Regulation of protein synthesis by insulin
... of protein synthesis by insulin is mediated primarily through phosphoinositide 3-kinase. This involves the activation of PKB (protein kinase B). In one case, PKB acts to phosphorylate and inactivate glycogen synthase kinase 3, which in turn phosphorylates and inhibits eIF2B. Insulin elicits the deph ...
... of protein synthesis by insulin is mediated primarily through phosphoinositide 3-kinase. This involves the activation of PKB (protein kinase B). In one case, PKB acts to phosphorylate and inactivate glycogen synthase kinase 3, which in turn phosphorylates and inhibits eIF2B. Insulin elicits the deph ...
Chapter 4: DNA, RNA, and the Flow of Genetic Information
... capacity of the double helix to unwind and thereby affect the interactions between DNA and other molecules. ...
... capacity of the double helix to unwind and thereby affect the interactions between DNA and other molecules. ...
CHAPTER 7 Molecular Genetics: From DNA to Proteins
... nucleic acid, is made from nucleotide monomers, and the DNA double helix consists of two polynucleotide chains. Each nucleotide consists of a sugar (deoxyribose), a phosphate group, and a nitrogen-containing base (A, C, G, or T). The sugar-phosphate backbone of the double helix was discussed in the ...
... nucleic acid, is made from nucleotide monomers, and the DNA double helix consists of two polynucleotide chains. Each nucleotide consists of a sugar (deoxyribose), a phosphate group, and a nitrogen-containing base (A, C, G, or T). The sugar-phosphate backbone of the double helix was discussed in the ...
Bacteriophage MS2 RNA
... that another important factor which leads to nonrandom codon use, may be dictated by the requirements of the translation machinery and, in particular the efficiency of codon-anticodon interaction. Indeed, several observations point to the existence of well-defined structural rules in this interactio ...
... that another important factor which leads to nonrandom codon use, may be dictated by the requirements of the translation machinery and, in particular the efficiency of codon-anticodon interaction. Indeed, several observations point to the existence of well-defined structural rules in this interactio ...
continued
... – Transcription of a gene produces a very long RNA strand that contains introns and exons – This long strand, which extends beyond the first and last exons, is often called precursor mRNA, or premRNA – More nucleotides are added at the beginning and end of the pre-mRNA molecule, forming a “cap” and ...
... – Transcription of a gene produces a very long RNA strand that contains introns and exons – This long strand, which extends beyond the first and last exons, is often called precursor mRNA, or premRNA – More nucleotides are added at the beginning and end of the pre-mRNA molecule, forming a “cap” and ...
Stress response in yeast mRNA export factor
... box proteins and shuttles between the nucleus and the cytoplasm (Snay-Hodge et al., 1998; Hodge et al., 1999). As it is usually concentrated at the cytoplasmic fibrils of NPCs where it interacts with Rat7p/Nup159p and Gle1p, Rat8p has been suggested to participate in a terminal step of mRNA export t ...
... box proteins and shuttles between the nucleus and the cytoplasm (Snay-Hodge et al., 1998; Hodge et al., 1999). As it is usually concentrated at the cytoplasmic fibrils of NPCs where it interacts with Rat7p/Nup159p and Gle1p, Rat8p has been suggested to participate in a terminal step of mRNA export t ...
short communication
... proto-oncogene c-myb (15). Moreover, there are several unusual AT islands located in the first intron of the neuronatin gene. Although the functional significance of these sites needs to be determined, there is increasing evidence indicating a regulatory role for the first intron in gene expression ...
... proto-oncogene c-myb (15). Moreover, there are several unusual AT islands located in the first intron of the neuronatin gene. Although the functional significance of these sites needs to be determined, there is increasing evidence indicating a regulatory role for the first intron in gene expression ...
Adobe PDF - CL Davis Foundation
... » Although CFTR is a ABC pump that utilizes ATP, it is considered a channel due to the rapid influx of chloride it can allow Defects in voltage-gated CLC chloride channels » Myoclonia congenita, Dent’s disease, Bartter’s disease, osteopetrosis ...
... » Although CFTR is a ABC pump that utilizes ATP, it is considered a channel due to the rapid influx of chloride it can allow Defects in voltage-gated CLC chloride channels » Myoclonia congenita, Dent’s disease, Bartter’s disease, osteopetrosis ...
Controlling Gene Expression in Bacteria
... cells all the time. These continually expressed genes are called constitutive genes. Other genes are only needed by certain cells or at specific times. The expression of these inducible genes is tightly controlled. For example, pancreas beta cells make the protein insulin by expressing the insul ...
