• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Extracting Haplotypes from Diploid Organisms
Extracting Haplotypes from Diploid Organisms

... first using gene-specific PCR primers to amplify both alleles in diploid individuals. The PCR products are then sequenced directly using automated DNA sequencers, yielding a composite chromatogram for each locus in each individual organism. The composite DNA sequence data for each locus from many in ...
Plant LTR-retrotransposons and MITEs: control of
Plant LTR-retrotransposons and MITEs: control of

... Retrotransposons are the most widespread class of eukaryotic TE. They can be divided into two principal groups, the long terminal repeat (LTR) and the non-LTR retrotransposons. LTR retrotransposons are further subdivided into the Ty1-copia and the Ty3-gypsy groups, while non-LTR retrotransposons are ...
Role of Ime4 Protein in PHO Regulon of S.cerevisiae.
Role of Ime4 Protein in PHO Regulon of S.cerevisiae.

... RNA base methylation. m6A modification is shown to be highest in the coding region of the mRNA particularly in the 3’ end of coding sequences (CDS) and first quarter of the 3’UTR with an average of one m6A residue per 2000 ribonucleotides (Meyer et al. 2012; Niu et al. 2013). Although, this modifica ...
SBI4U Translation
SBI4U Translation

... • The anticodons of some tRNAs recognize more than one codon • This is possible because the rules for base pairing between the third base of the codon and anticodon are relaxed (called the wobble hypothesis) – At the wobble position, U on the anticodon can bind with A or G in the third position of a ...
Molecular Plant-Microbe Interactions
Molecular Plant-Microbe Interactions

... downstream genes since we have previously reported that mutation in nodBC genes caused a Nod– phenotype on their temperate hosts (Cloutier et al. 1996b). We have been able to recover bacteria from crushed nodules induced by all the mutants with a 50 to 75% recovery at day 40 on O. viciifolia plants, ...
The Answer Is Fifteen Percent - CHEST Journal
The Answer Is Fifteen Percent - CHEST Journal

... emphysema.9 Other antiproteases that have been studied include ␣1-antichymotrypsin, ␣2-macroglobulin, secretory leukocyte protease inhibitor, elafin, and tissue inhibitors of metalloproteases.6,7 Macrophage-derived proteases such as the cathepsins and matrix metalloproteases have received some atten ...
Biological Sequence Data Formats
Biological Sequence Data Formats

... Sometimes you need to input many sequences at the same time to a program, such as a multiple sequence alignment program. This is easy in FASTA format – see below. (Note: These sequences are all the same length, but this does not have to be the case.) > HumanGlobin CCCTAAACCCTAAACCCTAAACCCTAAACCTCTGA ...
Familial Colorectal Cancers: Hereditary Non-Polyposis
Familial Colorectal Cancers: Hereditary Non-Polyposis

... on the methods used, they can miss positive cases anywhere from 5 to 50% of the time. A family may carry a mutation in a gene that has not yet been discovered or a mutation for which that testing has not yet been developed. Genetic testing is something that should not be taken lightly. One must cons ...
Colon Cancer by
Colon Cancer by

... beef induces and dietary rye bran prevents formation of intestinal polyps. • Several studies have suggested that red meat and processed meats, through breakdown products, increase DNA damage and cancer risk ...
Presentation Slides
Presentation Slides

... Rapid construction of transgenic models of human disease Rapid forward genetics – isolate mutants through transposons or chemical mutagenesis Rapid determination of the molecular basis of disease mechanisms ...
1 Total out of 100
1 Total out of 100

... asking what features make a good model organism. One sentence. need to state explicitly that a model organism is • the object of intense study with respect to a specific biological process • and that what we learn from studying this organism can be applied to other organisms or serve as a basis for ...
Dynamic Model of Paclitaxel Biosynthesis Suggests That the Key
Dynamic Model of Paclitaxel Biosynthesis Suggests That the Key

... Paclitaxel, isolated from the bark of several Taxus species, is diterpene alkaloid with remarkable anticancer propertiese specially effective against breast cancer and non-small cell lung cancer [1].The most promising and environmentally friendly way for the sustainable production of paclitaxel is p ...
Dragon Genetics - Chester Upland School District
Dragon Genetics - Chester Upland School District

... To test whether baby dragons with wings and baby dragons without wings will be equally likely to have big horns, you will carry out a simulation of the simultaneous inheritance of the genes for wings and horns. Since the father is homozygous (wwhh), you know that all of the father's sperm will be wh ...
Gene Sequencing
Gene Sequencing

