• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
p53, the Cellular Gatekeeper Review for Growth and Division
p53, the Cellular Gatekeeper Review for Growth and Division

... Product of an oncogene; inactivates p53-mediated transcription and so forms an autoregulatory loop with p53 activity GADD45 Induced upon DNA damage; binds to PCNA and can arrest the cell cycle; involved directly in DNA nucleotide excision repair Cyclin G A novel cyclin (it does not cycle with cell d ...
Mutant Mice and Neuroscience: Viewpoint Recommendations
Mutant Mice and Neuroscience: Viewpoint Recommendations

... chromosomes) to C57BL/6 animals (black chromosomes), an F1 generation of genetically identical hybrid heterozygotes is produced. Depending on the nature of the targeted allele (M), these animals may be suitable for study. Intercrossing the F1 heterozygotes will generate the first homozygotes for the ...
Rapid generation of nested chromosomal
Rapid generation of nested chromosomal

... Deletion endpoints can provide a starting point for the positional cloning of genes (2). All of these uses have been beautifully exemplified by a set of nested deletions over the albino locus on mouse chromosome 7, which has been used to define essential genes, conduct mutagenesis, and map and clone ...
Plasmids
Plasmids

Supporting Information Legends Supporting Figure 1. Amino acid
Supporting Information Legends Supporting Figure 1. Amino acid

... (A) Schematic diagrams of the AGO2 and the mutated AGO2 genes. The first half of the AGO2 genes is indicated. The black horizontal lines above or below the AGO2 diagrams correspond to the regions amplified by genomic PCR. The location of the AGO2 5th intron probe is indicated with double lines. PstI ...
Microbial Genetics - University of Montana
Microbial Genetics - University of Montana

... The T-odd phages fall into three serological groups: T3 and T7 are related to each other but not to T1 or to T5, which are unrelated. The T7 genome was sequenced in 1983; it is 39,937 bp in length ...
Regulation of Stage I1 of Sporulation in Bacillus subtilis
Regulation of Stage I1 of Sporulation in Bacillus subtilis

... was then removed from plasmid pUC7IIG with EcoRI, which cleaved sites in the polylinker of pUC7, and cloned into phage DI :1t (Flock, 1977). Selection of phage $lOSIIG from the bank of recombinant phages was essentially as described elsewhere (Jenkinson & Mandelstam, 1983; Errington, 1984). The resu ...
DROSOPHILA: GENETICS MEETS BEHAVIOUR
DROSOPHILA: GENETICS MEETS BEHAVIOUR

Regulation of Stage I1 of Sporulation in Bacillus subtilis
Regulation of Stage I1 of Sporulation in Bacillus subtilis

... was then removed from plasmid pUC7IIG with EcoRI, which cleaved sites in the polylinker of pUC7, and cloned into phage DI :1t (Flock, 1977). Selection of phage $lOSIIG from the bank of recombinant phages was essentially as described elsewhere (Jenkinson & Mandelstam, 1983; Errington, 1984). The resu ...
Development of Male and Female Reproductive System
Development of Male and Female Reproductive System

... conjunction with the autosomal gene SOX9 a transcription regulator also inducing testes differentiation SOX9 binds the promoter region of the gene for antimullerian hormone/mullerian inhibiting substance (AMH, MIH) regulating this genes expression At the begining SRY and/or SOX9 induce the testes to ...
Discussion S1.
Discussion S1.

... (1) and which we have estimated to be in the range of 77% in our study. Integration of several datasets is the first choice to increase the coverage as has been recently demonstrated by our group (2). Here, we present an integrated network of DNA metabolism for T. pallidum, which is solely based on ...
A Novel Two Domain-Fusion Protein in Cyanobacteria with
A Novel Two Domain-Fusion Protein in Cyanobacteria with

... All cyanobacteria examined to date have multiple hli genes (Bhaya et al., 2002; He et al., 2001; Steglich et al., 2006), but they have also been identified on the chloroplast genomes of the red algae Porphyra yezoensis (HYP_537036.1) Hand Cyanidium caldarium (Q9TM07) (Glockner et al., 2000), the gla ...
The influence of genomic imprinting on brain
The influence of genomic imprinting on brain

... humans or mice (Bartolomei & Tilghman, 1997). By 1999, more than 25 imprinted genes had been identified in humans, and estimates based on the mouse genome suggest that 100–200 imprinted genes may exist (see Table 1 in Falls, Pulford, Wylie, & Jirtle, 1999; Morison & Reeve, 1998). Imprinting has also ...
PINK1- and Parkin- mediated mitophagy at a glance
PINK1- and Parkin- mediated mitophagy at a glance

