The Plant Cell
									
... GenBank sequence entries. All clones isolated from a cDNA library by hybridization to the 67X1 transgene cross-hybridized to our largest ALF5 cDNA clone, suggesting that they were representatives of a single gene transcript in 67X1. The predicted gene, MDB19.4, within the genomic sequence (GenBank a ...
                        	... GenBank sequence entries. All clones isolated from a cDNA library by hybridization to the 67X1 transgene cross-hybridized to our largest ALF5 cDNA clone, suggesting that they were representatives of a single gene transcript in 67X1. The predicted gene, MDB19.4, within the genomic sequence (GenBank a ...
									Construction of in vivo infectious clones of PRSV P-YK and W-CI
									
... segment including nts 1-621 of viral sequences were amplified by RT-PCR with upstream primer T3G22 (5'AAGCGCGCAATTAACCCTCACTAAAGAAAAATAAAACATCTCAACACA -3', containing BssHII site, the T3 promoter and first 22 nucleotide viral sequence) and downstream primer YKT7602 (5'GAGCGCGCGTAATACGACTCACTATAGGGCC ...
                        	... segment including nts 1-621 of viral sequences were amplified by RT-PCR with upstream primer T3G22 (5'AAGCGCGCAATTAACCCTCACTAAAGAAAAATAAAACATCTCAACACA -3', containing BssHII site, the T3 promoter and first 22 nucleotide viral sequence) and downstream primer YKT7602 (5'GAGCGCGCGTAATACGACTCACTATAGGGCC ...
									HOLINS: The Protein Clocks of Bacteriophage Infections
									
... Annu. Rev. Microbiol. 2000.54:799-825. Downloaded from www.annualreviews.org by UNIVERSITY OF IDAHO LIBRARY on 01/20/11. For personal use only. ...
                        	... Annu. Rev. Microbiol. 2000.54:799-825. Downloaded from www.annualreviews.org by UNIVERSITY OF IDAHO LIBRARY on 01/20/11. For personal use only. ...
									Isolation, Identification, and Enumeration of Pathogenic Salmonella
									
... Multiplex PCR Kit (Qiagen, Hilden, Germany) along with the appropriate primer set, all of which is contained in a sterilized 0.5 mL PCR tube (modified from Hassanein et al. 2011). PCR kits typically contain Taq polymerase (an enzyme that anneals nucleotides to DNA strands; capable of surviving the h ...
                        	... Multiplex PCR Kit (Qiagen, Hilden, Germany) along with the appropriate primer set, all of which is contained in a sterilized 0.5 mL PCR tube (modified from Hassanein et al. 2011). PCR kits typically contain Taq polymerase (an enzyme that anneals nucleotides to DNA strands; capable of surviving the h ...
									Modular Architecture of Metabolic Pathways Revealed by
									
... The KEGG atom type14 generally consists of three characters, such as N1a for primary amine nitrogen and C5a for ketone carbon. The first (upper case letter) indicates the atomic species, the second (numeral) represents the predefined class of atomic bonding for each atomic species, and the third (lowe ...
                        	... The KEGG atom type14 generally consists of three characters, such as N1a for primary amine nitrogen and C5a for ketone carbon. The first (upper case letter) indicates the atomic species, the second (numeral) represents the predefined class of atomic bonding for each atomic species, and the third (lowe ...
									CONSERVATION AND DIVERGENCE IN MOLECULAR
									
... of Spätzle protein to a 23-kD form by Easter (99, 147). When injected into the perivitelline space, cleaved Spätzle activates ventral development in both a site- and concentration-specific fashion (99). Genetic and biochemical evidence suggests that the cleaved and active form of Spätzle then act ...
                        	... of Spätzle protein to a 23-kD form by Easter (99, 147). When injected into the perivitelline space, cleaved Spätzle activates ventral development in both a site- and concentration-specific fashion (99). Genetic and biochemical evidence suggests that the cleaved and active form of Spätzle then act ...
									Protein Similarity Score - Santa Clara Law Digital Commons
									
