Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
SUPPORTING INFORMATION Complete mitochondrial genomes and a novel spatial genetic method reveal cryptic phylogeographical structure and migration patterns among brown bears in northwestern Eurasia Marju Keis, Jaanus Remm,Simon Y. W. Ho, John Davison, Egle Tammeleht, Igor L. Tumanov, Alexander P. Saveljev, Peep Männil, Ilpo Kojola, Alexei V. Abramov, Tõnu Marg and Urmas Saarma Journal of Biogeography Appendix S1: Supporting text, tables and figures Appendix S1 provides: additional text information for the nucleotide diversity in different regions of the mitochondrial genome, and phylogenetic resolution through comparative analysis of five mtDNA datasets; data for samples and mitogenomes used in different analyses (Table S1); primers for complete mtDNA sequencing (Table S2); population genetic statistics of different mtDNA datasets (Table S3); molecular diversity indices for different regions of brown bear mtDNA (Table S4); relative contribution of different mitochondrial genes to the NCmtDNA network (Table S5); relative contribution of different mitochondrial genes to the NCmtDNA network normalized to gene length (Table S6) phylogeographic relationships of brown bears based on two mtDNA datasets: (a) 257 bp, (b) 1942 bp (Figure S1); relationships between sequence length and the number of parsimony-informative sites (PIS), the average number of nucleotide differences (k) and the haplotype diversity (Hd) (Figure S2); NCmtDNA network with defining mutations (Figure S3); Bayesian phylogenetic tree based on NCmtDNA data (Figure S4); network based on complete protein-coding sequences (Figure S5). 1 Nucleotide diversity in different regions of the mitochondrial genome The most variable section was the control region, but when homoplasious sections were excluded, its nucleotide diversity () dropped by almost an order of magnitude (Table S4), rendering it less diverse than several protein-coding genes. Of the coding sequences, the most variable genes were ND4, ND4L and ND5. ND4 and ND5 also had the highest average number of nucleotide differences per gene. Among tRNAs the most variable were tRNA-Tyr and tRNA-Ser, while many tRNAs were completely conserved (Table S4). To evaluate the relative contribution to the NCmtDNA network of each mitochondrial gene (and the control) region, we expressed the number of mutations in a particular gene as a proportion of the total number of mutations in the whole NCmtDNA network and in particular haplogroups (A–E) (Table S5). On this basis, the highest contributors to the NCmtDNA network were ND5, ND4, CYTB and the control region, and these same regions were also the highest contributors to individual haplogroups, though also COX3 also contributed importantly to haplogroup A. However, when contribution was normalized in relation to gene length (Table S6), a different set of regions contributed most (tRNAs, ATP6, ND6 and COX2). Different regions of mtDNA evolve at different rates, leading to considerable variation in nucleotide diversity along the genome. Among the 95 mitogenome sequences in our study, mutation hotspots were located in the control region, which is non-coding and thus able to accumulate frequent mutations without a significant cost to fitness. However, after removing indels and tandem repeats that are potentially homoplasious, the nucleotide diversity of the control region dropped