• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
BIOINFORMATICS Biological information is encoded in the
BIOINFORMATICS Biological information is encoded in the

... taster vs. human PTC non-taster. Then click on Compare in the grey bar. (The default operation is a multiple sequence alignment, using the CLUSTAL W algorithm.) The checked sequences are sent to a server at Cold Spring Harbor Laboratory, where the CLUSTAL W algorithm will attempt to align each nucle ...
Identify a gene of interest in a “non-model” system
Identify a gene of interest in a “non-model” system

... marine organisms has generated an enormous amounts of DNA/RNA sequence data. However, these DNA/RNA sequences are generally not well “annotated.” In other words, the individual genes have generally not been subjected to sufficient analysis to identify them by function or even to give them a name. If ...
scores
scores

... In general, the BLOSUM series is thought to be superior to the PAM series because it is derived from areas of conserved sequences. It is important to vary the parameters when performing a sequence comparison. Similarity scores for truly related sequences are usually not sensitive to changes in scori ...
The Sequence Manipulation Suite—a collection of JavaScript prog
The Sequence Manipulation Suite—a collection of JavaScript prog

... The Sequence Manipulation Suite is now hosted by Bioinformatics.Org, an organization that promotes the development of Open Source software for the biological sciences. It can be accessed at http://bioinformatics.org/sms as well as from numerous mirror sites, most of which can be found using Web sear ...
Applied Bioinformatics Exercise Sheet 2
Applied Bioinformatics Exercise Sheet 2

... f. How is the function of Hemoglobin different from Myoglobin? (1 point) g. Look for both of these structures in the PDB. First search for “Myoglobin” and “Hemoglobin” and note down how many hits you get for each. From looking at the results you should see that it is sometimes difficult to find the ...
- Covenant University Repository
- Covenant University Repository

... i. The strings in S¢ have the same length. ii. Ignoring dashes, string S¢ i is identical with string Si. An alignment can be interpreted as an array with n rows, one row for each S¢ i . Two letters of distinct strings are called aligned under S¢ if they are placed into the same column [24]. To compa ...
Heuris`c)search:)FastA)and)BLAST)
Heuris`c)search:)FastA)and)BLAST)

... molecular biologists. The method efficiently identifies regions of similar sequence and then scores the aligned identical and differing residues in those regions by means of an amino acid replaceability matrix. This matrix increases sensitivity by giving high scores to those amino acid replacements ...
Quiz5
Quiz5

... MDLRQFLMCLSLCTAF I ordered this gene to contain an EcoR1 site at the 5’ end of the coding sequence. Show precisely where M starts by circling the correct peaks (1pt) Please determine if the sequencing is correct? (1pt) Yes or No (circle one) What amino acid follows the 2nd F in the sequence below? ( ...
Sequencing genomes
Sequencing genomes

... • More difficult example ACGTCTGATACGCCGTATAGTCTATCT CTGATTCGCATCGTCTATCT ...
Comparative Analysis
Comparative Analysis

... What is BLAST? BLAST® (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. The BLAST programs have been designed for speed, with a minimal sacrifice of sensitivity to ...
Diapositiva 1 - Universitat de Lleida
Diapositiva 1 - Universitat de Lleida

... • Opening a gap is costly; extending it not so much (open=12; extension=1) ...
What are Math and Computer Science doing in Biology?
What are Math and Computer Science doing in Biology?

... Simple sequence comparison, comparing new sequences against sequences in databases, has been extremely productive. But how do we extract the most biological value from sequences? The Larger Challenge and Opportunity: How to utilize the deluge of sequence data? ...
GCB 535 / CIS 535: Introduction to Bioinformatics
GCB 535 / CIS 535: Introduction to Bioinformatics

... informative different elements in your positional weight matrix are. Explain (conceptually) how relative entropy differs from information content and briefly describe a situation where using information content and relative entropy are exactly equivalent (though the actual values the equations give ...
doc
doc

... 17. A databank search is performed with each of a collection of 5000 genes, with the aim for an overall probability to identify a false positive of 5%. Using the Bonferroni correction, which Evalue should be applied to each of the 5000 individual databank searches? 18. Using a random shuffling appro ...
I. Comparing genome sequences
I. Comparing genome sequences

... • Fixation rate is equal to mutation rate • Genomes become more dissimilar with greater phylogenetic distance ...
BioE/MCB/PMB C146/246, Spring 2005 Problem Set 1
BioE/MCB/PMB C146/246, Spring 2005 Problem Set 1

... The graphs for A and B1 should look very similar. Differences are due only to the random process of choosing which bases mutate. The graph for B2 should show fewer mutations overall, with many positions ...
Pairwise sequence alignment - uni
Pairwise sequence alignment - uni

... • It is used to decide if two proteins (or genes)  are related structurally or functionally • It is used to identify domains or motifs that are  ...
Sequence
Sequence

... 1. BLAST - Finds sequences in a database that are similar to a query sequence (ver.2.0) 2. FastA - Search for similarity sequences of the same type 3. FastX - Search for similarity sequences between a nucleotide sequence and protein database, taking frameshifts into account. 4. FindPatterns - Identi ...
I. Comparing genome sequences
I. Comparing genome sequences

... • Fixation rate is equal to mutation rate • Genomes become more dissimilar with greater phylogenetic distance ...
Lecture 8
Lecture 8

... • BLAST (http://www.ncbi.nlm.nih.gob/BLAST/) performs pairwise alignments up to user-selected number of subject sequences in the selected database(s) most similar to the input query sequence. • Can align vs ~900,000 peptide sequences in the database. • Pairwise alignments are found using BLOSUM62 an ...
Comparative Genomics
Comparative Genomics

... • For 5 teleost fish + constrained elements • For 12 eutherian mammals • For 35 eutherian mammals + constrained elements ...
presentation on Hidden Markov Models
presentation on Hidden Markov Models

... the protein backbone. How a protein folds is largely dictated by the primary sequence of amino acids ...
Learning objectives for Sequence Analysis 1
Learning objectives for Sequence Analysis 1

... compared to every sequence in a sequence database, and the similar ones are identified. Alignments with the best-matching sequences are shown and scored. If a query sequence can be readily aligned to a database sequence of known function, structure, or biochemical activity, the query sequence is pre ...
Sequence Alignment
Sequence Alignment

... They give a measure of the frequency of changing from one amino acid to another, as compared to the frequency of random change Derived from global alignments of homologus sequences from different, but closely related, species. The sequences had an average of 1 amino acid change per hundred residues. ...
Sequence logos for DNA sequence alignments
Sequence logos for DNA sequence alignments

... Sequence logos are a graphical representation of sequence alignments developed by Schneider and Stephens (1990). Each logo consists of stacks of symbols, one stack for each position in the sequence. The overall height of the stack is proportional to the information content at that position, while th ...
< 1 ... 13 14 15 16 17 18 19 20 >

Sequence alignment



In bioinformatics, a sequence alignment is a way of arranging the sequences of DNA, RNA, or protein to identify regions of similarity that may be a consequence of functional, structural, or evolutionary relationships between the sequences. Aligned sequences of nucleotide or amino acid residues are typically represented as rows within a matrix. Gaps are inserted between the residues so that identical or similar characters are aligned in successive columns.Sequence alignments are also used for non-biological sequences, such as those present in natural language or in financial data.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report