... point mutants of the protein and screen these mutants to identify one that retains the desired function. Alternatively, a more sophisticated approach, such as DNA shuffling or molecular directed evolution, could be used to generate a variant having a large number of substitutions while still retaini ...
                        	... point mutants of the protein and screen these mutants to identify one that retains the desired function. Alternatively, a more sophisticated approach, such as DNA shuffling or molecular directed evolution, could be used to generate a variant having a large number of substitutions while still retaini ...
									A number of antibiotics produced by different - J
									
... resistant to rifamycin and, partially, to streptovaricin while S. hygroscopicas RNA polymerase was resistant to geldanamycin and, partially, to streptovaricin. On the other hand, the other ansamycin producer, S. spectabilis, was specifically resistant to streptovaricin. It is noteworthy that S. lydi ...
                        	... resistant to rifamycin and, partially, to streptovaricin while S. hygroscopicas RNA polymerase was resistant to geldanamycin and, partially, to streptovaricin. On the other hand, the other ansamycin producer, S. spectabilis, was specifically resistant to streptovaricin. It is noteworthy that S. lydi ...
									Kinds of gene rearrangement
									
... “Translocation” shows a segment of one chromosome terminally attached, usually to a heterologous chromosome (see especially PAINTER and MULLER1929). “Inversion” consists in a portion of the gene string or chromonema being turned round, end for end; genes being apparently sometimes lost in the proces ...
                        	... “Translocation” shows a segment of one chromosome terminally attached, usually to a heterologous chromosome (see especially PAINTER and MULLER1929). “Inversion” consists in a portion of the gene string or chromonema being turned round, end for end; genes being apparently sometimes lost in the proces ...
									This document has been downloaded from Tampub – The
									
... Detection System (Applied Biosystems, Foster City, CA). PCR reaction containing genomic DNA, 2 × TaqMan universal PCR Master Mix, 900 nM of each primer and 200 nM of each probe was performed in 96-well plates according to standard protocol in a total volume of 25 μl. After cycling, end-point fluores ...
                        	... Detection System (Applied Biosystems, Foster City, CA). PCR reaction containing genomic DNA, 2 × TaqMan universal PCR Master Mix, 900 nM of each primer and 200 nM of each probe was performed in 96-well plates according to standard protocol in a total volume of 25 μl. After cycling, end-point fluores ...
									Pairwise sequence alignments
									
... A substitution matrix in which scores for each position are derived from observations of the frequencies of substitutions in blocks of local alignments in related proteins. Each matrix is tailored to a particular evolutionary distance. In the BLOSUM62 matrix, for example, the alignment from which sc ...
                        	... A substitution matrix in which scores for each position are derived from observations of the frequencies of substitutions in blocks of local alignments in related proteins. Each matrix is tailored to a particular evolutionary distance. In the BLOSUM62 matrix, for example, the alignment from which sc ...
									Biotechnology Explorer™ GMO Investigator™ Kit: A - Bio-Rad
									
... the NOS terminator, and some foods contain both. By testing for both sequences in a single reaction, approximately 15% more GM foods can be detected than if only the CaMV 35S primers were used. Please note that foods with compound genetic modifications, such as corn, with both round-up ready resista ...
                        	... the NOS terminator, and some foods contain both. By testing for both sequences in a single reaction, approximately 15% more GM foods can be detected than if only the CaMV 35S primers were used. Please note that foods with compound genetic modifications, such as corn, with both round-up ready resista ...
									Antimicrobial Agents and Chemotherapy
									
... spectra were determined on a MS30 spectrometer at 28 eV and 200°. Per N-acetylated and per O-silylated derivatives were prepared (4) and used in this study. ...
                        	... spectra were determined on a MS30 spectrometer at 28 eV and 200°. Per N-acetylated and per O-silylated derivatives were prepared (4) and used in this study. ...
									Introduction Milk is the exclusive nutrient source for the neonate.  ... practices and availability of highly selected sows have allowed for...
									
