pdf format - Faculty members Homepages
... phosphorylation (1). Evidence suggests that these covalent modifications play important roles in several biological activities involving chromatin, e.g., transcription and replication (2). Histone deacetylases (HDACs) catalyze the removal of the acetyl group from the lysine residues in the N-termina ...
... phosphorylation (1). Evidence suggests that these covalent modifications play important roles in several biological activities involving chromatin, e.g., transcription and replication (2). Histone deacetylases (HDACs) catalyze the removal of the acetyl group from the lysine residues in the N-termina ...
Cloning and characterization of the Xenopus laevis p8 gene
... it is likely to be a transcription factor. The DNAbinding activity of human p8 is increased with phosphorylation (Encinar et al. 2001) and, while we could not identify any putative phosphorylation sites on Xp8, there were a couple of well-conserved amino acids outside the bHLH region (Fig. 2a) that ...
... it is likely to be a transcription factor. The DNAbinding activity of human p8 is increased with phosphorylation (Encinar et al. 2001) and, while we could not identify any putative phosphorylation sites on Xp8, there were a couple of well-conserved amino acids outside the bHLH region (Fig. 2a) that ...
Prediction for Essential Proteins with the Support Vector Machine
... protein essentiality is one of the studies on protein phenotype. When an essential protein is removed, it will cause the cell to lose its life or functionality because the function of the essential protein cannot be replaced by other proteins. Essential proteins can be identified by the experiment w ...
... protein essentiality is one of the studies on protein phenotype. When an essential protein is removed, it will cause the cell to lose its life or functionality because the function of the essential protein cannot be replaced by other proteins. Essential proteins can be identified by the experiment w ...
Nitrogen Metabolism
... • Proteins have different biological value (BV) • Major reasons why animal protein is called BV protein, whereas plant protein is of lower BV: – Animal protein is “complete” - contains all essential amino acids – Contains essential amino acids in larger amounts and in proper ...
... • Proteins have different biological value (BV) • Major reasons why animal protein is called BV protein, whereas plant protein is of lower BV: – Animal protein is “complete” - contains all essential amino acids – Contains essential amino acids in larger amounts and in proper ...
Bacterial and Firefly Luciferase Genes in Transgenic Plants
... It has been realized early that a number of sensitive assays, such as determination of the concentration of O,, anaesthetics, antibiotics, mutagens, etc., can be carried out in vivo by expression of luciferases in living cells [Hastings and Nealson, 19771. Cloning of luciferase genes opened the way ...
... It has been realized early that a number of sensitive assays, such as determination of the concentration of O,, anaesthetics, antibiotics, mutagens, etc., can be carried out in vivo by expression of luciferases in living cells [Hastings and Nealson, 19771. Cloning of luciferase genes opened the way ...
Proteins
... concentrations of inorganic electrolytes and nonprotein organic compounds do not vary appreciably from sample to sample, and that differences in the refractive index reflect primarily differences in protein concentration. ...
... concentrations of inorganic electrolytes and nonprotein organic compounds do not vary appreciably from sample to sample, and that differences in the refractive index reflect primarily differences in protein concentration. ...
SnRK1 Isoforms AKIN10 and AKIN11 Are
... The results presented so far suggest that SnRK1 complexes are formed with the AKIN10 catalytic subunit under Pi starvation. To better understand the role of AKIN10 during Pi starvation, a T-DNA insertion line in akin10 was identified and characterized. In addition, RT-PCR, using gene-specific primer ...
... The results presented so far suggest that SnRK1 complexes are formed with the AKIN10 catalytic subunit under Pi starvation. To better understand the role of AKIN10 during Pi starvation, a T-DNA insertion line in akin10 was identified and characterized. In addition, RT-PCR, using gene-specific primer ...
INFORMATION FOR FOREIGN STUDENTS
... 1. Get the electrophoresis unit ready prior to experiment. Fill it with a veronal-medinal buffer pH 8.6 and place «wicks» consisting of several layers of filter paper to ensure contact between the supporting medium and the insulating plate. 2. Pencil a "start" mark on a dry cellulose acetate membran ...
... 1. Get the electrophoresis unit ready prior to experiment. Fill it with a veronal-medinal buffer pH 8.6 and place «wicks» consisting of several layers of filter paper to ensure contact between the supporting medium and the insulating plate. 2. Pencil a "start" mark on a dry cellulose acetate membran ...
Bacterial Ribosomes and Protein Synthesis
... majority of the 7 0 s ribosomes to 50 S +30S particles. It was estimated that 5-10 yo of the ribosomes might be in a non-dissociating, ‘active 708’ form. 308 and 5 0 8 particles had been previously shown to reassociate to 708 when the Mga+concentration was restored to 0.01 M but this procedure did n ...
