• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Chapter 5
Chapter 5

... Copyright © 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings ...
The Plant Cell
The Plant Cell

... GenBank sequence entries. All clones isolated from a cDNA library by hybridization to the 67X1 transgene cross-hybridized to our largest ALF5 cDNA clone, suggesting that they were representatives of a single gene transcript in 67X1. The predicted gene, MDB19.4, within the genomic sequence (GenBank a ...
Construction of in vivo infectious clones of PRSV P-YK and W-CI
Construction of in vivo infectious clones of PRSV P-YK and W-CI

... segment including nts 1-621 of viral sequences were amplified by RT-PCR with upstream primer T3G22 (5'AAGCGCGCAATTAACCCTCACTAAAGAAAAATAAAACATCTCAACACA -3', containing BssHII site, the T3 promoter and first 22 nucleotide viral sequence) and downstream primer YKT7602 (5'GAGCGCGCGTAATACGACTCACTATAGGGCC ...
HOLINS: The Protein Clocks of Bacteriophage Infections
HOLINS: The Protein Clocks of Bacteriophage Infections

... Annu. Rev. Microbiol. 2000.54:799-825. Downloaded from www.annualreviews.org by UNIVERSITY OF IDAHO LIBRARY on 01/20/11. For personal use only. ...
Isolation, Identification, and Enumeration of Pathogenic Salmonella
Isolation, Identification, and Enumeration of Pathogenic Salmonella

... Multiplex PCR Kit (Qiagen, Hilden, Germany) along with the appropriate primer set, all of which is contained in a sterilized 0.5 mL PCR tube (modified from Hassanein et al. 2011). PCR kits typically contain Taq polymerase (an enzyme that anneals nucleotides to DNA strands; capable of surviving the h ...
Gene Section HRK (harakiri, BCL2 interacting protein (contains only BH3 domain))
Gene Section HRK (harakiri, BCL2 interacting protein (contains only BH3 domain))

RNA Splicing
RNA Splicing

Modular Architecture of Metabolic Pathways Revealed by
Modular Architecture of Metabolic Pathways Revealed by

... The KEGG atom type14 generally consists of three characters, such as N1a for primary amine nitrogen and C5a for ketone carbon. The first (upper case letter) indicates the atomic species, the second (numeral) represents the predefined class of atomic bonding for each atomic species, and the third (lowe ...
The Relation between Multilocus Population Genetics and Social
The Relation between Multilocus Population Genetics and Social

CONSERVATION AND DIVERGENCE IN MOLECULAR
CONSERVATION AND DIVERGENCE IN MOLECULAR

... of Spätzle protein to a 23-kD form by Easter (99, 147). When injected into the perivitelline space, cleaved Spätzle activates ventral development in both a site- and concentration-specific fashion (99). Genetic and biochemical evidence suggests that the cleaved and active form of Spätzle then act ...
Protein Similarity Score - Santa Clara Law Digital Commons
Protein Similarity Score - Santa Clara Law Digital Commons

... point mutants of the protein and screen these mutants to identify one that retains the desired function. Alternatively, a more sophisticated approach, such as DNA shuffling or molecular directed evolution, could be used to generate a variant having a large number of substitutions while still retaini ...
A number of antibiotics produced by different - J
A number of antibiotics produced by different - J

... resistant to rifamycin and, partially, to streptovaricin while S. hygroscopicas RNA polymerase was resistant to geldanamycin and, partially, to streptovaricin. On the other hand, the other ansamycin producer, S. spectabilis, was specifically resistant to streptovaricin. It is noteworthy that S. lydi ...
Kinds of gene rearrangement
Kinds of gene rearrangement

... “Translocation” shows a segment of one chromosome terminally attached, usually to a heterologous chromosome (see especially PAINTER and MULLER1929). “Inversion” consists in a portion of the gene string or chromonema being turned round, end for end; genes being apparently sometimes lost in the proces ...
This document has been downloaded from Tampub – The
This document has been downloaded from Tampub – The

... Detection System (Applied Biosystems, Foster City, CA). PCR reaction containing genomic DNA, 2 × TaqMan universal PCR Master Mix, 900 nM of each primer and 200 nM of each probe was performed in 96-well plates according to standard protocol in a total volume of 25 μl. After cycling, end-point fluores ...
Pairwise sequence alignments
Pairwise sequence alignments

... A substitution matrix in which scores for each position are derived from observations of the frequencies of substitutions in blocks of local alignments in related proteins. Each matrix is tailored to a particular evolutionary distance. In the BLOSUM62 matrix, for example, the alignment from which sc ...
Biotechnology Explorer™ GMO Investigator™ Kit: A - Bio-Rad
Biotechnology Explorer™ GMO Investigator™ Kit: A - Bio-Rad