... Alternative fates of BCAA in the mammary gland, depending upon the amino acid, may include synthesis of cellular protein, synthesis of nonessential amino acids, utilization in fatty acid synthesis, and oxidization as an energy source. Animal nutrition studies do not usually account for these alterna ...
                        	... Alternative fates of BCAA in the mammary gland, depending upon the amino acid, may include synthesis of cellular protein, synthesis of nonessential amino acids, utilization in fatty acid synthesis, and oxidization as an energy source. Animal nutrition studies do not usually account for these alterna ...
									Genetic mapping of mutations using phenotypic pools and
									
... markers detect differences in DNA sequence, and are thus less ambiguous than phenotypic markers, which require gene expression. We have demonstrated a molecular approach to the mapping of mutant genes using RAPD markers and pooling of Individuals based on phenotype. To map genes by phenotypic poolin ...
                        	... markers detect differences in DNA sequence, and are thus less ambiguous than phenotypic markers, which require gene expression. We have demonstrated a molecular approach to the mapping of mutant genes using RAPD markers and pooling of Individuals based on phenotype. To map genes by phenotypic poolin ...
									Meiosis - Myersbiology
									
... • Males are an expensive luxury - in most species they contribute little to rearing offspring. ...
                        	... • Males are an expensive luxury - in most species they contribute little to rearing offspring. ...
									2006 Program
									
... vaccine candidates by a functional genomic serologic screen” Darin E. Allen and Helmut Hirt “Role of dltA in Enterococcus faecalis virulence and analysis of upstream promoter region” Megan J. Kaltinger and Helmut Hirt “EbsG, a novel surface protein, is involved in the biology of lipoteichoic acid in ...
                        	... vaccine candidates by a functional genomic serologic screen” Darin E. Allen and Helmut Hirt “Role of dltA in Enterococcus faecalis virulence and analysis of upstream promoter region” Megan J. Kaltinger and Helmut Hirt “EbsG, a novel surface protein, is involved in the biology of lipoteichoic acid in ...
									The Nucleotide Sequence of a Type 3 Poliovirus Isolated During a
									
... between poliovirus strains. In particular, the 5' untranslated region and the non-structural proteins show an unexpectedly high degree of difference to P3/Leon/37. A comparison between the 5' untranslated regions of strain 23127 and the three poliovirus serotypes is presented diagrammatically in Fig ...
                        	... between poliovirus strains. In particular, the 5' untranslated region and the non-structural proteins show an unexpectedly high degree of difference to P3/Leon/37. A comparison between the 5' untranslated regions of strain 23127 and the three poliovirus serotypes is presented diagrammatically in Fig ...
									The Nucleotide Sequence of a Type 3 Poliovirus Isolated During a
									
... between poliovirus strains. In particular, the 5' untranslated region and the non-structural proteins show an unexpectedly high degree of difference to P3/Leon/37. A comparison between the 5' untranslated regions of strain 23127 and the three poliovirus serotypes is presented diagrammatically in Fig ...
                        	... between poliovirus strains. In particular, the 5' untranslated region and the non-structural proteins show an unexpectedly high degree of difference to P3/Leon/37. A comparison between the 5' untranslated regions of strain 23127 and the three poliovirus serotypes is presented diagrammatically in Fig ...
									Recurrent Pregnancy Loss and Its Relation to Combined Parental
									
... RPL is classically defined as the occurrence of three or more consecutive losses of clinically recognized pregnancies prior to the 20th week of gestation (ectopic and molar pregnancies are not included). The ASRM defines RPL as two or more failed pregnancies (by ultrasound or histopathological exami ...
                        	... RPL is classically defined as the occurrence of three or more consecutive losses of clinically recognized pregnancies prior to the 20th week of gestation (ectopic and molar pregnancies are not included). The ASRM defines RPL as two or more failed pregnancies (by ultrasound or histopathological exami ...