... protect cells under stress, are not known to function in mitophagy. Presumably, substrates involved in PINK1-mediated Parkin recruitment would be located either on the OMM or in the cytosol. For Parkin, as suggested above, it has not been fully elucidated how many proteins are subject to ubiquitylat ...
DFL1, an auxin-responsive GH3 gene homologue, negatively
DFL1, an auxin-responsive GH3 gene homologue, negatively

... between d¯1-D and wild type (Figure 5). At a relatively high concentration (10±7 M), while the growth of wildtype roots was strongly inhibited, the degree of inhibition was not so severe in d¯1-D (Figure 5). At a high concentration of IAA (10±5 M), the growth of both d¯1-D and wild-type roots were s ...
sex chromosomes
sex chromosomes

... • Differences in chromosomes are associated with difference in the way we grow. • The karyotypes of males and females are not the same Females have two large X chromosomes Males have a large X and a small Y chromosome The X and the Y chromosomes are called sex chromosomes The sex chromosomes are pla ...
Supplementary Table S1
Supplementary Table S1

Identification of lineage-specific zygotic transcripts in early
Identification of lineage-specific zygotic transcripts in early

... this transition from maternal to zygotic control is regulated (Maduro and Rothman, 2002; Newman-Smith and Rothman, 1998). Keen interest has recently centered upon identification of these target genes. However, genetic screens designed to identify these genes have to date been remarkably unsuccessful ...
The genomic landscape of chronic lymphocytic leukemia: clinical
The genomic landscape of chronic lymphocytic leukemia: clinical

... Comparing the sequences of the entire genome or known coding regions (the exome) between tumour cells and germline cells or different subsets of tumour cells (eg mutated vs unmutated IgVH) allows identification of somatic point mutations ...
glycan associated protein of Legionella (PpiA)
glycan associated protein of Legionella (PpiA)

... chain reaction (PCR) using the bio-med Thermocycler 60 (Braun, Göttingen, Germany). Primers were selected according the sequence published by Ludwig et a/.: 13 5'GCCGGATCGTTTTATAAACTGGG 3' (position 116-139) and 5'CTTGTTGCCTCATAAATAAACTCTC 3' (reverse position 639-615). Oligonucleotide synthesis was ...
w + gene is silenced in some cells
w + gene is silenced in some cells

... In yeast that has deletion of telomerase, telomeres shorten by 3 bp per generation • Eventually the chromosomes break and the cells die In humans, the levels of telomerase and cellular life-span varies between different types of cells • Most somatic cells have low expression of telomerase ...
Chapter 11 Meiosis and Genetics
Chapter 11 Meiosis and Genetics

... 6 Any Punnett square shows that 2 different genes  A assort independently B are linked C have the same alleles D are always homozygous 7 Mendel's principles of genetics apply to A plants only B animals only C pea plants only D all organisms 8 The number of chromosomes in a gamete is represented by t ...
Essential Biology 04: Genetics (HL) DNA structure review: draw and
Essential Biology 04: Genetics (HL) DNA structure review: draw and

... b. Colour in bands to show where the ‘standard’ fragments would be observed. c. What evidence is there to suggest that Nick and Rob are related? ...
CHAPTER 8
CHAPTER 8

... having too much of a gene product. In addition, monosomies may unmask rare recessive alleles that are detrimental. C22. Answer: Trisomies 13, 18, and 21 survive because the chromosomes are small and contain fewer genes compared to the larger chromosomes. Individuals with abnormal numbers of X chromo ...
CHAPTER 5 Heredity and Genetic Testing
CHAPTER 5 Heredity and Genetic Testing

... • You were diagnosed with both breast and ovarian cancer • You have a male relative diagnosed with breast cancer Giving a blood sample for genetic testing might seem like a simple and practical issue, but it can be an emotionally charged decision for you and your family. Your decision to be tested a ...
< 1 ... 106 107 108 109 110 111 112 113 114 ... 919 >

NEDD9

Neural precursor cell expressed developmentally down-regulated protein 9 (NEDD-9) is a protein that in humans is encoded by the NEDD9 gene. NEDD-9 is also known as enhancer of filamentation 1 (EF1), CRK-associated substrate-related protein (CAS-L), and Cas scaffolding protein family member 2 (CASS2). An important paralog of this gene is BCAR1.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report