• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Supplementary Methods and Legends
Supplementary Methods and Legends

... Cancer Centre (22) prior to plasmid preparation. COLO-829 authentication was performed by validating the presence of COLO-829 mutations as reported in the COSMIC database (1, 2), against those identified from promoter amplification and sequencing. For reporter assays with Renilla normalisation, COLO ...
GI tract, Liver and Pancreatic tumors ,TMC, Kolkata
GI tract, Liver and Pancreatic tumors ,TMC, Kolkata

... Early gastric cancers are very amenable to interventional endoscopy. Both endoscopic mucosal resection (EMR) and endoscopic submucosal dissection (ESD) have resulted in sucessful endoscopic resections of lesions.5,6 ...
Solid Tumour Section Endocrine/neuroendocrine glands: Adrenal
Solid Tumour Section Endocrine/neuroendocrine glands: Adrenal

... mutations of TP53. Deletions of the ACTH receptor gene have been recently found in undifferentiated adenomas and in aggressive adrenocortical carcinomas although the frequency of ACTH receptor deletion needs to be more fully examined. Other key oncogenes and tumor suppressor genes remain to be ident ...
Classifying cancer genome aberrations by their mutually
Classifying cancer genome aberrations by their mutually

... identify transcriptional patterns that can be used as biomarkers of treatment response, independent of the genomic aberrations that occur within these tumors. We evaluated this idea using publicly available data from The Cancer Genome Atlas (TCGA). We acquired data representing mutations (including ...
Center for Cancer Research National Cancer Institute
Center for Cancer Research National Cancer Institute

... Developed monitoring technology for neurofibromatosis Developed software to automate 3D visualization of cellular structures Developed adenovirus-based HIV vaccine that gives best protection to date Brought Hsp90 inhibitors to clinical trials Unraveled mechanisms of multidrug resistance/ABC transpor ...
Genome and Transcriptome Sequencing in Prospective Metastatic
Genome and Transcriptome Sequencing in Prospective Metastatic

... Triple-negative breast cancer (TNBC) is characterized by the absence of expression of estrogen receptor, progesterone receptor, and HER-2. Thirty percent of patients recur after first-line treatment, and metastatic TNBC (mTNBC) has a poor prognosis with median survival of one year. Here, we present ...
lung cancer - Kentucky Cancer Registry
lung cancer - Kentucky Cancer Registry

... Small Cell Lung CA Biomarkers ...
The Emergence of Thalidomide in Treating Advanced Renal Cell
The Emergence of Thalidomide in Treating Advanced Renal Cell

... to female predominance (Bukowski & Novik, 1997). An estimated 31,900 new cases of kidney cancer are projected to be diagnosed in the United States in 2003 (Jemal et al.), and 25%– 33% of these patients will present with metastatic or advanced disease. Although the overall survival is approximately 5 ...
Anti-VEGF Reduces Drug Delivery and Therapeutic
Anti-VEGF Reduces Drug Delivery and Therapeutic

... GACGACCCTTACAACCCCTAC AAG – 3’ (italics: EcoRI site, underlined: start codon) and ...
word
word

... Serhiy Souchelnytskyi – Karolinska Biomics Center, Stockholm, Sweden "Personalized medicine and cancer proteomics" ...
A miRNA-based predictor of EOC early relapse
A miRNA-based predictor of EOC early relapse

... miRNA mimics (miRNA replacement therapy) to restore loss-of-function inhibition of the upregulated oncomiRs using antisense miRs (miRNA inhibition therapy) In hepatocellular carcinoma, miR-34 was recognized to be frequently downregulated: phase I clinical trial in patients with hepatocellular carcin ...
SETD2 loss-of-function promotes renal cancer branched evolution
SETD2 loss-of-function promotes renal cancer branched evolution

... polymerase II (RNA Pol II).9,10 In this study, we used an integrated bioinformatics and functional approach to investigate the consequences of SETD2 loss-of-function in ccRCC. RESULTS SETD2 mutations and LOH in ccRCC Using data from The Cancer Genome Atlas (TCGA) Research Network, we assembled a ccR ...
Lung Cancer Master Protocol Activation Announcement
Lung Cancer Master Protocol Activation Announcement

... Grouping multiple studies: reduces overall screen failure rate , multi-target screening by NGS platform: sufficient “hit rate” uninterrupted accrual. ...
Translational cancer research comes of age in Latin America
Translational cancer research comes of age in Latin America

... Laboratory of Molecular and Cellular Therapy, Fundación Instituto Leloir-CONICET, Buenos Aires, Argentina. 2Instituto Nacional de Câncer, Ministério da Saúde, Brasil. 3Instituto Nacional del Cáncer, Santiago, Chile. 4Departamento de Fisiología, ...
Two Clinical Cases of Paraneoplastic Dermatomyositis Associated
Two Clinical Cases of Paraneoplastic Dermatomyositis Associated