... cells all the time. These continually expressed genes are called constitutive genes. Other genes are only needed by certain cells or at specific times. The expression of these inducible genes is tightly controlled. For example, pancreas beta cells make the protein insulin by expressing the insul ...
Teacher-submitted assessment ideas
... A. From the following DNA sequence, transcribe the information for a mRNA strand. AAGCATACGTTAAGGCGAGTAATA B. From the above resulting mRNA strand, translate the codons into its corresponding amino acid using the genetic code table supplied. ...
... A. From the following DNA sequence, transcribe the information for a mRNA strand. AAGCATACGTTAAGGCGAGTAATA B. From the above resulting mRNA strand, translate the codons into its corresponding amino acid using the genetic code table supplied. ...
NZY First-Strand cDNA Synthesis Kit
... RNA. The kit includes a combination of random hexamers and oligo(dT)18 primers in order to increase sensitivity. The primers are included in the NZYRT 2× Master Mix, which also contains dNTPs, MgCl2 and an optimized RT buffer. NZYRT Enzyme Mix includes both the NZY Reverse Transcriptase (RNase H min ...
... RNA. The kit includes a combination of random hexamers and oligo(dT)18 primers in order to increase sensitivity. The primers are included in the NZYRT 2× Master Mix, which also contains dNTPs, MgCl2 and an optimized RT buffer. NZYRT Enzyme Mix includes both the NZY Reverse Transcriptase (RNase H min ...
Exam II Review Document
... in eukaryotes to what we saw in bacteria. You should be familiar with the processes occurring in Figure 19.8. The promoter is the binding site on DNA where RNA polymerase must bind before transcription can begin. In eukaryotes, promoters are more complex than in bacteria, but many eukaryotic promote ...
... in eukaryotes to what we saw in bacteria. You should be familiar with the processes occurring in Figure 19.8. The promoter is the binding site on DNA where RNA polymerase must bind before transcription can begin. In eukaryotes, promoters are more complex than in bacteria, but many eukaryotic promote ...
Analysis of splice sites in the early region of bovine polyomavirus
... polymerase (Cetus) was added to the reaction mixtures. Amplification reactions were performed using a thermal cycler (Perkin-Elmer Cetus) according to the following procedure. After 5 min of denaturation at 95 °C, 35 amplification cycles were performed (1 min at 95 °C, 1 min at 55 °C, 2 min at 72 °C ...
... polymerase (Cetus) was added to the reaction mixtures. Amplification reactions were performed using a thermal cycler (Perkin-Elmer Cetus) according to the following procedure. After 5 min of denaturation at 95 °C, 35 amplification cycles were performed (1 min at 95 °C, 1 min at 55 °C, 2 min at 72 °C ...
7.2 Nucleic acids
... not protein, carried the genetic information. Early 1950s: Rosalind Franklin and Maurice Wilkins, shed light on the DNA structure using X-ray diffraction (DNA fibers). They deduced that DNA molecules are helical with two periodicities ...
... not protein, carried the genetic information. Early 1950s: Rosalind Franklin and Maurice Wilkins, shed light on the DNA structure using X-ray diffraction (DNA fibers). They deduced that DNA molecules are helical with two periodicities ...
8-Cell and Molecular Biology (Transcription)
... • RNA polymerase II transcribe most genes including all those that encode proteins • Although eukaryotic RNA polymerase II has many structural similarities to the bacterial RNA polymerase ...
... • RNA polymerase II transcribe most genes including all those that encode proteins • Although eukaryotic RNA polymerase II has many structural similarities to the bacterial RNA polymerase ...
Fig. 1.12
... not protein, carried the genetic information. Early 1950s: Rosalind Franklin and Maurice Wilkins, shed light on the DNA structure using X-ray diffraction (DNA fibers). They deduced that DNA molecules are helical with two periodicities ...
... not protein, carried the genetic information. Early 1950s: Rosalind Franklin and Maurice Wilkins, shed light on the DNA structure using X-ray diffraction (DNA fibers). They deduced that DNA molecules are helical with two periodicities ...
Elucidation of the Genetic Code
... could direct the binding of specific aminoacyl-tRNAs to ribosomes in vitro • By using 14C-labelled amino acids with all possible trinucleotide codons they showed that 61 (of the 64 possible) codons could code for the 20 amino acids ...
... could direct the binding of specific aminoacyl-tRNAs to ribosomes in vitro • By using 14C-labelled amino acids with all possible trinucleotide codons they showed that 61 (of the 64 possible) codons could code for the 20 amino acids ...