... • The membranes of these cells are then broken apart using a detergent (similar to what you would find in dish soap). • Because the membranes of cells are made of fatty lipids, the same detergent that you use to get grease off of a frying pan could work to break apart the lipid cellular membranes th ...
Li, H. Ghosh, S. K., Amerson, H. and Li, B. (2004Major Gene Detection for Fusiform Rust Resistance using Bayesian Complex Segregation Analysis in Loblolly Pine,"
Li, H. Ghosh, S. K., Amerson, H. and Li, B. (2004Major Gene Detection for Fusiform Rust Resistance using Bayesian Complex Segregation Analysis in Loblolly Pine,"

... and Walkinshaw 1991). Recent evidence shows that resistance in loblolly pine, at least in part, is the result of major resistance genes in the host interacting with pathogenicity (avirulence/virulence) genes in the pathogen (Wilcox et al. 1996; Kuhlman et al. 1997; Amerson et al. 1997). Non-infected ...
Chapter 1. Fundamental Properties of Genes
Chapter 1. Fundamental Properties of Genes

A preliminary mutation analysis of phenylketonuria in southwest Iran
A preliminary mutation analysis of phenylketonuria in southwest Iran

... five other mutations, Y356X, S231P, I224T, IVS11-2A>G, and V388M, in an Iranian population. Southwestern Iran, especially the Khuzestan Province, is comprised of heterogeneous ethnic groups; therefore, diversity in the mutation spectrum was expected. In summary, we sequenced five exons of the PAH ge ...
The Interplay of Temperature and Genotype on Patterns
The Interplay of Temperature and Genotype on Patterns

... (Figure 4 inset). The difference in alternative splicing between the two genotypes at 13° becomes clearer after adjusting for variance in the 39 gene-body read coverage across replicates (see File S1). With temperature stress resulting in increasing differences in the splicing pattern between the tw ...
21 principles of genetics
21 principles of genetics

... and so on generation after generation. This inheritance of genes is termed ‘heredity’ the study of heredity is ‘Genetics’. New individual develop according to the genes inherited from their parents. The transmission of characters from one generation to the next, that is from parents to offspring is ...
Practical: Ranges
Practical: Ranges

Splice variants` role in mediating different disease states in
Splice variants` role in mediating different disease states in

... which is capable of generating different variants of the same protein, arise. But, given the energetic cost of generating different splice variants for testing their capability at a specific task, which incurs cellular functional uncertainty; as well as the exertion of differing physiological effect ...
embj201488796-sup-0008
embj201488796-sup-0008

... I. mRNA expression of 14 activity-regulated genes is regulated after expression of shRNA467. Normalized mRNA levels relative to levels in neurons expressing scrambled shRNA are plotted. shRNA 467 yields comparable results as independent shRNA 944 (Fig 5A), what argues strongly against off-target eff ...
Pleurochrysome: A Web Database of
Pleurochrysome: A Web Database of

... yeast, but without P. haptonemofera, by using OrthoMCL. Thereafter, P. haptonemofera UNIGENEs were connected with the orthologous groups based on the best hit counterpart in the result of a blastx search with the UNIGENE nucleotide sequences as a query against each protein database of the 12 species ...
Lecture 10.PATTERNS OF INHERITANCE.012410
Lecture 10.PATTERNS OF INHERITANCE.012410

... the phenotypic ratio for F₂ offspring of a monohybrid cross? How is that different from a simple dominant-recessive cross? 2. Two parents have O blood. What blood type would you expect for their child? 3. What is the likely mechanism for inheritance for a character with large range of phenotypes? Ex ...
forever young: a gene facilitating the study of the third larval instar of
forever young: a gene facilitating the study of the third larval instar of

... The two fey alleles were obtained from a P-element reversion experiment where the P-elements in the sra alleles sraP1 and sraP2 were removed. Originally, fey1 and fey2 had been referred to as sral1 and sral2, respectively, (Czank 1998) as the result of the fact that P-element removal was a "sra alle ...
< 1 ... 286 287 288 289 290 291 292 293 294 ... 1264 >

RNA-Seq



RNA-seq (RNA sequencing), also called whole transcriptome shotgun sequencing (WTSS), is a technology that uses the capabilities of next-generation sequencing to reveal a snapshot of RNA presence and quantity from a genome at a given moment in time.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report