... majority of the 7 0 s ribosomes to 50 S +30S particles. It was estimated that 5-10 yo of the ribosomes might be in a non-dissociating, ‘active 708’ form. 308 and 5 0 8 particles had been previously shown to reassociate to 708 when the Mga+concentration was restored to 0.01 M but this procedure did n ...
Chapter 12 Lecture Notes: Metabolism – Enzyme and Gene
... 4. Now the question became, what prevents termination of transcription in the absence of Trp (or what causes termination in the presence of Trp)? Yanofsky et al proposed a model based on sequence analysis and site directed mutagenesis in the attenuator region. The model was based on the secondary s ...
... 4. Now the question became, what prevents termination of transcription in the absence of Trp (or what causes termination in the presence of Trp)? Yanofsky et al proposed a model based on sequence analysis and site directed mutagenesis in the attenuator region. The model was based on the secondary s ...
Bacterial Ribosomes and Protein Synthesis
... majority of the 7 0 s ribosomes to 50 S +30S particles. It was estimated that 5-10 yo of the ribosomes might be in a non-dissociating, ‘active 708’ form. 308 and 5 0 8 particles had been previously shown to reassociate to 708 when the Mga+concentration was restored to 0.01 M but this procedure did n ...
... majority of the 7 0 s ribosomes to 50 S +30S particles. It was estimated that 5-10 yo of the ribosomes might be in a non-dissociating, ‘active 708’ form. 308 and 5 0 8 particles had been previously shown to reassociate to 708 when the Mga+concentration was restored to 0.01 M but this procedure did n ...
Name: TF Name: 1
... Using the information in the chart above, briefly explain why each experiment makes the protein binding interaction more or less favorable. In the control experiment with wild-type proteins, the positively-charged lysine makes an ionic bond with the negatively-charged glutamate. In experiment 1, lys ...
... Using the information in the chart above, briefly explain why each experiment makes the protein binding interaction more or less favorable. In the control experiment with wild-type proteins, the positively-charged lysine makes an ionic bond with the negatively-charged glutamate. In experiment 1, lys ...
PDF - Biotechnology for Biofuels
... vector given its pollution-free combustion and the ease with which it can be converted into electricity via fuel cells. However, current industrial hydrogen production processes, such as steam reforming of natural gas, release large quantities of CO2 and thereby contribute substantially to the green ...
... vector given its pollution-free combustion and the ease with which it can be converted into electricity via fuel cells. However, current industrial hydrogen production processes, such as steam reforming of natural gas, release large quantities of CO2 and thereby contribute substantially to the green ...
Task - The British Association of Sport and Exercise Sciences
... (3) During translation, an amino acid chain (peptide chain, protein) is synthesized by the ribosome. The mRNA serves as a template. ...
... (3) During translation, an amino acid chain (peptide chain, protein) is synthesized by the ribosome. The mRNA serves as a template. ...
Shetti, a simple tool to parse, manipulate and search large datasets
... sequences. The Shetti tool can be used to search for a sequence, species, protein/gene or pattern/motif. Moreover, it can also be used to construct a universal consensus or molecular signatures for proteins based on their physical characteristics. Shetti is an efficient and fast tool that can deal w ...
... sequences. The Shetti tool can be used to search for a sequence, species, protein/gene or pattern/motif. Moreover, it can also be used to construct a universal consensus or molecular signatures for proteins based on their physical characteristics. Shetti is an efficient and fast tool that can deal w ...
Tyrosine cross-linking of extracellular matrix is catalyzed by Duox, a
... levels of reactive oxygen species participate in bacterial killing. In recent years, it has become clear that nonphagocytic cells also generate reactive oxygen, albeit at lower levels (Cross and Jones, 1991). The origin and function of this reactive oxygen has not been clear and has been attributed ...
... levels of reactive oxygen species participate in bacterial killing. In recent years, it has become clear that nonphagocytic cells also generate reactive oxygen, albeit at lower levels (Cross and Jones, 1991). The origin and function of this reactive oxygen has not been clear and has been attributed ...
Proteins with
... Sequence searches and alignments using DNA/RNA are usually not as informative as searches and alignments using protein sequences. However. DNA/RNA searches are intuitively easier to understand: AGGCTTAGCAAA........TCAGGGCCTAATGCG ...
... Sequence searches and alignments using DNA/RNA are usually not as informative as searches and alignments using protein sequences. However. DNA/RNA searches are intuitively easier to understand: AGGCTTAGCAAA........TCAGGGCCTAATGCG ...
