• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Enzyme Complete ppt
Enzyme Complete ppt

... • facilitate chemical reactions • increase rate of reaction without being consumed • reduce activation energy • don’t change free energy (G) released or required ...
SBI4U Translation
SBI4U Translation

... Try This! • The following is the sequence of the coding DNA strand in a prokaryote • Determine the sequence of the transcribed mRNA • Then, using the Genetic Code on p240, determine the polypeptide chain • How do you know where to start? 5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3’ ...
Formation and nuclear export of tRNA, rRNA and mRNA is regulated
Formation and nuclear export of tRNA, rRNA and mRNA is regulated

... (O’Connor & Peebles, 1991). An additional potential substrate for Rsp5p is a protein component of RNase P, since both the activity and maturation of this complex were inhibited. The depletion of the mature RNase P RNA did not, however, appear to be sufficient to account for the dramatic pre-tRNA acc ...
Chapter 10
Chapter 10

... – begins with the formation of a peptide bond between the methionine and the second amino acid – the process involves the addition of a sequence of amino acids, specified by the codons – as each new amino acid is brought into position, a peptide bond is formed with the preceding amino acid – transla ...
Getting to the Roof of our Problem: Human Malformations of the Mid
Getting to the Roof of our Problem: Human Malformations of the Mid

... “available” for JS for the NPHP1 and AHI1 genes, accounting for <15% of JS • Specific gene testing may be indicated if an older sibling has a mutation in a known JS gene ...
RIBOSWITCHES - Creighton Chemistry Webserver
RIBOSWITCHES - Creighton Chemistry Webserver

... provided a wealth of information regarding RNA structure and ligand interaction ...
2 SINGLE-MOLECULE DNA:PROTEIN INTERACTIONS - VU-dare
2 SINGLE-MOLECULE DNA:PROTEIN INTERACTIONS - VU-dare

... In addition to the advantages discussed above, certain single-molecule techniques provide the unique ability to apply forces and to measure tension. The information that may be accessed by means of force is extremely rich: one can measure the forces generated by DNA-protein complexes to unravel thei ...
Graph-based Methods for the Design of DNA - TUBdok
Graph-based Methods for the Design of DNA - TUBdok

... DNA computing is a rapidly evolving field utilizing DNA molecules instead of silicon-based electronic units to perform calculations. The reliability of such computations strongly depends on the DNA sequences that represent units of information. Recently, the thermodynamic constraints, based on the f ...
Structure-Function Studies of Bacteriophage P2 Integrase and Cox Protein
Structure-Function Studies of Bacteriophage P2 Integrase and Cox Protein

... phage, P4. P4 has gained the ability to adopt the P2 protein machinery to its own purposes. In this work the importance of the native size for biologically active integrase and Cox proteins has been determined. Further, structure-function analyses of the two proteins have been performed with focus o ...
Mike Goatley Bermudagrass Off
Mike Goatley Bermudagrass Off

... 3 contains more than 27 chromosomes and could possibly be an aneuploid. A conventional chromosome count is needed to determine its exact number. If it should turn out to be an even tetraploid (2n=4x=36), then we would conclude that offtype 3 most likely originated from a contaminant seed. At this ti ...
Vitis 37 (3), 119
Vitis 37 (3), 119

... The electrophoretically detected degree of genetic similarity between each pair of cultivars studied (Tab. 2) was calculated using the NTSYS-pc package 1.8 developed by ROHFL (Exeter Software, New York, USA). ...
No Slide Title
No Slide Title

... (XPA +/+), were heterozygous for XPA ( XPA +/-), or had nonfunctional XPA ( XPA -/-) . •The purpose of the experiment was to compare the effects of UVB light and carcinogen exposure in the three different groups. ...
Genetics Review Questions PPT
Genetics Review Questions PPT

... fight. What molecule contained all the information necessary to make a new leg? A. protein ...
Lecture 5 Natural selection – theory and definitions
Lecture 5 Natural selection – theory and definitions

... Inference 3. Over many generations, evolutionary change must occur in the population. ...
Nongenic transcription, gene regulation and action at a distance
Nongenic transcription, gene regulation and action at a distance

... discuss recent evidence showing that many regulatory motifs acting at a distance are transcription units, and that clusters of such units organize the chromatin fibre into loops. I suggest that the act of transcription of the regulatory motifs underlies the way they work and constitutes an under-rec ...
PowerPoint 演示文稿
PowerPoint 演示文稿

... • no need to design and test several siRNA sequences before an effective one can be identified • the theoretical potential for nonspecific silencing effects • Best for: Fast and inexpensive analysis of loss of function ...
Molecular analysis of putative genetic factors affecting BSE
Molecular analysis of putative genetic factors affecting BSE

