Download Functional Importance of RASSF1A Microtubule

Functional Importance of RASSF1A Microtubule Localization and Polymorphisms*
Mohamed EL-Kalla, Christina Onyskiw and Shairaz Baksh#
#Department of Pediatrics, Faculty of Medicine and Dentistry, University of Alberta,
Edmonton, AB, Canada, T6G 2N8
Running title: RASSF1A microtubule localization and polymorphisms
Supplemental Material
Supplemental Experimental Procedures
Antibodies and Reagents
Anti-Annexin-V Alexa Fluor 647 were obtained from Molecular Probes. Rabbit anti-Erk1/Erk2 (sc-93/sc154), rabbit anti-14-3-3 (sc-629), mouse anti-GFP (sc-9996), rabbit anti-TNF-R1 (sc-7895), goat anti-TRAIL
R1 (AF-347, R&D), rabbit anti-PARP (Cell Signaling, #9542), rabbit anti-RASSF1A (M304 from Dr. Gerd
Pfiefer) and human TNF and TRAIL (300-014 and 310-04, respectively from Peprotech) were purchased
from the indicated commercial sources. Murine monoclonal anti-HA (12CA5) and anti-Myc (9E10) were
purified from their corresponding in house hybridomas; mouse anti--tubulin (Santa Cruz, sc-8035); rabbit
anti--tubulin (Santa Cruz, sc-10732); mouse anti--tubulin (Sigma, T3559); mouse anti-acetylated -tubulin
(Cell signaling, Sigma T7451). Nocodazole, colchine, and taxol were obtained from Calbiochem. In house
ECL detection was used for all immunostaining analysis.
Cell Lysis and Immunoprecipitations
Unless otherwise indicated, cells were stimulated with 50 ng/ml TNF or TRAIL, followed by “SB” lysis
buffer containing 50 mM HEPES (pH 7.5), 150 mM NaCl, 1 mM MgCl2, 1.5 mM EDTA, 0.5% Triton X-100,
20 mM -glycerolphosphate, 100 mM NaF, 0.1 mM PMSF. TNF-R1 immunoprecipitations were carried out
using 1.5 µg of rabbit anti-TNF-R1 antibody; TRAIL-R1 immunoprecipitations were carried out overnight
with 1.0 µg of goat anti-TRAIL R1; and immunoprecipitations for HA and Myc-tagged proteins were carried
out with 20 l of our in house hybridoma supernatant. For all whole cell lysate (WCL) immunoblots, 10% of
input was used (~ 70 µg of protein/lane).
Expression Vectors
Expression vectors for GFP-RASSF1A, HA-RASSF1A and Myc-MOAP-1 were generated as previously
described (26,27). All HA and Myc tagged proteins contained single tags at their amino termini. For
RASSF1A deletion mutants, all were cloned into pCDNA3-HA expression vector using Bam H1/Not1
restriction sites: for 128 - 340, 5' primer was cagtgcggatccatcgatgacctttctcaagct and 3’ primer was
tatgcggccgctattcacccaagggggcaggc; for 139 - 340, 5' primer was cagtgcggatccatcgatatcaaggagtacaat and 3’
primer was the same as 128 - 340; for 1 - 300, 5’ primer was cagtgccatatgatcgatatgtcgggggagcct and 3’ primer
was tatgcggccgctattcattcaggcatgctgaa. All RASSF1A expression constructs containing microtubule mutant
and polymorphisms were generated by PCR using the Quickchange site directed mutagenesis kit (Stratagene)
following manufacturers instructions and with the indicated primers. For RASSF1A MT mutant, primers
were tgggagacacctgaccttgagcagaagatcaag for 131SQAEI deletion and ctacgtatcctgcagcgggagcgccagatcctg for
300ELHNFL deletion. For C65R, primer was gccacgcacacgtggagggacctctgtggcgac; A133S, primer was
gacacctgacctttctcaatccgagattgagcagaagtc; E246K, primer was: gcaagtttgcactctttaagcgcgctgagcgtcacggcc.
Further details on the generation of other constructs are available from S.B. upon request. All expression
constructs were confirmed by sequencing.