Red/ET Recombination
... Any DNA molecule in E. coli of almost any size can be engineered at any site using Red/ET. Recombineering therefore permits more DNA engineering freedom than any other technology and has become an essential component of the molecular biological tool kit. Recombineering can easily be deployed alongsi ...
... Any DNA molecule in E. coli of almost any size can be engineered at any site using Red/ET. Recombineering therefore permits more DNA engineering freedom than any other technology and has become an essential component of the molecular biological tool kit. Recombineering can easily be deployed alongsi ...
Journal of Applied Phycology
... DNA digested with BglII was ligated to BamHI digested pUC19. The clones were screened by carrying out PCR with two consensus recA primers (A: 5' CTCCATGCGATCGCCGAAGT 3' and B: 5' GGTITGGATGCGGCGGATATCTA 3') which were based on the conserved amino acid sequences LHAIAEV and LDIRRIQT in the Anabaena v ...
... DNA digested with BglII was ligated to BamHI digested pUC19. The clones were screened by carrying out PCR with two consensus recA primers (A: 5' CTCCATGCGATCGCCGAAGT 3' and B: 5' GGTITGGATGCGGCGGATATCTA 3') which were based on the conserved amino acid sequences LHAIAEV and LDIRRIQT in the Anabaena v ...
Using the Inquiry Page in a High School Classroom
... weight gain. CF patients have salt crystal formation on their skin when they sweat excessively. CF slide show available at: http://www.healthcentral.com/library/April_03/flash_co ntent/hcplay.asp?id=110 ...
... weight gain. CF patients have salt crystal formation on their skin when they sweat excessively. CF slide show available at: http://www.healthcentral.com/library/April_03/flash_co ntent/hcplay.asp?id=110 ...
Cloning, Functional Characterization and Site
... skeletons. It could convert different hydroxycinnamyl substrates into Coenzyme A (CoA)-linked intermediates (Figure 1). In view of the 4CL committed roles in biosynthetic pathway of phenylpropanoid-derived metabolites, there have been a lot of reports about the cloning and identification of 4CLs fro ...
... skeletons. It could convert different hydroxycinnamyl substrates into Coenzyme A (CoA)-linked intermediates (Figure 1). In view of the 4CL committed roles in biosynthetic pathway of phenylpropanoid-derived metabolites, there have been a lot of reports about the cloning and identification of 4CLs fro ...
Back-translation Using First Order Hidden Markov Models
... of the same species of plant), we expected a minuscule error rate in our backtranslated output in each of the three scenarios. Further, we predicted that the Spanish training set would give the most accurate back-translation of the three sets and the Russian set would give the least accurate. Surpr ...
... of the same species of plant), we expected a minuscule error rate in our backtranslated output in each of the three scenarios. Further, we predicted that the Spanish training set would give the most accurate back-translation of the three sets and the Russian set would give the least accurate. Surpr ...
Costs of life - Dynamics of the protein inventory of
... of data-independent acquisition methods such as LC-MSE 20,21. Complemented with the Hi3 absolute quantification18 even more comprehensive quantitative data sets can be generated22. However, there are only very few studies that combine the dynamics of the entire protein inventory with interpretation ...
... of data-independent acquisition methods such as LC-MSE 20,21. Complemented with the Hi3 absolute quantification18 even more comprehensive quantitative data sets can be generated22. However, there are only very few studies that combine the dynamics of the entire protein inventory with interpretation ...
The Construction of GFP Fusion Genes For Transgenically Labeled
... PAC clone 239-9P was identified (Figure 8). A GFAP 5' UTR probe hybridized to a 10 kb Nco I and a 2 kb Nco I Sac I fragment. These fragments were chosen for subcloning and testing because they were small enough to be cloned easily, yet large enough to potentially contain the entire set of cis-acting ...
... PAC clone 239-9P was identified (Figure 8). A GFAP 5' UTR probe hybridized to a 10 kb Nco I and a 2 kb Nco I Sac I fragment. These fragments were chosen for subcloning and testing because they were small enough to be cloned easily, yet large enough to potentially contain the entire set of cis-acting ...
... Sonesson M, Eliasson L, Matsson L. (2003) Minor salivary gland secretion in children and adults. Arch Oral Biol. 48: 535-539. Sonesson M, Wickström C, Kinnby B, Ericson D, Matsson L. (2008) Mucins MUC5B and MUC7 in minor salivary gland secretion of children and adults. Arch Oral Biol. 53: 523-527. ...