considerably, even below the level of protein-coding genes ND4, ND4L and ND5. If haplotype diversity values are also considered, it would appear that the control region does not hold any advantage over coding sequences with regard to information content. ND4 and ND5 have previously been used to study the phylogeny of Ursidae, though ND4L exhibited poor phylogenetic value (Yu et al., 2007). We found that ND4L exhibited the highest nucleotide diversity among protein-coding genes, but its overall contribution was small (only four variable positions) because it comprises fewer than 300 bp and is the secondshortest gene (after ATP8). However, the highest contributors to the NCmtDNA network were ND5, ND4, CYTB and the control region, and the same regions were among the highest contributors to individual haplogroups (Table S5). On the other hand, when contribution was normalized in relation to gene length (Table S6), the highest contributing regions were different (tRNAs, ATP6, ND6 and COX2). It should be noted that the importance of the control region was also low in this respect, as the network based only on protein-coding genes (Fig. S5) was highly similar to the NCmtDNA network. 2 Phylogenetic resolution through comparative analysis of five mtDNA datasets Five datasets comprising the same bear individuals but different sections of mtDNA (Table 1) were analysed to compare their power to resolve phylogeographic structure: (1) 257 bp; (2) 1942 bp; (3) NCmtDNA, 16686–16689 bp; (4) protein-coding, 11406 bp; and (5) complete mtDNA, 16760–16793 bp. The coding of haplotypes is such that the identities of individual haplotypes are traceable between different sets (e.g. haplotypes 1a–c in NCmtDNA set, shown in Fig. 1, are all derived from individuals with haplotype 1 in Fig. S1b). (1) Based on the most commonly used section of control region (257 bp) we identified six closely related haplotypes. Six variable sites were found in this short fragment of the control region, with the central haplotype separated from the others by only one or two mutations. Almost 90% of the samples (85 out of 95) represented a single and widespread haplotype (marked in orange in Fig. S1a, Table S1). The other five haplotypes comprised only ten samples and were found mostly at the periphery of the study area. (2) Analysis of 1942 bp revealed 18 closely related haplotypes that also formed a star-like network (Fig. S1b), albeit with more internal structure than the 257 bp network. The central haplotype of the 257 bp dataset was divided into 13 different haplotypes in this analysis (Fig. S1b, Table S1). In common with the shorter sequence set, the central haplotype of this set was one of the most numerous (comprising 27% of all analysed samples) and was found throughout the study area, except in Pskov and Vologda oblasts and Estonia. Most other haplotypes were more or less geographically restricted and comprised a small number of samples. From this perspective, haplotypes 2, 5 and 13 were exceptional: haplotype 2 was as numerous as haplotype 1, but was specific to brown bears in Estonia (n = 26; 72% of all analysed bear samples from Estonia carried this haplotype); haplotypes 5 and 13 were less numerous, but covered much larger areas and were found from Finland to Arkhangelsk oblast. (3) The third network, based on nearly complete mtDNA (NCmtDNA), contained 37 different haplotypes, with 117 variable sites, of which 85 