Protein Localization Analysis of Essential Genes in Prokaryotes
... mutagenesis, which has increased the number of prokaryotic species involved in gene essentiality research dramatically9. In the last few years, great progresses not only in vivo but also in silico have been made. For example, bacterial essential genes have been showed more evolutionarily conserved t ...
... mutagenesis, which has increased the number of prokaryotic species involved in gene essentiality research dramatically9. In the last few years, great progresses not only in vivo but also in silico have been made. For example, bacterial essential genes have been showed more evolutionarily conserved t ...
A global view of pleiotropy and phenotypically derived gene function
... range of pleiotropies by phenotype profile successfully groups genes with common biological functions. The fact that both condition-specific and highly pleiotropic genes can be grouped by common phenotype profiles into gene sets that show significant enrichment for known biological processes suggests th ...
... range of pleiotropies by phenotype profile successfully groups genes with common biological functions. The fact that both condition-specific and highly pleiotropic genes can be grouped by common phenotype profiles into gene sets that show significant enrichment for known biological processes suggests th ...
bchm6280_lect1_16
... • What taxonomic groups are represented in this population of bacteria, viruses or fungi? • How do the gene expression patterns change between samples (and across time)? • Where does this transcription factor bind in the genome? ...
... • What taxonomic groups are represented in this population of bacteria, viruses or fungi? • How do the gene expression patterns change between samples (and across time)? • Where does this transcription factor bind in the genome? ...
Genes, Alleles, and Traits (recovered)
... The British mathematician/biologist R.C. Punnett developed a method for visually representing the possible combinations of alleles from the parents. It was then possible to predict the possible outcomes of the offspring. Before taking a closer look at Punnett squares, we will describe the parents mo ...
... The British mathematician/biologist R.C. Punnett developed a method for visually representing the possible combinations of alleles from the parents. It was then possible to predict the possible outcomes of the offspring. Before taking a closer look at Punnett squares, we will describe the parents mo ...
Novel genes involved in the regulation of
... reports on the genes in the right-hand section and on the phenotypes of mutants with transposon insertions in these genes. Sequence analysis identified eight genes or ORFs with the gene order rpfD–orf1–orf2–orf3–orf4–recJ–rpfE–greA. RecJ and GreA have established functions in recombination and trans ...
... reports on the genes in the right-hand section and on the phenotypes of mutants with transposon insertions in these genes. Sequence analysis identified eight genes or ORFs with the gene order rpfD–orf1–orf2–orf3–orf4–recJ–rpfE–greA. RecJ and GreA have established functions in recombination and trans ...
Gene Tagging with Transposons
... • Constructed Ty1 element with a galactose-inducible promoter and an intron • Used galactose to stimulate transcription, then found that all the new copies transposed had the intron spliced out ...
... • Constructed Ty1 element with a galactose-inducible promoter and an intron • Used galactose to stimulate transcription, then found that all the new copies transposed had the intron spliced out ...
embj201490542-sup-0013
... target genes. To define genes that become induced upon Scl expression, SclhCD4 reporter ES cells (Chung et al, 2002) were used to identify genes that become up-regulated in day 4 Scl-expressing mesoderm (Flk1+Scl+) as compared to Flk1+Scl- mesodermal precursors that give rise to other mesodermal lin ...
... target genes. To define genes that become induced upon Scl expression, SclhCD4 reporter ES cells (Chung et al, 2002) were used to identify genes that become up-regulated in day 4 Scl-expressing mesoderm (Flk1+Scl+) as compared to Flk1+Scl- mesodermal precursors that give rise to other mesodermal lin ...
Full Text
... sine oculis, a homeobox containing gene, are some of the players in that conservative genetic cascade that we have characterized in Platyhelminthes. Freshwater planarians detect light intensity through their eyespots. Although being very simple, they contain two cell types: photoreceptor and pigment ...
... sine oculis, a homeobox containing gene, are some of the players in that conservative genetic cascade that we have characterized in Platyhelminthes. Freshwater planarians detect light intensity through their eyespots. Although being very simple, they contain two cell types: photoreceptor and pigment ...
Ecophysiology of Thioploca ingrica as revealed by the
... 4100 000 000 paired-end metagenomic sequences using the Illumina MiSeq platform. Because lowredundancy sequences derived from minor contaminating bacteria disturbed sequence assembly, 3 000 000 reads were used as input sequences, in accordance with the results of an optimization procedure (see Mater ...