... were taken from BSE cases slaughtered in the field and thus was sometimes in poor condition when it reached the laboratory. Some of the samples were 6 years old and in very limited supply when used so the purity could not be improved. Given this variability between samples the study was continued by ...
Molecular Cloning and Nucleotide Sequence of the 3
Molecular Cloning and Nucleotide Sequence of the 3

... sequences of HindIII-CluI, CluI-EcoRI, EcoRI-BglII and BglII-Hind111 fragments could be clearly read from one end to the other. However, if there were two proximal CluI sites or an EcoRI or BglII site which could not be detected by mapping with restriction endonucleases, they would be missed. To tes ...
Molecular Cloning of engrafted: A Gene Involved in the
Molecular Cloning of engrafted: A Gene Involved in the

... Comparison of restriction digests and hybridization analyses indicated when the two separate walks overlapped. A total of 225 kb of DNA was cloned from the 48AB region (Figure 2) and 205 kb were found to be deleted by en sF31. It is notable that in the course of this work a number of different chrom ...
Prof. Kamakaka`s Lecture 6 Notes
Prof. Kamakaka`s Lecture 6 Notes

... Much of this energy comes from binding energy (DGB) contributed by formation of weak noncovalent interactions between substrate and enzyme in the transition state. ...
Determinants of  mRNA  localization University
Determinants of mRNA localization University

... Therefore, mRNA localization may serve to increase local intracellular concentrations to promote these interactions. Conversely, the effects of non-localized protein synthesis may cause non-productive, promiscuous interactions between polypeptides, or lethal consequences in the case of morphogens. A ...
An Innovative Anion Regulation Strategy for Energy Bands of
An Innovative Anion Regulation Strategy for Energy Bands of

Alkaline Southern Blotting Kit with 11 × 14 cm BioBond™ Plus
Alkaline Southern Blotting Kit with 11 × 14 cm BioBond™ Plus

... Southern blotting of deoxyribonucleic acids on solid supports is an integral part of any laboratory using molecular biology techniques. Sigma’s Alkaline Southern Breeze™ blotting kits provide standard reagents for transfer in convenient single use packages. Additionally, the kit components have been ...
ch 5 presentation
ch 5 presentation

... surgical thread that decomposes after the wound or incision heals. ...
PPT File
PPT File

... surgical thread that decomposes after the wound or incision heals. ...
< 1 ... 96 97 98 99 100 101 102 103 104 ... 1026 >

Deoxyribozyme



Deoxyribozymes, also called DNA enzymes, DNAzymes, or catalytic DNA, are DNA oligonucleotides that are capable of catalyzing specific chemical reactions, similar to the action of other biological enzymes, such as proteins or ribozymes (enzymes composed of RNA).However, in contrast to the abundance of protein enzymes in biological systems and the discovery of biological ribozymes in the 1980s,there are no known naturally occurring deoxyribozymes.Deoxyribozymes should not be confused with DNA aptamers which are oligonucleotides that selectively bind a target ligand, but do not catalyze a subsequent chemical reaction.With the exception of ribozymes, nucleic acid molecules within cells primarily serve as storage of genetic information due to its ability to form complementary base pairs, which allows for high-fidelity copying and transfer of genetic information. In contrast, nucleic acid molecules are more limited in their catalytic ability, in comparison to protein enzymes, to just three types of interactions: hydrogen bonding, pi stacking, and metal-ion coordination. This is due to the limited number of functional groups of the nucleic acid monomers: while proteins are built from up to twenty different amino acids with various functional groups, nucleic acids are built from just four chemically similar nucleobases. In addition, DNA lacks the 2'-hydroxyl group found in RNA which limits the catalytic competency of deoxyribozymes even in comparison to ribozymes.In addition to the inherent inferiority of DNA catalytic activity, the apparent lack of naturally occurring deoxyribozymes may also be due to the primarily double-stranded conformation of DNA in biological systems which would limit its physical flexibility and ability to form tertiary structures, and so would drastically limit the ability of double-stranded DNA to act as a catalyst; though there are a few known instances of biological single-stranded DNA such as multicopy single-stranded DNA (msDNA), certain viral genomes, and the replication fork formed during DNA replication. Further structural differences between DNA and RNA may also play a role in the lack of biological deoxyribozymes, such as the additional methyl group of the DNA base thymidine compared to the RNA base uracil or the tendency of DNA to adopt the B-form helix while RNA tends to adopt the A-form helix. However, it has also been shown that DNA can form structures that RNA cannot, which suggests that, though there are differences in structures that each can form, neither is inherently more or less catalytic due to their possible structural motifs.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report