were parsimony-informative (Fig. 1, Table 1). Compared with the previous networks, the much larger number of characters in this dataset (16686–16689 bp) meant that phylogeographically distinct clusters could be identified, although the centre of the network consisted of several median vectors (i.e. unsampled or extinct haplotypes). The most significant change compared with the previous 3 networks was that the haplotypes were divided among five divergent, geographically confined and partially overlapping haplogroups (defined as A, B, C, D and E; Fig. 1). Haplotype 1 from the 1942 bp dataset was transformed most dramatically in this dataset: it was divided into 13 different haplotypes (1a1–1a5, 1b, 1c1–1c3, 1d, and 1e1–1e3) that contributed to all haplogroups except for D (specific to Finland). Haplotypes 2 and 3 were both further divided into three haplotypes (2a–c, 3a–c), all belonging to haplogroup B. Haplotypes 2a–c were specific to Estonia and haplotypes 3a–c to Estonia and adjacent areas of Russia (Leningrad and Pskov oblasts). Haplotype 5 was also further divided into three closely related haplotypes 5a–c (most found in Arkhangelsk oblast, but a single sample was also detected in eastern Finland), positioned in haplogroup C. One notable change was a brown bear from Arkhangelsk oblast which in the 1942 bp dataset represented haplotype 13, generally found in Finland; but clustered here together with samples from Kirov oblast (1c1–1c3) in the NCmtDNA dataset. (4) A median-joining network based on the full protein-coding dataset (11406 bp) showed the same topology (Fig. S5) as that based on the NCmtDNA dataset (Fig. 1), except that several branches were shorter and three haplotypes present in the NCmtDNA network were not evident here (see also Table S1). (5) In comparison with NCmtDNA, complete genomes (16760–16793 bp) yielded a messy network with many reticulations, presumably due to homoplastic repeat sequences (data not shown). The assignment of short sequences did not always correspond, even coarsely, to the results from the nearly complete mtDNA (Dataset 3, Table 1). For example, one bear from Arkhangelsk oblast grouped together with two Finnish bears in the 1942 bp dataset (Fig. S1b, haplotype 13), whereas the same bears were placed into different haplogroups based on the NCmtDNA dataset: the bear from Arkhangelsk oblast was placed into haplogroup C (Fig. 1, haplotype 13b). REFERENCE Yu, L., Li, Y.W., Ryder, O.A. & Zhang, Y.P. (2007) Analysis of complete mitochondrial genome sequences increases phylogenetic resolution of bears (Ursidae), a mammalian family that experienced rapid speciation. BMC Evolutionary Biology, 7, 198. 4 Table S1 Data for 95 brown bear samples and mitogenomes used in different analyses No. GenBank no.1 Haplotype designations for four different datasets 2 3 4 5 257 bp 1942 bp NCmtDNA Coding Groups6 1 1 (HQ685901) Orange 2 2a 2a NEst 2 2 (HQ685902) Orange 2 2a 2a NEst 3 2 (HQ685902) Orange 2 2a 2a NEst 4 2 (HQ685902) Orange 2 2a 2a NEst 5 1 (HQ685901) Orange 2 2a 2a NEst 6 3 (HQ685903) Light blue Light blue Light blue Light blue NEst 7 4 (HQ685904) Orange 2 2a 2a NEst 8 2 (HQ685902) Orange 2 2a 2a SEst 9 5 (HQ685905) Orange 2 2a 2a NEst 10 6 (HQ685906) Orange 2 2a 2a SEst 11 7 (HQ685907) Orange 2 2b 2b NEst 12 8 (HQ685908) Orange 2 2a 2a NEst 13 2 (HQ685902) Orange 2 2a 2a NEst 14 9 (HQ685909) Orange 2 3a 3a+3c SEst 15 9 (HQ685909) Orange 2 3a 3a+3c