• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Cells
Cells

... Separated from cytoplasm by nuclear membrane Contains genetic material - DNA ...
File
File

... Plant Cell Wall is feeling good today! Coleman FINALLY watered! Large Central Vacuole is turgid – plenty of water all around! November 2, 2010 Wall ...
hydrophilic - muhlsdk12.org
hydrophilic - muhlsdk12.org

... Membrane Proteins • Proteins determine membrane’s specific functions – cell membrane & organelle membranes each have unique collections of proteins ...
5cap` AAUGAGUACCGGGCGAUAAUC AGAAA 3`
5cap` AAUGAGUACCGGGCGAUAAUC AGAAA 3`

... 6a. If molecule #4a was destined to be secreted from the cell and used elsewhere in the body, what kind of ribosome would be involved in its translation? a bound ribosome (bound to RER) b. ...
Mitosis Vs Meiosis Powerpoint
Mitosis Vs Meiosis Powerpoint

... The copies then must be separated & sorted into two sides of the cell. The cell then splits in two. Part of each parent is carried to the two new cells. ...
The Summary of the Cell Division
The Summary of the Cell Division

... called S phase (DNA synthesis phase), which typically lasts about 6 h. In mammalian cells, the start of S phase—the actual initiation of DNA synthesis—takes place several hours after the cell has committed to carrying out DNA synthesis. During S phase, each chromosome replicates exactly once to form ...
Chapter 10 - North Mac Schools
Chapter 10 - North Mac Schools

... • The centromeres joining the sister chromatids, separate & become individual chromosomes. • These chromosomes then move to opposite ends of the cell called poles. • Anaphase ends when the chromosomes stop ...
Online Activity: Types of Transport
Online Activity: Types of Transport

... bloodstream? Hint: You may have to look up how dialysis works online. ___________________________________________________________________________________ ___________________________________________________________________________________ ______________________________________________________________ ...
Stages of Mitosis (fig 8.7)
Stages of Mitosis (fig 8.7)

... complete DNA replication. ...
Chapter 3
Chapter 3

... cell that is in a hypotonic environment will lyse (burst); ex. placing a cell in distilled water would cause the cell to lyse - water would move into the cell to where the water concentration is lower. 3.) hypertonic solution ("hyper" = more) - one solution has more solute (less water) than the othe ...
Cell “Travel Brochure”
Cell “Travel Brochure”

... o Town Hall: Be sure to stop here first! This is where all the information about Cell City can be found. Also this is where Mayor Eukayto resides. If your lucky maybe you’ll meet him! (nucleus) o Your analogy needs to make sense in relation to the cell structure it is supposed to represent. You will ...
7.2 Cell Structure
7.2 Cell Structure

... the cytoskeleton: a network of protein filaments; it helps the cell maintain its shape and is involved in movement centrioles: organelles made from tubulins; they help organize cell division in animal cells ...
Cell Model Expectations
Cell Model Expectations

... You must identify all the organelles listed below for whichever cell you choose. The type of cell, your name and class period must be identified somehow on the model and the key. DO NOT label the organelles on the model, use ID numbers. The key will identify which organelle is represented by each ID ...
IBMitosis-Meiosis-student-notes
IBMitosis-Meiosis-student-notes

... 1. In meiosis I, there are three events that occur which do not happen in mitosis... a. During prophase I -> ...
Lecture 8 Intermediate filaments
Lecture 8 Intermediate filaments

... Lamin B: essential for cell survival RNAi-mediated reduction of lamin B in C. elegans and HeLa cells: spindle defects & chromosome mis-segregation ...
CELL STRUCTURE AND FUNCTION On
CELL STRUCTURE AND FUNCTION On

... hereditary information they contain, DNA, is passed from cell to cell. All cells, plant and animal, have basically the same composition, and carry out many of the same chemical reactions. Energy flow occurs within cells allowing life processes to be carried out. Living organisms contain specialized ...
Bacteria Notes - Fort Bend ISD
Bacteria Notes - Fort Bend ISD

... Monera – the (outdated) name of the kingdom that included ALL prokaryotes Now we know there are differences between bacteria and have divided them into the two kingdoms Eubacteria and Archaebacteria Also put into two different domains: Bacteria and Archae ...
Topic 2: Cells - Peoria Public Schools
Topic 2: Cells - Peoria Public Schools

... 36. Interphase is the phase in which the cell is carrying out its appointed activity or activities. Metabolic activities such as protein synthesis, DNA replication and organelle reproduction occur in this phase. 37. The phases of mitosis can be remembered in their proper order by the word shipmate. ...
Chapter 5 - Marissa Junior/Senior High School
Chapter 5 - Marissa Junior/Senior High School

... Diffusion is the SIMPLEST type of passive transport. Diffusion: the movement of molecules from an area of higher concentration to an area of lower concentration Concentration Gradient: the difference in the concentration of molecules across a distance ...
Chapter 7 Powerpoint
Chapter 7 Powerpoint

... Types of Osmotic Solutions ...
cells
cells

... within specified limits. C. Many organisms are unicellular (consisting of only 1 cell) --However cell size is limited. D. Because of size constraints, large organisms such as animals and plants are multi-cellular. * Each cell of a multi-cellular organism make a specialized contribution to the body a ...
Biology Monday, October 16
Biology Monday, October 16

... – Transport (carrier) proteins allow large particles to flow through the membrane – with the concentration gradient (from high concentration to low concentration) – This does not require energy – Particles that are too large to fit between lipids: such as glucose http://highered.mcgrawhill.com/sites ...
transport across the membrane
transport across the membrane

... • are both forms of Active Transport and require ATP energy - energy required because they are changing the shape of the cell membrane. It requires a great deal of energy to fuse a vacuole with the cell membrane or create a vacuole from the cell membrane. The vacuoles are made from a phospholipid bi ...
NAME BIOLOGY- _____ Date ______ THE CELL CYCLE The cell
NAME BIOLOGY- _____ Date ______ THE CELL CYCLE The cell

... The process of mitosis (division of the nucleus) is divided into four stages (Prophase, Metaphase, Anaphase, and Telophase). Immediately following nuclear division (mitosis), the cell membrane must also divide (cytokinesis). Animal cells divide the cytoplasm by constricting the cell membrane in the ...
Document
Document

... A cell membrane is made of a double layer of phospholipid molecules. Each layer is a mirror image of the other layer. The structure is called a lipid bilayer. Located within the lipid bilayer of the cell membrane are proteins of different types. Each type of membrane protein plays a vital role in th ...
< 1 ... 567 568 569 570 571 572 573 574 575 ... 1089 >

Cytokinesis



Cytokinesis (cyto- + kinesis) is the process during cell division in which the cytoplasm of a single eukaryotic cell is divided to form two daughter cells. It usually initiates during the early stages of mitosis, and sometimes meiosis, splitting a mitotic cell in two, to ensure that chromosome number is maintained from one generation to the next. After cytokinesis two (daughter) cells will be formed that are exact copies of the (parent) original cell. After cytokinesis, each daughter cell is in the interphase portion of the cell cycle. In animal cells, one notable exception to the normal process of cytokinesis is oogenesis (the creation of an ovum in the ovarian follicle of the ovary), where the ovum takes almost all the cytoplasm and organelles, leaving very little for the resulting polar bodies, which then die. Another form of mitosis without cytokinesis occurs in the liver, yielding multinucleate cells. In plant cells, a dividing structure known as the cell plate forms within the centre of the cytoplasm and a new cell wall forms between the two daughter cells.Cytokinesis is distinguished from the prokaryotic process of binary fission.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report