Key Molecule for the Evolution of Life—Nucleic Acid
... has an additional OH in the sugar moiety if compared with DNA, and RNA is built up by the use of uracil base whereas DNA built up of thymine. The difference between thymine and uracil is methyl-modified or not. In organisms, such slight differences are strictly discriminated. Importantly, [G and C] ...
... has an additional OH in the sugar moiety if compared with DNA, and RNA is built up by the use of uracil base whereas DNA built up of thymine. The difference between thymine and uracil is methyl-modified or not. In organisms, such slight differences are strictly discriminated. Importantly, [G and C] ...
MiRNA_GO_Meeting_August2015
... Direct curation of the roles of miRNAs is expected to improve miRNA functional analysis that has so far relied on indirect analysis of the gene targets’ functions “We show that the most commonly used functional enrichment test is inappropriate for the analysis of sets of genes targeted by miRNAs.” B ...
... Direct curation of the roles of miRNAs is expected to improve miRNA functional analysis that has so far relied on indirect analysis of the gene targets’ functions “We show that the most commonly used functional enrichment test is inappropriate for the analysis of sets of genes targeted by miRNAs.” B ...
Gene Expression and Regulation
... transmission genetics, based on Mendelian principles. We will now address how gene expression is regulated, primarily at the level of transcription and translation and some of the ways in which we can use our current knowledge of molecular genetics via DNA technology to modify and alter genetic mole ...
... transmission genetics, based on Mendelian principles. We will now address how gene expression is regulated, primarily at the level of transcription and translation and some of the ways in which we can use our current knowledge of molecular genetics via DNA technology to modify and alter genetic mole ...
Document
... made continuously • Regulated expression = gene product made on demand; expression can be induced or repressed ...
... made continuously • Regulated expression = gene product made on demand; expression can be induced or repressed ...
Foundations of Biology - Geoscience Research Institute
... cells all the time. These continually expressed genes are called constitutive genes. Other genes are only needed by certain cells or at specific times. The expression of these inducible genes is tightly controlled. For example, pancreas beta cells make the protein insulin by expressing the insul ...
... cells all the time. These continually expressed genes are called constitutive genes. Other genes are only needed by certain cells or at specific times. The expression of these inducible genes is tightly controlled. For example, pancreas beta cells make the protein insulin by expressing the insul ...
Central Dogma of Molecular Biology Chapter 28 DNA Replication
... At least 15% of all genetic diseases have been associated with mutations that affect RNA splicing. Moreover, the same pre-mRNA can be spliced differently in various cell types, at different stages of development, or in response to other biological signals. (Alternative Splicing) In addition, individ ...
... At least 15% of all genetic diseases have been associated with mutations that affect RNA splicing. Moreover, the same pre-mRNA can be spliced differently in various cell types, at different stages of development, or in response to other biological signals. (Alternative Splicing) In addition, individ ...
Insulin-like growth factor binding protein-2 (IGFBP
... cDNA sequences of two insulin-like growth factor binding protein-2 (IGFBP-2a and IGFBP-2b) from Japanese flounder, Paralichthys olivaceus. The fulllength cDNA of IGFBP-2a is 1,046 bp long and consists an open frame (ORF) of 876 bp, a 50 untranslated region (UTR) of 125 bp and a 30 -UTR of 45 bp. IGF ...
... cDNA sequences of two insulin-like growth factor binding protein-2 (IGFBP-2a and IGFBP-2b) from Japanese flounder, Paralichthys olivaceus. The fulllength cDNA of IGFBP-2a is 1,046 bp long and consists an open frame (ORF) of 876 bp, a 50 untranslated region (UTR) of 125 bp and a 30 -UTR of 45 bp. IGF ...
Messenger RNA
Messenger RNA (mRNA) is a large family of RNA molecules that convey genetic information from DNA to the ribosome, where they specify the amino acid sequence of the protein products of gene expression. Following transcription of primary transcript mRNA (known as pre-mRNA) by RNA polymerase, processed, mature mRNA is translated into a polymer of amino acids: a protein, as summarized in the central dogma of molecular biology.As in DNA, mRNA genetic information is in the sequence of nucleotides, which are arranged into codons consisting of three bases each. Each codon encodes for a specific amino acid, except the stop codons, which terminate protein synthesis. This process of translation of codons into amino acids requires two other types of RNA: Transfer RNA (tRNA), that mediates recognition of the codon and provides the corresponding amino acid, and ribosomal RNA (rRNA), that is the central component of the ribosome's protein-manufacturing machinery.The existence of mRNA was first suggested by Jacques Monod and François Jacob, and subsequently discovered by Jacob, Sydney Brenner and Matthew Meselson at the California Institute of Technology in 1961.