SEst 16 2 (HQ685902) Orange 2 2a 2a NEst 17 10 (HQ685910) Orange 2 2a 2a NEst 18 11 (HQ685911) Orange 2 2a 2a NEst 19 2 (HQ685902) Orange 2 2a 2a NEst 20 2 (HQ685902) Orange 2 2a 2a NEst 21 2 (HQ685902) Orange 2 2a 2a NEst 22 12 (HQ685912) Light blue Light blue Light blue Light blue NEst 23 2 (HQ685902) 2a NEst 24 12 (HQ685912) Light blue Light blue Light blue Light blue NEst 25 9 (HQ685909) Orange 3 3a 3a+3c SEst 26 9 (HQ685909) Orange 3 3a 3a+3c SEst Orange 2 2a 5 27 13 (HQ685913) Orange 3 3a 3a+3c SEst 28 4 (HQ685904) Orange 2 2a 2a SEst 29 6 (HQ685906) Orange 2 2a 2a NEst 30 14 (HQ685914) Orange 2 2c 2c NEst 31 2 (HQ685902) Orange 2 2a 2a NEst 32 12 (HQ685912) Light blue Light blue Light blue Light blue SEst 33 5 (HQ685905) Orange 2 2a 2a NEst 34 1 (HQ685901) Orange 2 2a 2a NEst 35 1 (HQ685901) Orange 2 2a 2a NEst 36 15 (HQ685915) Orange 3 3c 3a+3c NEst 37 16 (HQ685916) Orange 1 1e2 1e2 WRus 38 17 (HQ685917) Orange 12 12 12 WRus 39 18 (HQ685918) Orange 12 12 12 WRus 40 19 (HQ685919) Orange 1 1e1 1e1 WRus 41 20 (HQ685920) Orange 1 1e1 1e1 WRus 42 21 (HQ685921) Orange 12 12 12 WRus 43 22 (HQ685922) Orange 1 1e1 1e1 WRus 44 22 (HQ685922) Orange 1 1e1 1e1 WRus 45 23 (HQ685923) Orange 3 3b 3b WRus 46 18 (HQ685918) Orange 12 12 12 WRus 47 24 (HQ685924) Orange 12 12 12 WRus 48 22 (HQ685922) Orange 1 1e1 1e1 WRus 49 25 (HQ685925) Orange 1 1b 1b WRus 50 26 (HQ685926) Orange 1 1a2 1a2 WRus 51 27 (HQ685927) Orange 4 4 4 NRus 52 54 (HQ685954) Orange 3 3a 3a+3c WRus 53 28 (HQ685928) Orange 13 13b 13b+1c1 NRus 54 29 (HQ685929) Black Black Black Black NRus 55 30 (HQ685930) Orange 5 5b 5b NRus 6 56 31 (HQ685931) Black Black Black Black NRus 57 30 (HQ685930) Orange 5 5b 5b NRus 58 32 (HQ685932) Orange 5 5a 5a NRus 59 32 (HQ685932) Orange 5 5a 5a NRus 60 33 (HQ685933) Orange 1 1e3 1e3 NRus 61 34 (HQ685934) Orange 1 1d 1d NRus 62 33 (HQ685933) Orange 1 1e3 1e3 NRus 63 35 (HQ685935) Orange 11 11 11 NRus 64 36 (HQ685936) Orange 11 11 11 NRus 65 37 (HQ685937) Orange 1 1c1 13b+1c1 ERus 66 38 (HQ685938) Orange 6 6 6 ERus 67 39 (HQ685939) Orange 1 1c1 13b+1c1 ERus 68 40 (HQ685940) Orange 7 7 7 ERus 69 41 (HQ685941) Orange 9 9 9 ERus 70 42 (HQ685942) Red Red Red Red ERus 71 43 (HQ685943) Orange 1 1c3 1c3 ERus 72 44 (HQ685944) Orange 1 1c2 1c2 ERus 73 45 (HQ685945) Orange 7 7 7 ERus 74 46 (HQ685946) Orange 10 10 10 ERus 75 39 (HQ685939) Orange 1 1c1 13b+1c1 ERus 76 47 (HQ685947) Orange 1 1a5 1a5 WRus 77 48 (HQ685948) Orange 1 1a4 1a4 WRus 78 49 (HQ685949) Orange 1 1e1 1e1 WRus 79 50 (HQ685950) Orange 1 1a1 1a1 CRus 80 51 (HQ685951) Orange 1 1a4 1a4 CRus 81 52 (HQ685952) Orange 1 1a4 1a4 CRus 82 53 (HQ685953) Orange 1 1a1 1a1 CRus 83 55 (HQ685955) Orange 8 8 8 NFin 84 56 (HQ685956) Orange 8 8 8 SFin 7 85 57 (HQ685957) Blue Blue Blue Blue NFin 86 56 (HQ685956) Orange 8 8 8 SFin 87 57 (HQ685957) Blue Blue Blue Blue SFin 88 58 (HQ685958) Orange 1 1a3 1a3 SFin 89 59 (HQ685959) Orange 8 8 8 SFin 90 60 (HQ685960) Green Green Green 13+green NFin 91 61 (HQ685961) Orange 1 1a3 1a3 SFin 92 62 (HQ685962) Orange 13 13 13+green NFin 93 61 (HQ685961) Orange 1 1a3 1a3 SFin 94 63 (HQ685963) Orange 13 13 13+green NFin 95 64 (HQ685964) Orange 5 5c 5c SFin 1 Haplotype numbers in GenBank annotation derived from complete mtDNA (Dataset 5, see Table S3) 2 Control region (see also Table S3 and Fig. S1a) 3 Control region and CYTB (see also Table S3 and Fig. S1b) 4 Nearly complete mtDNA (16686–16689 bp): complete mtDNA with