• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Acetyl-CoA
Acetyl-CoA

... transsulfurase exists in extrahepatic tissue. 2)Under starveling condition, ketogenesis is increased. This allows the heart ,the brain and skeletal muscles use ketone bodies as energy. ...
Single-strain improved oral cholera vaccine : scientific report
Single-strain improved oral cholera vaccine : scientific report

... both for use in cholera outbreaks and in mass vaccination campaigns. The main goal of the project has been to develop a simplified killed oral cholera vaccine based on a single Vibrio cholerae O1 vaccine strain and a single inactivation method, which could replace three virulent O1 strains inactivat ...
Interaction of Sesbania Mosaic Virus Movement Protein
Interaction of Sesbania Mosaic Virus Movement Protein

... and dynamic process which involves functional contribution from many proteins of viral and host origin [2]. A number of RNA viruses have been identified which require an MP and two or more additional proteins for effective cell-to-cell spread of their genetic material. For example, in the case of po ...
VITAMINS-6
VITAMINS-6

MÉu b×a luËn v¨n th¹c sÜ cã in ch÷ nhò khæ 210x297mm
MÉu b×a luËn v¨n th¹c sÜ cã in ch÷ nhò khæ 210x297mm

... CCAGTTGGTTGACAATTGGAAT ...
Structure and function of the GINS complex, a key component of the
Structure and function of the GINS complex, a key component of the

... form of the Psf1 protein was affinity-purified under native conditions from exponentially growing yeast cells and was shown to co-purify with Sld5 and Psf3, as well as with a novel 213-amino-acid protein later designated Psf2 [5]. Overproduction of PSF2, like PSF1, was also shown to be able to suppr ...
SARS Outbreaks in Ontario, Hong Kong and Singapore
SARS Outbreaks in Ontario, Hong Kong and Singapore

... • Diploid (2n): An organism or cell having two sets of chromosomes or twice the haploid number • Haploid (n): An organism or cell having only one complete set of chromosomes • Gamete: Reproductive cells involved in fertilization. The ovum is the female gamete; the spermatozoon is the male gamete. • ...
Inheritance of Aldehyde Oxidase in Drosophila melanogaster
Inheritance of Aldehyde Oxidase in Drosophila melanogaster

... areas of genetic research. The study of genetics focuses on an understanding of the principles which govern the inheritance of specific traits. Initial experiments were concerned with the transmission of hereditary factors from generation to generation and led to the discovery of specific laws which ...
Analyses of the E3 ubiquitin-ligase target adapter
Analyses of the E3 ubiquitin-ligase target adapter

... Ubiquitylation, the attachment of ubiquitin to proteins to mark for degradation by proteasomes, is crucial for proper organism function. One family of complexes that play a role in this process is the BTB/Cullin 3/RBX E3 ubiquitinprotein ligases. Three proteins; a BTB (Bric-a-Brac, Tramtrack, Broad ...
TFE3 contains two activation domains, one acidic and the other
TFE3 contains two activation domains, one acidic and the other

... protein containing 102 amino acids from the C-terminus of TFE3 isolating a GAL4 site pentamer from G5E4T (gift of M. Carey) by digestion with Xbal and HindSM. This fragment was cloned by fused to the GAL4 DBD activated transcription to a similar extent, 284-fold. For comparison, activation is shown ...
Abdominal Aortic Aneurysms(AAA)
Abdominal Aortic Aneurysms(AAA)

... - BAVD is the most common congenital cardiac malformation, affecting 1–2% of the population. - BAVD is highly associated with other congenital aorta abnormalities, such as coarctation , dilatation of the aortic root or ascending aorta and may progress to frank thoracic aortic aneurysms and aortic di ...
Is HP1 an RNA detector that functions both in repression and
Is HP1 an RNA detector that functions both in repression and

Specific PCR Primers for the Identification of Salmonella enterica
Specific PCR Primers for the Identification of Salmonella enterica

Ab Initio Modeling of Biological Systems - Psi-k
Ab Initio Modeling of Biological Systems - Psi-k

... However, there are many areas in which the use of effective potentials may be not appropriate, and more sophisticated and accurate approaches are required. An alternative is offered by ab initio molecular dynamics (AIMD). AIMD in the Born-Oppheneimer approximation can be efficiently performed using ...
ppt
ppt

... 8.19 A karyotype is a photographic inventory of an individual’s chromosomes  A karyotype shows stained and magnified versions of chromosomes – Karyotypes are produced from dividing white blood cells, stopped at metaphase – Karyotypes allow observation of – Homologous chromosome pairs – Chromosome ...
Circulation Research Classics
Circulation Research Classics

