1.13E-12 Bna39283027 G-BOX Binding factor 6 0.10 2.18E-14 Bna39162581 G-BOX Binding factor 6 0.42 2.76E-05 Bna25499168 MADS-box protein 2.59 0.000118035 CCAAT-box binding transcription factor High mobility group protein Homeo-box transcription factor Armadillo/beta-catenin repeat protein AT hook motif-containing protein PAK-box/P21-Rho-binding protein Proton-dependent oligopeptide transport protein, POT C2 domain-containing protein Bna25485472 MADS-box protein 0.62 3.89E-13 Bna39174956 CCAAT-box binding transcription factor subunit B (NF-YB) family 7.95 5.44E-05 Bna38956976 CCAAT-binding transcription factor family protein 0.90 3.80E-14 Bna39019364 High mobility group family protein 2.25 2.00E-10 Bna39237481 High mobility group family protein 1.20 1.63E-13 Bna37278549 High mobility group 1.07 3.39E-13 Bna52590617 Homeo-demain glabrous 2 transcription factor 1.09 7.69E-08 Bna35033044 Homeo-box transcription factor 12 0.24 2.18E-32 Bna39237404 Armadillo/beta-catenin-like repeat-containing protein 8.85 1.06E-08 Bna39237334 Armadillo/beta-catenin-like repeat-containing protein 2.64 8.58E-05 Bna38909465 Armadillo/beta-catenin repeat family protein 0.68 2.78E-14 Bna39189331 Armadillo/beta-catenin repeat family protein 0.13 0.000149854 Bna38977058 Armadillo/beta-catenin-like repeat-containing protein 0.10 6.30E-17 Bna38957858 AT hook motif-containing protein 1.75 8.33E-08 Bna38883405 AT hook motif DNA-binding family protein 0.52 1.86E-08 Bna38993870 PAK-box/P21-Rho-binding family protein 2.52 1.59E-05 Bna38992151 PAK-box/P21-Rho-binding family protein 1.64 4.14E-07 Bna39280883 POT family protein 2.80 1.11E-06 Bna39177881 POT family domain containing protein 1.72 4.57E-14 Bna36045813 POT family domain containing protein 1.15 8.38E-06 Bna52601200 POT family domain containing protein 0.80 2.11E-11 Bna39240634 C2 domain-containing protein 1.98 2.26E-06 Bna38885765 C2 domain-containing protein 1.20 1.94E-13 Bna37280278 C2 domain-containing protein 1.13 1.06E-12 Bna39196965 C2 domain-containing protein 0.42 4.65E-107 Bna38993229 C2 domain-containing protein 0.41 2.02E-13 B1 14-3-3 protein Other transcription factors Bna44681878 14-3-3-like protein GF14 Lambda 3.25 3.95E-05 Bna32888478 14-3-3-like protein GF14 omega 1.05 1.20E-06 Bna35033086 CDF1, Cell Growth Defect Factor 1 9.25 2.88E-11 Bna39231727 Constan-like 1 protein 8.36 2.04E-06 Bna39063491 6B-interacting protein 1-like 1 2.69 2.53E-05 Bna37282085 WW domain containing protein 2.63 1.35E-05 Bna52612004 SWP, struwwelpeter 2.34 7.70E-10 Bna25477613 BURP domain-containing protein 0.81 8.73E-211 Bna53130419 HYH, HY5-Homolog 0.59 9.30E-05 Bna38959385 VQ motif-containing protein 0.52 9.91E-06 Bna39242837 Transcription factor LHY 0.13 3.48E-05 Bna53140101 Early-phytochrome-responsive1, EPR1 0.11 1.56E-11 Table S7 PCR primers used in real-time RT-PCR analysis Gene ID Target Gene Oligonucleotides primers Bna39005120 Actin F: 5'- GCTGACCGTATGAGCAAAGA R: 5'- GCTGAGGGATGCCAAGATG Bna39208628 (+)-Abscisic acid 8'-hydroxylase F: 5'-AAGGTTACAATTCGATGCCAGTG R: 5'- GATTATGTTGTCGGCGATCTGTT Bna37279562 Auxin-responsive family protein F: 5'- AGCTGTTACTCCTCCAACCATAA R: 5'- GCTTGCGTAGTCTTGATCTCCTA Bna43236380 Proline dehydrogenase Bna39264037 Zinc finger family protein F: 5'- CGCATTATCTTCCTCTTGTCTC R: 5'- CGCTGATGATGTTGGTGGT F: 5'- TCCATCATCACCCTTCT R: 5'- TGTCCCACTTGACCTCT Bna38995424 Putative peptide chain release factor F: 5'- GACAGGCAGTAGGCGTAGGT R: 5'- CCCGTCGGAGTGTATGAGT Bna39189036 Leucine-rich repeat receptor-like protein kinase F: 5'- GGCGGAGTTGGAGATGTATGGTG R: 5'- CCCGTTCGTGGCCTGGAGAAGAT Bna52591370 Transcription factor F: 5'- TAGTGATGGAAGTGACGGGAATA R: 5'- TGACTGAGAAACAGACCGAAATG Bna25485078 Lipoxygenase Bna42607382 Long chain acyl-CoA synthetase1 F: 5'- AAGGATGGTGGAGTGAAGTGAGG R: 5'- GTGGTTGGTCGGTTGGGAAAGTA F: 5'- AGGACGGGAAGGTCTTTGAGAAG R: 5'- AAGCAGCCCTGTAACGCAATAAA Bna25494861 Myrosinase-associated protein F: 5'- CCGATGGTTCTGCTCAACAAGCT R: 5'- TCACGATAGGAAAGCAACCCAGT