Immunoblotting
Protein samples were resolved on 10% SDS-PAGE and then transferred to polyvinylidene fluoride (PVDF)
membranes (Millipore, Bedford, MA). Membranes were blocked by incubation with 10% (w/v) skim milk
powder in TBS-T solution (5M NaCl, 1M Trizma [Tris base], and 0.05% Tween 20, pH 7.4), followed by
incubation overnight at 4°C with primary antibodies diluted in 2% (w/v) skim milk powder in TBS-T solution.
Following incubation, membranes were washed 3 X 5 min washes with TBS-T solution and incubated with the
appropriate secondary horseradish peroxidase-conjugated secondary antibodies diluted in 2% (w/v) skim milk
powder in TBS-T solution for 2 hours at room temperature. Following 3 X 5 min washes with TBS-T solution
the immunoblot was exposed to chemiluminescence reagents, ECL (GE Healthcare UK Ltd, Buckinghamshire,
UK) and developed on Super RX Fuji medical x-ray film (FUJIFILM Corporation, Tokyo, Japan). Where
necessary, membranes were stripped of antibodies using the buffer (52mM Trizma [Tris base], 2% SDS and
143mM β-mercaptoethanol) for 30 min at 60°C, followed by 2 X 15 min washes with TBS-T solution before
membrane blocking and incubation with primary antibody overnight.
Cells Lines and Transfection
COS-1 and U2OS cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) plus 10% bovine
growth serum (BGS); the non-small cell lung cancer cell line, H1299, cells were maintained in RPMI medium
plus 10% BGS; the colon cancer cell line, HCT116, was maintained in McCoy’s 5A/10% BGS. All cells were
maintained in a 37 oC/5% CO2 incubator. To generate stable H1299 cells, transfections were carried out using
the linear 25 kDa polymer, polyethyleneimine (PEI) obtained from Polysciences, USA (Catalog #23966-2).
PEI transfections were carried out by mixing PEI/DNA in a ratio of 4 l PEI/1 g DNA (for COS-1, U2OS, or
HCT116 cells) or 5 l PEI/1 g DNA (for H1299 cells) in 400 l of serum-free DMEM (for transfection in a 6
well dish) as described elsewhere (Foley et al., 2008). Transfection efficiencies were between 50 and 70% for
the cells lines used in this study. Further details are available from S.B. upon request.
Cell death assays
Human TNF or TRAIL were added together with 10 µg/ml cyclohexamide (CHX) for the indicated times
and Annexin V staining analysis was carried out as previously described (Baksh et al., 2005). All apoptosis
assays were performed at least six times. Data for all immunofluorescence and apoptosis assays were
evaluated by Student's t-test (two-tailed), unless otherwise stated.
Cell cycle arrest and release
Cells were treated with either 2 M nocodazole (for M-phase arrest) or 750 M hydroxyurea (for S-phase
arrest) overnight followed by a release from arrest by washing out either nocodazole or hydroxyurea by
changing to media without these drugs. Cell cycle phases were confirmed by FACS analysis using a FASC
Caliber (Beckman/Coulter).
Subcutaneous injection of tumor cells-HCT116 colon cancer cells transiently transfected with the indicated
expression constructs. After 48 h, cells were trysinized and spun down at 1000 rpm for 5 min and resuspended
in a 2:1 mix of media:matrigel (BD #354234, 10 mg/ml of LDEV-free matrix). Two hundred microlitres
(containing ~ 3 X 106 cells) of this mixture was subcutaneously injected into the right and left flanks of
athymic nude mice (Taconic Laboratories #NCRNU-M, CrTac:NCr-FoxN1Nu) in order to determine tumor
promoting potential of the RASSF1A wild type and mutants. Mice were monitored weekly until tumors
appear and mice euthanized once tumors exceed 20 mm diameter.
Surface staining of TNF-R1-Stable cells containing either HA-RASSF1A WT or MT mutant were generated
and stimulated with TNF. Surface TNF-R1 expression was assessed using antibodies against its extracellular
domain (mouse anti-TNF-R1, sc-8436 [Santa Cruz Biotechnology]). Cells were harvested by scraping into 1
X PBS, washed once with 1 X PBS, followed by the addition of primary antibodies (100 µl solution of 3 µg/ml
antibody in 1 X PBS + 3 % FBS) for 30 min on ice. Cells were then washed twice with 1 X PBS, followed by
the addition of rabbit anti-mouse Alexa 546 secondary antibody (Molecular Probes, 1:200 in same solution as
primary antibody) for 30 min on ice. Staining with secondary antibodies alone was used as a negative control.
