• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Biotechnology - Department of Plant Biology
Biotechnology - Department of Plant Biology

... chromosome of the bacterium E. coli has 4.7 million base pairs and thousands of genes, but a plasmid might have only 2,000 base pairs and 2 genes (see Fig. 19.3). This makes the plasmid more stable in a test tube and easier to analyze. Furthermore, bacterial cells can be induced to take up circular ...
Multiplexing of DELFIA® Cell Proliferation and DNA
Multiplexing of DELFIA® Cell Proliferation and DNA

... detected using a labeled antibody. The DNA Fragmentation assay is a cell-based assay performed in 96-well micro plate format for quantitative detection of apoptosis. The labeling of the 3’-hydroxyl ends of DNA fragments provides a measure of cells undergoing apoptosis. Incorporated, labeled nucleoti ...
G NOME® Whole Blood DNA Isolation Kit
G NOME® Whole Blood DNA Isolation Kit

... hereunder shall be limited to, at our option, product credits, refund of the purchase price of, or the replacement of all material(s) that does not meet our specification. By acceptance of the product, Buyer indemnifies and holds BIO 101 harmless against, and assumes all liability for the consequenc ...
chapter 20 - Elizabeth C-1
chapter 20 - Elizabeth C-1

...  In addition to uncovering gene interactions and providing clues to gene function, DNA microarray assays may contribute to a better understanding of certain diseases and suggest new diagnostic techniques or therapies. o Comparing patterns of gene expression in breast cancer tumors and noncancerous ...
FinalReview
FinalReview

... bowls, dental plaque ...
5`ccugaugcaugccuagaugccauaacgggcuuaaauagauga3`
5`ccugaugcaugccuagaugccauaacgggcuuaaauagauga3`

... a) To show that there is an interaction between the protein of interest and the protein expressed by the “fish” construct. b) To ensure that the yeast also have both the fish and the bait plasmid. c) To show that there is an interaction between the DNA binding domain of the “bait” construct and the ...
Study Guide B
Study Guide B

DNA Translocation Through Nanopores
DNA Translocation Through Nanopores

... Optical tweezers forces measurements on a single dsDNA revealed a strong increase of the threading force upon decreasing the diameter of the pore. This can be attributed to a reduction of the electroosmotic flow in smaller pores, which always opposes the electrostatic force acting on the DNA molecul ...
Genes Are DNA
Genes Are DNA

recombinant DNA
recombinant DNA

Domain Bacteria
Domain Bacteria

...  ___________ are short, hairlike projections that help bacteria ______________ __________________ and to host cells and other surfaces.  Can _________________________ to pass genetic material  Endospores  _____________________ form in ___________________________________ when environmental condit ...
Uracil-DNA Glycosylase (UDG)
Uracil-DNA Glycosylase (UDG)

... Protocol: Preventing Carry-over Contamination with Uracil-DNA Glycosylase In PCRs even minuscule amounts of a contaminant can be amplified and lead to a false positive result. Such contaminants are often come from previous PCRs (carry-over contamination). Therefore, researchers have developed method ...
Comp 5a Packet
Comp 5a Packet

... So, now, we know the nucleus controls the cell's activities through the chemical DNA, but how? It is the sequence of bases that determine which protein is to be made. The sequence is like a code that we can now interpret. The sequence determines which proteins are made and the proteins determine whi ...
PCR (Polymerase Chain Reaction)
PCR (Polymerase Chain Reaction)

... can identify the DNA of the virus immediately following infection, as opposed to the antibodies that are produced weeks or months after infection. PCR can also be used to determine the viral load (i.e. how much virus is circulating around the body), which is a useful measure of prognosis. The role o ...
Training
Training

microfluidic microarray assembly and its applications to
microfluidic microarray assembly and its applications to

... materials within the channels. Centrifugal pumping was used for liquid transport in a similar manner as other research groups [2, 3]. What is new here is the two-time use of centrifugal pumping, first along radial channels and then along spiral channels. As shown in Figure 2, 96 RADIAL and SPIRAL mi ...
Section 7.1 DNA Cloning with Plasmid Vectors
Section 7.1 DNA Cloning with Plasmid Vectors

... Selection of Transformed Cells In 1944, O. T. Avery, C. M. Macleod, and M. McCarty first demonstrated gene transfer with isolated DNA obtained from Streptococcus pneumoniae. This process involved the genetic alteration of a bacterial cell by the uptake of DNA isolated from a genetically different ba ...
Central Dogma Mini-Book Instructions
Central Dogma Mini-Book Instructions

... DNA is the directions to build our bodies. The only problem is, DNA is locked inside the nucleus of a cell and can’t get out. To solve this problem, copies of the DNA are made in a form called mRNA. The process of making mRNA from DNA is called transcription. After transcription, the mRNA copies lea ...
No Slide Title
No Slide Title

A Section 2
A Section 2

Z. Naturforsch. 66c
Z. Naturforsch. 66c

... bacterial cell to possess the ability to actively take up and heritably integrate extracellular DNA into its genome, i.e., to have the competence for natural transformation (Johnsborg et al., 2007). More than 40 prokaryotic species, including many soil and rhizosphere bacteria, have been described t ...
Worksheet
Worksheet

... evidence that DNA is a double helix. (1.8) Rosalind Franklin’s careful observation and interpretation of the photographic evidence was crucial to Crick’s and Watson’s successful discovery of the structure of DNA. Her work and her calculations were shown to Crick and Watson without her permission and ...
24 GENETICS AND SOCIETY MODULE - 3
24 GENETICS AND SOCIETY MODULE - 3

... and chemical nature of DNA was understood [recall the double helical structure of DNA as proposed by J. Watson and F. Crick] The central dogma of molecular biology holds that genetic information resides in DNA, but its expression is in the form of proteins which are synthesized according to genetic ...
DNA App Notes
DNA App Notes

... either storage temperature. No differences in DNA quality or integrity were observed between DNA stored frozen and DNA stored in GenTegra™ DNA tubes, indicating that GenTegra™ DNA Tubes preserved DNA integrity during the ...
To learn how to use a spectrophotometer. UV/visible spectrophotometer Quartz Cuvette
To learn how to use a spectrophotometer. UV/visible spectrophotometer Quartz Cuvette

< 1 ... 58 59 60 61 62 63 64 65 66 ... 191 >

Transformation (genetics)



In molecular biology, transformation is the genetic alteration of a cell resulting from the direct uptake and incorporation of exogenous genetic material (exogenous DNA) from its surroundings and taken up through the cell membrane(s). Transformation occurs naturally in some species of bacteria, but it can also be effected by artificial means in other cells. For transformation to happen, bacteria must be in a state of competence, which might occur as a time-limited response to environmental conditions such as starvation and cell density.Transformation is one of three processes by which exogenous genetic material may be introduced into a bacterial cell, the other two being conjugation (transfer of genetic material between two bacterial cells in direct contact) and transduction (injection of foreign DNA by a bacteriophage virus into the host bacterium).""Transformation"" may also be used to describe the insertion of new genetic material into nonbacterial cells, including animal and plant cells; however, because ""transformation"" has a special meaning in relation to animal cells, indicating progression to a cancerous state, the term should be avoided for animal cells when describing introduction of exogenous genetic material. Introduction of foreign DNA into eukaryotic cells is often called ""transfection"".
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report