• Study Resource
  • Explore
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Fig. 8.1. Amino acid structure
Fig. 8.1. Amino acid structure

DNA and the Genome
DNA and the Genome

... PCR helps to rapidly identify people. Specific areas of DNA known to vary between individuals is amplified. Giving different sized fragments in different people. CFE Higher Biology ...
2004 Lec 42-43: Nucleotide Metabolism
2004 Lec 42-43: Nucleotide Metabolism

... the form of a phonographic recording, nor may it be stored in a retrieval system, transmitted, or otherwise copied for public or private use, without written permission from the publisher. ...
chapter 16: the molecular basis of inheritance
chapter 16: the molecular basis of inheritance

... 18) Describe the process of translation (including initiation, elongation, and termination) and explain which enzymes, protein factors, and energy sources are needed for each stage. 19) Explain what determines the primary structure of a protein and describe how a polypeptide must be modified before ...
Microbiology (BIO
Microbiology (BIO

... that the desired microorganism or group can use and its competitors can not SELECTIVE – selects for growth of certain microorganisms in a mixed population by using an ingredient that inhibits the growth of other microorganisms, but not the desired species or group DIFFERENTIAL – does not select for ...
Journal of Applied Phycology
Journal of Applied Phycology

... DNA digested with BglII was ligated to BamHI digested pUC19. The clones were screened by carrying out PCR with two consensus recA primers (A: 5' CTCCATGCGATCGCCGAAGT 3' and B: 5' GGTITGGATGCGGCGGATATCTA 3') which were based on the conserved amino acid sequences LHAIAEV and LDIRRIQT in the Anabaena v ...
Functional second genes generated by retrotransposition of the X
Functional second genes generated by retrotransposition of the X

... Although the complete process for assembling the functional ribosome has not yet been elucidated, the in¯uence of the gene dosage of each ribosomal component on development has been extensively studied in Drosophila melanogaster. For example, haploinsuf®ciency of any one of the RP genes yields a Min ...
File
File

... sequence of the DNA by nucleotide position. Letters for each base are stacked on top of each other according to their relative frequency at that position among the aligned sequences, with the most common base as the largest letter at the top of the stack. The height of each letter represents the rel ...
Does the size of a rock affect the diversity of the epilithic fauna?
Does the size of a rock affect the diversity of the epilithic fauna?

...  Sand – Less than 4mm  Pebble - 4mm and 64mm  Cobble - 64mm to 256mm  Boulder - greater than 256mm  Bedrock ...
PCR Reagents
PCR Reagents

Getting a grip on how DNA polymerases function
Getting a grip on how DNA polymerases function

... nucleotide relative to the noncomplementary nucleotides. Inefficient extension of an incorporated terminal noncomplementary nucleotide allows time for removal by 3′-5′ exonuclease. The exonucleolytic (3′-5′) proofreading domain is an integral part of some DNA polymerases and contributes, on average, ...
Document
Document

... nucleoplasm, transcribes tRNAs, 5S rRNA, and the remaining snRNAs. ...
Analysis of Biofilms
Analysis of Biofilms

Chapter 17 - Auburn University
Chapter 17 - Auburn University

... 4. all are synthesized from DNA templates (thus, some genes code for tRNA and rRNA, not protein) III. Overview of gene expression A. Central Dogma of Gene Expression: DNA  RNA  protein 1. the gene is the DNA sequence with instructions for making a product 2. the protein (or protein subunit) is the ...
Big Idea3
Big Idea3

... Genetic information provides for continuity of life and, in most cases, this information is passed from parent to offspring via DNA. The double- stranded structure of DNA provides a simple and elegant solution for the transmission of heritable information to the next generation; by using each strand ...
Bacterial infection and antibiotics
Bacterial infection and antibiotics

... - Adaptive Immune Responses (Ag-specific B & T cells) – the later stage ...
The Great Plankton Race
The Great Plankton Race

... Diatoms on the other hand, have little resemblance to plants although they are still similar in the fact that they rely on photosynthesis for acquiring food and energy. Diatoms are extremely diverse and come in a variety of shapes ranging from round spheres to long narrow stalks. Dinoflagellates har ...
Document
Document

... Introduction to medical microbiology. Classifications and characteristics of cellular microorganisms (bacteria, fungi, protists) and acellular microorganisms viruses, virus-like organisms (viroids) and prions. Prokaryotic and eukaryotic microorganisms. Bacterial cell structures and functions. Bacter ...
Noninvasive sampling for carnivores
Noninvasive sampling for carnivores

... by using scent-detecting or scat-detector dogs (Canis familiaris; Hurt et al. 2000; Wasser et al. 2004; Smith et al. 2005, 2003; Long et al. 2007; MacKay et al. 2008). Detector dogs commonly are trained and handled following protocols applied for search-and-rescue dogs (MacKay et al. 2008). The dogs ...
RNA
RNA

... Anticodon ...
Rumen fermentation
Rumen fermentation

...  Only small particles leave reticulorumen Increases surface area for microbial attachment and digestion/fermentation ...
PHYSICAL AGENTS TO CONTROL MICROORGANISMS
PHYSICAL AGENTS TO CONTROL MICROORGANISMS

... are listed below: 1. Phenol and phenol derivatives Phenol (5-10%) was the first disinfectant commonly used. However, because of its toxicity and odor, phenol derivatives are now generally used. These include orthophenylphenol, hexachlorophene, triclosan, hexylresorcinol, and chlorhexidine. Orthophen ...
Journal Club - Clinical Chemistry
Journal Club - Clinical Chemistry

... specific detection of small amounts of tumor specific cfDNA in the peripheral blood of patients with cancer. •The detection of tumor specific DNA alterations such as mutations and methylation in cfDNA provides a less invasive, more easily accessible source of DNA for genetic analysis than tumor biop ...
ppt
ppt

... A Pseudo-Rotational Online Service and Interactive Tool Proteins can be grouped on the basis of their sequences, into a limited number of families. Some regions have been better conserved than others during evolution. These regions are generally important for the function of a protein and/or the mai ...
Experiment Bacterial genetic exchange : Conjugation of
Experiment Bacterial genetic exchange : Conjugation of

... and Xanthomonas campestris pv. translucens, are able to catalyze ice formation at temperatures of -2 to -12 o C. These microorganisms efficiently catalyze ice formation at temperatures much higher than most organic and inorganic substances. On plants, they are responsible for initiating ice formatio ...
< 1 ... 142 143 144 145 146 147 148 149 150 ... 512 >

Community fingerprinting

  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report