After secondary antibody staining, cells were washed twice with 1 X PBS and then analyzed by FACS analysis
to determine the amount of TNF-R1 remaining on the surface following TNF stimulation. All experiments
were carried out at least four times using single clones and pools of the stable cell lines with similar results.
Supplemental Legends
Supplemental Figure 1 Cell cycle profile using hydroxurea arrest and release. U2OS cells were left untreated
(asynchronous cells) or treated with hydroxyurea for 16 h followed by release from arrest by adding fresh
media to the cell. Release was allowed for the indicated times and FACS analysis carried out to confirm cell
cycle profile following arrest and release. Numbers indicated percentage of cells within each given
population.
Supplemental Figure 2 Characterization of RASSF1A polymorphisms. (a) HCT116 cells were transfected
with the indicated expression constructs and imaged on a confocal microscope to determine cellular
localization. About 75 – 100 cells were counted and percentage of nuclear staining is graphed. The
experiment was repeated three times. Vector control cells did not stain with the anti-HA antibody and wild
type RASSF1A revealed 0% nuclear localization. IF, immunoflourescence. (b) Quantitation of acetylated tubulin bands in Figure 6f. p value for differences between WT and C65R under asynchronous conditions was
< 0.04 and < 0.004 for nocodazole treatment; p value for differences between WT and A133S under
asynchronous conditions was < 0.05 and < 0.03 for nocodazole treatment; no significant differences were
observed between WT and E246K under any of the conditions tested. All analyses were determined by
Student’s T-test. (c and d) HA tagged RASSF1A wild type (WT) or RASSF1A polymorphisms were
ectopically expressed in HCT116 cells followed by self association with GFP-RASSF1A (c) or association
with 14-3-3 (d). Associated RASSF1A was recovered by immunoprecipitation (IP) with the indicated
antibodies and recovered proteins were separated by SDS-PAGE and immunoblotted (IB) as indicated. (e)
HA-RASSF1A WT (WT) or C65R mutant of RASSF1A were ectopically expressed in U2OS cells and
associated TNF/CHX-evoked PARP cleavage (see IB: Anti-PARP) was detected using an anti-PARP
antibody in order to detect full length PARP (p116PARP) and cleaved PARP (p85 PARP). Also indicated are
expression levels for HA-RASSF1A and anti-Erk1/2 immunoblotting as loading controls. (f) HA tagged
RASSF1A WT or MT proteins were ectopically expressed in U2OS cells followed by immunoprecipitation
(IP) with a pan specific 14-3-3 antibody and recovered proteins were separated by SDS-PAGE and
immunoblotted (IB) as indicated.
Supplemental Figure 3 (a) Male athymic nude mice were purchased at 6 – 8 weeks of age from Taconic
Laboratories and used in tumorigenicity experiments as outlined in Fig. 7. For each expression construct 3
animals were injected on both flanks to give 6 measures of tumor growth and significance was evaluated by
either Student’s T-test (two-tailed). p values between C65R and C98A (< 0.03); between C65R and
C101A/C102A (< 0.6). (b) HCT116 cells were transfected with the indicated expression constructs and cells
maintained in culture for the indicated times. At the indicated times, cells were harvested, lysed in SB lysis
buffer and then prepared for immunoblotting as indicated. Top anti-HA immunoreactive band in all panels is a
non-specific band. Anti-Erk1/2 immunoblotting was used as a loading control for the HA-immunoblot. (c)
Stable U2OS cells containing either vector control, RASSF1A WT or MT expression constructs were grown
to confluency in a 6 well dish followed by scratching of the center of the well using a pipet tip to “wound” the
cells. After the indicated time points, the image was captured to reveal the speed of migration of these cells
following wounding. Right panel, expression of proteins in the stable U2OS cells used in (c).