homoplastic sequences removed, i.e Dataset 3 (see Table S3, Fig. 1, Materials and Methods) 5 Complete protein-coding dataset (11406 bp, see Table S3 and Fig. S5) 6 Names of regions used in spatial diffusion analysis; Estonia = North-Estonia (NEst, n = 27, Lääne-Virumaa, Ida- Virumaa, Raplamaa, Järvamaa, Jõgevamaa) and South-Estonia (SEst, n = 9, Pärnumaa, Viljandimaa, Tartumaa, Põlvamaa), Finland = North-Finland (NFin, n = 5, Oulu and Lapland provinces) and South-Finland (SFin, n = 8, Southern Finland, Western Finland and Eastern Finland provinces). European Russia: Northern (NRus, n = 13), Western (WRus, n = 18), Central (CRus, n = 4) and Eastern Russia (ERus, n = 11). See also Fig. 3. 8 Table S2 Primers for PCR and sequencing of complete mtDNA of brown bears Primer pair no. Primer sequence (5' to 3') Position* Size of PCR product 1 F - ACAACCAGTAGAACATCCCTT R - TGGCACGAAATTAACCAA 15188–15208 300–317 1800 bp 2 F - CATAAAGGTTTGGTCCTAG R - CAAGTTGATATGGGTGTTG 67–85 1646–1664 1598 bp 3 F - GCCTGGTGATAGCTGGTT R- CTGCGATAGGTTGTAGGAGAC 1439–1456 2885–2905 1467 bp 4 F - AGCCCGGTGATTGCATAA R - TGGACGGTGAGATTTGGT 2691–2708 4347–4364 1674 bp 5 F - CGCATCCATGCTCCTGAT R - ATGGTGGCAGCAACCAGA 4114–4131 5651–5668 1555 bp 6 F - ATTGGCACTCTTTACCTTCT R - GTGGTTATGATATTGGCTTG 5389–5408 6926–6945 1557 bp 7 F - ATCCAGATGCCTATACAACA R - TTACGAGTATCGGGATTAGA 6674–6693 8356–8375 1702 bp 8 F - AACTAATCTTCTGGGTCTATTA R - GTTTGTGATGCTCAGGGA 8191–8212 9706–9723 1533 bp 9 F - TCTATTGATGAGGGTCCTG R - GATTATTAAGGCTGTTGCTC 9395–9413 11119–11138 1744 bp 10 F - ACAAGTTCTATCTGCCTACG R - CGGATTAGAAGAAATACCC 11001–11020 12530–12548 1548 bp 11 F - AACATGAAAACCTTAACA R - ATGGCCACTGAGCAGTAT 12377–12394 13859–13876 1500 bp 12 F - ACTGTATAAAGCCGCAATC R - GTCTTAGGGAGGGTAGGTA 13652–13670 15359–15377 1726 bp F - TTCCAATCCTACTAACCCTTC 15823–15843 812 bp R - CATGCCTGTGATTACAGTGAT 16614–16634 *Positions are according to HQ685901 (Table S1); **This is an additional primer pair used occasionally to double-check part of the control region if an equivocal sequence was obtained using the original primers; F – forward primer; R – reverse primer 13** 9 Table S3 Population genetic statistics of different mtDNA datasets (n = 95) Dataset Length (bp) h 1. 257 bp 257 2. 1942 bp 1942 Hd (SD) (SD) V S PI k 6 0.199 (0.055) 0.00097 (0.0003) 6 2 4 0.249 18 0.839 (0.024) 0.00094 (0.0001) 21 6 15 1.816 3. NCmtDNA* 16686–16689 37 0.923 (0.02) 0.00075 (0.00003) 117 32 85 12.501 4. Coding** 11406 34 0.92 (0.02) 0.00092 (0.00004) 90 25 65 10.511 5. CmtDNA*** 16760–16793 64 0.969 (0.01) 0.00097 (0.00004) 132 32 100 16.213 h, number of haplotypes; Hd, haplotype diversity; SD, standard deviation; , nucleotide diversity; V, total number of variable sites; S, singletons; PI, parsimony-informative sites; k, average number of nucleotide differences. *NCmtDNA denotes “nearly complete mtDNA”, with TC-tracks, TAC-CGT replacements and tandem repeats removed from the complete genome due to homoplasy (see Materials and Methods); **Coding – all protein-coding genes concatenated; ***Complete mtDNA – full-length mtDNA sequences. See Materials and Methods for detailed information about datasets. 