... 2. Dermatomyositis, associated with other connective tissue disease. 3. Dermatomyositis and infection. 4. Paraneoplastic dermatomyositis. In adults with DM the most important feature is the increased incidence of malignancies. Several authors have reported coexistence of DM with various cancers ( ...
Bladder carcinoma with divergent histological
Bladder carcinoma with divergent histological

... cancer to prognosis with varied results. Most studies ...
Genetic heterogeneity in breast cancer: the road to personalized medicine? Open Access
Genetic heterogeneity in breast cancer: the road to personalized medicine? Open Access

... In the largest breast cancer series reported to date, the METABRIC study group performed an integrated analysis of copy number and gene expression in discovery and validation sets each containing approximately 1,000 primary breast tumors, with long-term clinical follow-up [17]. Inherited genetic var ...
TR - National University Cancer Institute, Singapore (NCIS)
TR - National University Cancer Institute, Singapore (NCIS)

... • TR database system (TRDS) was developed in-house by Tan Kee Peck using Microsoft.net • TRDS is based on the CCRD Oracle platform, it is Web accesible and integrated with hospital database systems • TRDS has multiple security features, including Trusted Third Party (TTP) Data Escrow System to de-id ...
Pathology of the Female Genital Tract - 1
Pathology of the Female Genital Tract - 1

... thinned out and resembles paper. The labia becomes atrophic and stiffened. Microscopically: thinning of the epidermis and disappearance of rete pegs, hydropic degeneration of the basal cells, superficial hyperkeratosis, and dermal fibrosis with a scant perivascular, mononuclear inflammatory cell inf ...
The mutational landscape of chromatin regulatory factors across
The mutational landscape of chromatin regulatory factors across

... Drugs Administration to treat a specific type of lymphoma, and more than 20 molecules of this type are currently under preclinical and clinical investigation [11]. Some DNMT inhibitors have been recently approved by the US Food and Drugs Administration to treat myelodysplastic syndromes, and their c ...
Finding and Calling Genome Variants
Finding and Calling Genome Variants

...  +1 is A of ATG (start codon); -1 is the previous/upstream nucleotide  “*” is the stop codon (eg. *1 is the first nucleotide of the stop codon) ...
Folie 1
Folie 1

... Randomized phase II trial on the efficacy of FOLFIRI in combination with cetuximab vs. bevacizumab as firstline-treatment for metastasizing colorectal carcinoma ...
HELA Cell Line Risk Assessment - Institutional Biosafety Committee
HELA Cell Line Risk Assessment - Institutional Biosafety Committee

... histological findings in the lymph nodes shoud be considerees as a subpopulation for poor outcome especially in the young age group (5) A vaccine is currently available. This vaccine is not effective post exposure. All who work in labs that manipulate this agent are encouraged to become informed as ...
an unfavourble cup subset
an unfavourble cup subset

... Methods: A cohort of resected metastatic lesions from patients diagnosed with CUP was studied blindly on the microRNA-based test. The cohort included 93 samples (from 92 patients) with tissue adequate for the test. Results: The test results were fully concordant with the diagnosis based on all the c ...
Sweden
Sweden

... biases – Minimisation of reverse causality biases • 2. Efficiency – Samples and data already collected. Follow-up studies with decades of follow-up completed in weeks • 3. Past exposures – Particularly for cancer, causal exposure may have occurred long before diagnosis (even at the fetal stage) and ...
< 1 ... 20 21 22 23 24 25 26 27 28 ... 37 >

The Cancer Genome Atlas

The Cancer Genome Atlas (TCGA) is a project, begun in 2005, to catalogue genetic mutations responsible for cancer, using genome sequencing and bioinformatics. TCGA represents an effort in the War on Cancer that is applying high-throughput genome analysis techniques to improve our ability to diagnose, treat, and prevent cancer through a better understanding of the genetic basis of this disease.TCGA is supervised by the National Cancer Institute and the National Human Genome Research Institute funded by the US government. A three-year pilot project, begun in 2006, focused on characterization of three types of human cancers: glioblastoma multiforme, lung, and ovarian cancer. In 2009, it expanded into phase II, which plans to complete the genomic characterization and sequence analysis of 20-25 different tumor types by 2014. Funding is split between genome characterization centers (GCCs), which perform the sequencing, and genome data analysis centers (GDACs), which perform the bioinformatic analyses.The project scheduled 500 patient samples, more than most genomics studies, and used different techniques to analyze the patient samples. Techniques gene expression profiling, copy number variation profiling, SNP genotyping, genome wide DNA methylation profiling, microRNA profiling, and exon sequencing of at least 1,200 genes. The TCGA is sequencing the entire genomes of some tumors, including at least 6,000 candidate genes and microRNA sequences. This targeted sequencing is being performed by all three sequencing centers using hybrid-capture technology. In phase II, TCGA is performing whole exon sequencing on 80% of the cases and whole genome sequencing on 80% of the cases used in the project.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report