... the NOS terminator, and some foods contain both. By testing for both sequences in a single reaction, approximately 15% more GM foods can be detected than if only the CaMV 35S primers were used. Please note that foods with compound genetic modifications, such as corn, with both round-up ready resista ...
Antimicrobial Agents and Chemotherapy
Antimicrobial Agents and Chemotherapy

... spectra were determined on a MS30 spectrometer at 28 eV and 200°. Per N-acetylated and per O-silylated derivatives were prepared (4) and used in this study. ...
Introduction Milk is the exclusive nutrient source for the neonate.  ... practices and availability of highly selected sows have allowed for...
Introduction Milk is the exclusive nutrient source for the neonate. ... practices and availability of highly selected sows have allowed for...

... Alternative fates of BCAA in the mammary gland, depending upon the amino acid, may include synthesis of cellular protein, synthesis of nonessential amino acids, utilization in fatty acid synthesis, and oxidization as an energy source. Animal nutrition studies do not usually account for these alterna ...
Genetic mapping of mutations using phenotypic pools and
Genetic mapping of mutations using phenotypic pools and

... markers detect differences in DNA sequence, and are thus less ambiguous than phenotypic markers, which require gene expression. We have demonstrated a molecular approach to the mapping of mutant genes using RAPD markers and pooling of Individuals based on phenotype. To map genes by phenotypic poolin ...
Meiosis - Myersbiology
Meiosis - Myersbiology

... • Males are an expensive luxury - in most species they contribute little to rearing offspring. ...
2006 Program
2006 Program

... vaccine candidates by a functional genomic serologic screen” Darin E. Allen and Helmut Hirt “Role of dltA in Enterococcus faecalis virulence and analysis of upstream promoter region” Megan J. Kaltinger and Helmut Hirt “EbsG, a novel surface protein, is involved in the biology of lipoteichoic acid in ...
Simultaneous Alignment and Folding of Protein Sequences
Simultaneous Alignment and Folding of Protein Sequences

The Nucleotide Sequence of a Type 3 Poliovirus Isolated During a
The Nucleotide Sequence of a Type 3 Poliovirus Isolated During a

... between poliovirus strains. In particular, the 5' untranslated region and the non-structural proteins show an unexpectedly high degree of difference to P3/Leon/37. A comparison between the 5' untranslated regions of strain 23127 and the three poliovirus serotypes is presented diagrammatically in Fig ...
The Nucleotide Sequence of a Type 3 Poliovirus Isolated During a
The Nucleotide Sequence of a Type 3 Poliovirus Isolated During a

... between poliovirus strains. In particular, the 5' untranslated region and the non-structural proteins show an unexpectedly high degree of difference to P3/Leon/37. A comparison between the 5' untranslated regions of strain 23127 and the three poliovirus serotypes is presented diagrammatically in Fig ...
Recurrent Pregnancy Loss and Its Relation to Combined Parental
Recurrent Pregnancy Loss and Its Relation to Combined Parental

... RPL is classically defined as the occurrence of three or more consecutive losses of clinically recognized pregnancies prior to the 20th week of gestation (ectopic and molar pregnancies are not included). The ASRM defines RPL as two or more failed pregnancies (by ultrasound or histopathological exami ...
< 1 ... 86 87 88 89 90 91 92 93 94 ... 2254 >

Artificial gene synthesis

Artificial gene synthesis is a method in synthetic biology that is used to create artificial genes in the laboratory. Currently based on solid-phase DNA synthesis, it differs from molecular cloning and polymerase chain reaction (PCR) in that the user does not have to begin with preexisting DNA sequences. Therefore, it is possible to make a completely synthetic double-stranded DNA molecule with no apparent limits on either nucleotide sequence or size. The method has been used to generate functional bacterial or yeast chromosomes containing approximately one million base pairs. Recent research also suggests the possibility of creating novel nucleobase pairs in addition to the two base pairs in nature, which could greatly expand the possibility of expanding the genetic code.Synthesis of the first complete gene, a yeast tRNA, was demonstrated by Har Gobind Khorana and coworkers in 1972. Synthesis of the first peptide- and protein-coding genes was performed in the laboratories of Herbert Boyer and Alexander Markham, respectively.Commercial gene synthesis services are now available from numerous companies worldwide, some of which have built their business model around this task. Current gene synthesis approaches are most often based on a combination of organic chemistry and molecular biological techniques and entire genes may be synthesized ""de novo"", without the need for precursor template DNA. Gene synthesis has become an important tool in many fields of recombinant DNA technology including heterologous gene expression, vaccine development, gene therapy and molecular engineering. The synthesis of nucleic acid sequences is often more economical than classical cloning and mutagenesis procedures.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report