10 Table S4 Molecular diversity indices for different regions of brown bear mtDNA (n = 95 mitogenomes) Sequence* Length (bp) Hd (SD) (SD) V S PI I tRNA-Phe 68 0 0 0 0 0 0 12S rRNA 962-963 0.196 (0.053) 0.00021 (0.00006) 3 1 2 1 tRNA-Val 66 0.082 (0.038) 0.00124 (0.00057) 1 0 1 0 16S rRNA 1579 0.618 (0.040) 0.00047 (0.00004) 5 0 5 0 tRNA-Leu 75 0.042 (0.028) 0.00056 (0.00038) 1 0 1 0 ND1 957 0.387 (0.063) 0.00045 (0.00008) 6 1 5 0 tRNA-Ile 70 0.021 (0.021) 0.0003 (0.00029) 1 1 0 0 tRNA-Gln** 73 0 0 0 0 0 0 tRNA-Met 69 0 0 0 0 0 0 ND2 1044 0.264 (0.056) 0.00031 (0.00008) 5 3 2 0 tRNA-Trp 68 0 0 0 0 0 0 tRNA-Ala** 69 0 0 0 0 0 0 tRNA-Asn** 73 0 0 0 0 0 0 tRNA-Cys** 67 0.042 (0.028) 0.00062 (0.00042) 1 0 1 0 tRNA-Tyr** 67 0.12 (0.044) 0.0018 (0.00065) 1 0 1 0 COX1 1545 0.784 (0.026) 0.00082 (0.00007) 8 3 5 0 tRNA-Ser** 72-74 0 0 0 0 0 2 tRNA-Asp 67 0 0 0 0 0 0 COX2 684 0.598 (0.037) 0.001 (0.0001) 6 4 2 0 tRNA-Lys 68 0 0 0 0 0 0 ATP8 204 0.121 (0.045) 0.0006 (0.0002) 2 1 1 0 ATP6 681 0.542 (0.044) 0.00095 (0.0001) 4 0 4 0 COX3 784 0.379 (0.06) 0.001 (0.0002) 5 0 5 0 11 tRNA-Gly 69 0 0 0 0 0 0 ND3 346 0.042 (0.028) 0.00012 (0.00008) 1 0 1 0 tRNA-Arg 69 0 0 0 0 0 0 ND4L 297 0.671 (0.021) 0.003 (0.00021) 4 1 3 0 ND4 1378 0.739 (0.043) 0.001 (0.0001) 13 3 10 0 tRNA-His 69 0.021 (0.021) 0.00031 (0.0003) 1 1 0 0 tRNA-Ser 59 0.062 (0.034) 0.001 (0.00059) 2 1 1 0 tRNA-Leu 70 0 0 0 0 0 0 ND5 1821 0.812 (0.026) 0.0012 (0.0001) 19 5 14 0 ND6** 528 0.452 (0.058) 0.001 (0.00018) 7 1 6 0 tRNA-Glu** 69 0.042 (0.028) 0.0006 (0.0004) 1 0 1 0 CYTB 1140 0.735 (0.031) 0.001 (0.00009) 10 3 7 0 tRNA-Thr 70 0 0 0 0 0 0 tRNA-Pro** 65 0 0 0 0 0 0 Control region 1317-1350 0.835 (0.022) 0.00329 (0.00025) 25 3 22 35 0.358 (0.00401) 0.0005 (0.00011) 10 3 7 0 Control region*** 1244 *for position numbers, see the reference sequence HQ685901 in GenBank (Table S1); **genes coded by complementary strand; ***shorter control region (NCmtDNA); Hd, haplotype diversity; SD, standard deviation; , nucleotide diversity; V, total number of variable sites; S, singletons; PI, parsimony-informative sites; I, indels 12 Table S5 Relative contribution of different mitochondrial genes (and the shortened control region) to the NCmtDNA network (Fig. 1). In the NCmtDNA and haplogroup columns the first value represents the number of mutations in a particular gene, and the second value is the number of mutations in a particular gene expressed as a percentage of the number of mutations in the whole network (NCmtDNA) or in a particular haplogroup (A-E). The mitochondrial genes contributing most to the NCmtDNA network are shown in bold red. Total = number of mutations for the whole NCmtDNA network and for different haplogroups. Sequence* tRNA-Phe 12S rRNA tRNA-Val 16S rRNA tRNA-Leu ND1 tRNA-Ile tRNA-Gln** tRNA-Met ND2 tRNA-Trp tRNA-Ala** tRNA-Asn** tRNA-Cys** tRNA-Tyr** COX1 tRNA-Ser** tRNA-Asp COX2 tRNA-Lys ATP8 ATP6 COX3 tRNA-Gly ND3 tRNA-Arg ND4L ND4 tRNA-His tRNA-Ser tRNA-Leu ND5 ND6** tRNA-Glu** CYTB tRNA-Thr tRNA-Pro** Control region (shorter) Total Length (bp) NCmtDNA 68 962-963 66 1579 75 957 70 73 69 1044 68 69 73 67 67 1545 72-74 67 684 68 204 681 784 69 346 69 297 1378 69 59 70 1821 528 69 1140 70 65 1244 4/3.3 1/0.8 5/4.2 1/0.8 6/5 1/0.8 5/4.2 1/0.8 1/0.8 8/6.7 2/1.7 6/5 2/1.7 4/3.3 5/4.2 1/0.8 4/3.3 13/10.8 1/0.8 2/1.7 19/15.8 7/5.8 1/0.8 10/8.3 10/8.3 120 13 A 1/3.6 2/7.1 2/7.1 2/7.1 2/7.1 1/3.6 5/17.9 3/10.7 2/7.1 2/7.1 2/7.1 4/14.3 28 Haplogroups B C D E 3/5 1/8.3 1/1.7 1/8.3 3/5 1/1.7 2/3.3 2/22.2 1/1.7 1/8.3 2/16.7 1/1.7 1/1.7 1/8.3 3/5 1/8.3 1/8.3 3/5 2/16.7 2/3.3 2/16.7 2/3.3 1/11.1 1/1.7 2/3.3 2/16.7 6/10 1/8.3 1/1.7 2/3.3 2/16.7 11/18.3 1/11.1 3/25 3/5 2/22.2 1/1.7 2/16.7 5/8.3 