... role of the RAS in various physiological and pathological processes in multiple organs, the discovery and characterization of the ACE2 pathway might have implications well beyond cardiovascular medicine. Perhaps, deletion of the Mas1 gene, coding for the Ang 1-7 receptor, or the Ace2 gene provides g ...
*** 1
*** 1

... compounds. Apical abortion in broccoli is a highly destructive disorder which occurs in transplants. However, little is known about the genetic and environmental factors that affect apical abortion. In this study, we characterized the broccoli cultivars with healthy and aborted shoots by using compa ...
The endogenous molecular clock orchestrates the temporal
The endogenous molecular clock orchestrates the temporal

Chylomicron Remnants and Nonesterified Fatty Involved in Lipogenesis in Rats
Chylomicron Remnants and Nonesterified Fatty Involved in Lipogenesis in Rats

... Virginia University approved all experimental procedures. Hepatocytes were isolated from male Sprague-Dawley rat (150–200 g) livers by a modification of the method of Seglen (22), as described previously (23). Hepatocytes (3 3 106) were plated onto 60-mm collagen-coated plates in Hi/Wo/Ba medium [Wa ...
The origin of eukaryotes and their relationship with the Archaea: are
The origin of eukaryotes and their relationship with the Archaea: are

... are arbitrary. For simplicity, the root of the universal tree of life has been placed in the bacterial branch, but note that alternative rootings in the lineage leading to the Eukarya102–104 or within the Bacteria58,105 have been proposed. This scenario implies that such an ancestor was very likely ...


... genotype. Since norms of reaction of different genotypes are curves of irregular shape that cross each other, it is not possible to predict the phenotypes of different genotypes in new environments. Indeed, the outcome of development of any genotype is a unique consequence of the interaction between g ...
Precious Pearls - Sun Colors Ranch LLC
Precious Pearls - Sun Colors Ranch LLC

... palomino mare, which at the time wasn’t very desirable like it is now. Now it’s the rage. “At the time, anything lighter [than a palomino or dun] was not desirable. Now it’s hot property. Had we known what a goldmine we had, well, we could have added a lot more of the light colors to the breeds. All ...
Time course of differential mitochondrial energy metabolism
Time course of differential mitochondrial energy metabolism

... time of 21 days. Indeed, regarding the time course of CHinduced pulmonary hypertension, we have previously observed that RV hypertrophy increases linearly with the duration of exposure to CH from 1 to 3 weeks and then remains stable up to 4 weeks [10]. Our results indicate that CH decreases ATP synt ...
Effects of muscle fiber type on glycolytic potential and
Effects of muscle fiber type on glycolytic potential and

... mRNA concentrations than other muscles (P < 0.01) (Figure 1A and 1B). The longissimus dorsi, obliquus externus abdominis, and semitendinosus muscles had higher MyHC IIb concentrations than other muscles (P < 0.01) (Figure 1C). The absolute amounts of MyHC IIx were highest in psoas major and semimemb ...
INVESTIGATING THE IMPORTANCE OF ANATOMICAL
INVESTIGATING THE IMPORTANCE OF ANATOMICAL

... literature.16 Here, we present results for a commonly used measure, SimIC , which is based on the concept of Information Content (IC), or the specificity of the match between two annotations relative to a chosen annotation corpus.17 We also examined another commonly used measure, Jaccard similarity ...
< 1 ... 130 131 132 133 134 135 136 137 138 ... 2254 >

Artificial gene synthesis

Artificial gene synthesis is a method in synthetic biology that is used to create artificial genes in the laboratory. Currently based on solid-phase DNA synthesis, it differs from molecular cloning and polymerase chain reaction (PCR) in that the user does not have to begin with preexisting DNA sequences. Therefore, it is possible to make a completely synthetic double-stranded DNA molecule with no apparent limits on either nucleotide sequence or size. The method has been used to generate functional bacterial or yeast chromosomes containing approximately one million base pairs. Recent research also suggests the possibility of creating novel nucleobase pairs in addition to the two base pairs in nature, which could greatly expand the possibility of expanding the genetic code.Synthesis of the first complete gene, a yeast tRNA, was demonstrated by Har Gobind Khorana and coworkers in 1972. Synthesis of the first peptide- and protein-coding genes was performed in the laboratories of Herbert Boyer and Alexander Markham, respectively.Commercial gene synthesis services are now available from numerous companies worldwide, some of which have built their business model around this task. Current gene synthesis approaches are most often based on a combination of organic chemistry and molecular biological techniques and entire genes may be synthesized ""de novo"", without the need for precursor template DNA. Gene synthesis has become an important tool in many fields of recombinant DNA technology including heterologous gene expression, vaccine development, gene therapy and molecular engineering. The synthesis of nucleic acid sequences is often more economical than classical cloning and mutagenesis procedures.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report