... 4100 000 000 paired-end metagenomic sequences using the Illumina MiSeq platform. Because lowredundancy sequences derived from minor contaminating bacteria disturbed sequence assembly, 3 000 000 reads were used as input sequences, in accordance with the results of an optimization procedure (see Mater ...
Appendix S1.
... Candidate gene selection from the MYP6 locus and subsequent validation by Endeavour Genes were identified from NCBI database and manually prioritized into 5 categories – highly relevant (with substantial evidence for ocular disease or function), possibly related (with relatively less evidence for oc ...
... Candidate gene selection from the MYP6 locus and subsequent validation by Endeavour Genes were identified from NCBI database and manually prioritized into 5 categories – highly relevant (with substantial evidence for ocular disease or function), possibly related (with relatively less evidence for oc ...
biol b242 chromosomal evolution
... There is even evidence for HETEROZYGOUS ADVANTAGE, which, as we have seen, will maintain polymorphisms. This is found in flies such as Drosophila, and also the malaria carrier, Anopheles mosquitoes. Why? Dobzhansky in 1930s suggested that inversions trap "coadapted gene complexes", groups of genes t ...
... There is even evidence for HETEROZYGOUS ADVANTAGE, which, as we have seen, will maintain polymorphisms. This is found in flies such as Drosophila, and also the malaria carrier, Anopheles mosquitoes. Why? Dobzhansky in 1930s suggested that inversions trap "coadapted gene complexes", groups of genes t ...
No Slide Title - Brigham Young University
... You might measure the expression of 10,000 genes and hope that any of them are up- or down-regulated. But you can expect to see 5% (500 genes) regulated at the p < 0.05 level by chance alone. To account for the thousands of repeated measurements you are making, some researchers apply a Bonferroni co ...
... You might measure the expression of 10,000 genes and hope that any of them are up- or down-regulated. But you can expect to see 5% (500 genes) regulated at the p < 0.05 level by chance alone. To account for the thousands of repeated measurements you are making, some researchers apply a Bonferroni co ...
Chromosomal rearrangements in Salmonella spp. s2-2
... (Figure 1), S. paratyphi 822, and S. enteritidis2], the same order as in E coli K-l2ts. Because I-CeuI cleaves only rrn operons and because the rrn skeleton is highly conserved in enteric bacteria, related wild type strains usually yield identical fingerprints; for example, seventeen independent wil ...
... (Figure 1), S. paratyphi 822, and S. enteritidis2], the same order as in E coli K-l2ts. Because I-CeuI cleaves only rrn operons and because the rrn skeleton is highly conserved in enteric bacteria, related wild type strains usually yield identical fingerprints; for example, seventeen independent wil ...
www.mbio.ncsu.edu
... genes, further suggesting that this replicon was a plasmid recruited to become a chromosome encoding essential genes (Fig. 1; Supplemental Table 2). Genes around the origin of replication in chromosome display a high level of synteny with genes of other known proteobacteria. chrI codes for nine rDNA ...
... genes, further suggesting that this replicon was a plasmid recruited to become a chromosome encoding essential genes (Fig. 1; Supplemental Table 2). Genes around the origin of replication in chromosome display a high level of synteny with genes of other known proteobacteria. chrI codes for nine rDNA ...
Web API In addition to the web interface, one can access Cas
... {"targets": [{"gc_contents": 40.0, "strand": "-", "oof_score": 74.2595596756, "sequence": "ACGAAATATCAATGATGGCCAGG", "coverage": 1, "position": 144050592, "offtarget_counts": [1, 0, 0], "id": 34, "chromosome": "chr7", "cds_percentages": {"ENST00000408906": 20.9401709402}}, {"gc_contents": 30.0, "str ...
... {"targets": [{"gc_contents": 40.0, "strand": "-", "oof_score": 74.2595596756, "sequence": "ACGAAATATCAATGATGGCCAGG", "coverage": 1, "position": 144050592, "offtarget_counts": [1, 0, 0], "id": 34, "chromosome": "chr7", "cds_percentages": {"ENST00000408906": 20.9401709402}}, {"gc_contents": 30.0, "str ...