1/8.3 5/8.3 3/33.3 1/8.3 12 60 9 12 Table S6 Relative contribution of different mitochondrial genes (and the control region) to the NCmtDNA network (Fig. 1) normalized in relation to gene length. Contribution values were calculated as follows: the number of mutations in a particular gene was divided by a number of mutations in the whole network (NCmtDNA) or in a particular haplogroup (A–E), which was then subsequently divided by gene-length (and multiplied by 100). The mitochondrial genes contributing most to the NCmtDNA network are shown in bold red. Total = number of mutations for the whole NCmtDNA network and for different haplogroups Sequence* tRNA-Phe 12S rRNA tRNA-Val 16S rRNA tRNA-Leu ND1 tRNA-Ile tRNA-Gln** tRNA-Met ND2 tRNA-Trp tRNA-Ala** tRNA-Asn** tRNA-Cys** tRNA-Tyr** COX1 tRNA-Ser** tRNA-Asp COX2 tRNA-Lys ATP8 ATP6 COX3 tRNA-Gly ND3 tRNA-Arg ND4L ND4 tRNA-His tRNA-Ser tRNA-Leu ND5 ND6** tRNA-Glu** CYTB tRNA-Thr tRNA-Pro** Control region (shorter) Total Haplogroups B C D 8.7 42.1 44 5.3 37.0 5.8 258 39.7 66.5 41.5 41.5 44.9 5.4 101.5 12.2 27.2 203.9 8.2 181.3 8.0 18.7 100.8 12.1 40.3 94.2 76.3 16.8 67.8 15.8 467.6 40.3 121.8 12.2 - Length (bp) NCmtDNA 68 962-963 66 1579 75 957 70 73 69 1044 68 69 73 67 67 1545 72-74 67 684 68 204 681 784 69 346 69 297 1378 69 59 70 1821 528 69 1140 70 65 3.5 12.6 2.6 11.1 5.2 11.9 3.9 12.4 12.4 4.3 22.8 7.9 8.2 4.9 5.3 2.4 11.2 7.9 12.1 28.2 8.7 11.1 12.1 7.3 - A 8.1 26.7 24.4 16.5 349.5 18.6 81.3 27.8 14.0 48.3 22.4 - 1244 6.7 41.0 - 11.2 297.7 55.8 120 28 12 60 9 12 14 E 72.1 133 44.9 203.1 50.4 114.4 60.9 - Figure S1 Phylogeographic relationships between brown bears in north-western Eurasia (n = 95) based on two mtDNA datasets: (a) 257 bp; (b) 1942 bp (see Table S3). A separate colour is assigned to each haplotype in (b), with the colours corresponding to those in (a); e.g. an orange haplotype in (b) represents an individual that was assigned to the large central haplotype (also orange) in (a). Note that: (1) on networks the sample sizes for haplotypes are presented inside the symbols (small numbers in italic) and the haplotype numbers are beside the symbols (large numbers in bold); (2) on maps the sample sizes are not presented, and the haplotype numbers are inside the points. 15 Figure S2 Relationships between sequence length and the number of parsimony-informative sites (PIS), the average number of nucleotide differences (k) and the haplotype diversity (Hd) (see also Table 1). Asterisks denote parameters multiplied by a factor of ten. 16 Figure S3 NCmtDNA network with defining mutations (i.e. Dataset 3, Table S3). Five haplogroups (A–E) are shown. The colours and numbering of haplotypes follows that in Fig. 1. 17 Figure S4 Bayesian phylogenetic tree of brown bear haplotypes based on 95 nearly complete mitochondrial sequences (Dataset 3, see Tables S1 & S3). Haplogroup names (A–E) and colours correspond to those in Fig. 1. 18 Figure S5 Median-joining network of brown bears in north-western Eurasia (n = 95) based on complete protein-coding sequences (i.e. Dataset 4, Table S3). Compared to the nearly complete mtDNA (i.e. Dataset 3 in Table S3; Fig. 1), the same five haplogroups (A–E) are defined, although the lengths of several branches are shorter here and three haplotypes are missing (not diverged owing to a smaller number of characters; shown with red arrows). The colours and numbering of haplotypes follow that in Fig. 1. 19