• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
DNA TYPING “Fingerprinting” - BHSBiology-Cox
DNA TYPING “Fingerprinting” - BHSBiology-Cox

... Minute amounts of DNA template may be used from as little as a single cell.  DNA degraded to fragments only a few hundred base pairs in length can serve as effective templates for amplification.  Large numbers of copies of specific DNA sequences can be amplified simultaneously with multiplex PCR r ...
Replication Worksheet
Replication Worksheet

... o After the first enzyme does his job, another enzyme (2) comes in to continue synthesis. What enzyme synthesizes new DNA? How does this enzyme do this? o Assuming that helicase is moving in this ⃪ direction, which strand is leading and which is lagging? What if helicase moves this → direction? o Wh ...
DNA Statistics and the Null Hypothesis
DNA Statistics and the Null Hypothesis

... Suppose, by hook or crook, we discover a DNA feature which seems to hold predictive power.  For  example, imagine we search a collection of bacterial DNA samples and find that bacteria with the  sequence "ATCTCTGTTCCTATCATATATATACCCCG" are resistant to a particular antibiotic, while ones  without th ...
DNA Extraction from Strawberry - Partnership for Biotechnology and
DNA Extraction from Strawberry - Partnership for Biotechnology and

... Plant cell membrane- phospholipid bilayer ...
Prot-DNAInteractionsWksht
Prot-DNAInteractionsWksht

... Protein-DNA binding interactions 4) Base your answers for this part on the 3-D information for Structure 1, in Kinemage 1. (Turn side chains on or off as needed.) What common structural motif is present in Protein X? What residues (numbers) form the motif? What residues (numbers) form the DNA recogn ...
17.1 – Isolating the Genetic Material
17.1 – Isolating the Genetic Material

... Complimentary base pairings – pairing of bases between nucleic acid strands. The two strands of a DNA helix are complimentary with each other. Each purine base pairs with a pyrimidine base on the other side. A binds with T (2 hydrogen bonds) C binds with G (3 hydrogen bonds) Antiparallel – describes ...
PDF file - the Houpt Lab
PDF file - the Houpt Lab

... Expt 2. Hershey & Chase Phage viruses are composed of DNA and protein. Is the genetic material in the protein, or in the DNA? In other words, does the phage inject the bacteria with protein or DNA? Use radioactive isotopes to label protein or label DNA. Sulfur is an element only in protein: so use 3 ...
DNA, RNA, and Protein Synthesis
DNA, RNA, and Protein Synthesis

... • The bases on each of those chains are attracted to each other and form hydrogen bonds • The force of thousands or millions of hydrogen bonds keeps the two strands of DNA held tightly together ...
DNA to RNA to Protein
DNA to RNA to Protein

... Two new DNA strands are made Each new double helix contains a new strand and an old strand The two new double helices are identical to each other. ...
D N A: The Master Molecule of Life
D N A: The Master Molecule of Life

... acids(polypeptides). Proteins build living material, fight disease, and help transport things out of the cell. The important class of proteins called enzymes act to control the rates of chemical reactions. Most proteins are enzymes. Replication of DNA: The process that occurs when DNA makes an exact ...
DNA Structure - OpenStax CNX
DNA Structure - OpenStax CNX

... Moreover, Watson had acquired little training in X-ray crystallography, and therefore had not fully understood what Dr. Franklin was saying about the structural symmetry of the DNA molecule. Crick, however, knowing the Fourier transforms of Bessel functions that represent the X-ray diraction patter ...
Supplemental Data Nuclear Gene Sequences from a Late
Supplemental Data Nuclear Gene Sequences from a Late

... and Svante Pääbo ...
DNA History WebquestJ
DNA History WebquestJ

... 4. Alfred Hershey and Martha Chase http://highered.mcgraw-hill.com/olc/dl/120076/bio21.swf a. In 1952, their experiments showed that ______ is the genetic material instead of ____________. ...
Lecture-3 DNA Structure: (Deoxyribonucleic acid) DNA is a long
Lecture-3 DNA Structure: (Deoxyribonucleic acid) DNA is a long

... mother parent during sexual reproduction. Very slowly change generation because there is no involvement of recombination. In case of human almost 16500 nucleotides are present in mtDNA. mtDNA is useful for forensic cases when nuclear DMA is insufficient and is not recoverable especially from fossils ...
DNA - Northwest ISD Moodle
DNA - Northwest ISD Moodle

... Remember how the sugar is 5 carbon, and each carbon is numbered? Since only phosphates can attach to either the 5’ or 3’ carbons, and only bases can attach to the 1’ carbon, the two strands of DNA must run in opposite ...
DNA - The Double Helix
DNA - The Double Helix

... What important polymer is located in the nucleus? _______________ ___________ is the instructions for making a cell's ______________. Chromosomes are composed of genes, which is a segment of DNA that codes for a particular protein, which in turn codes for a trait. Hence you hear it commonly referred ...
PPT
PPT

... copied/replicated exactly before it can be incorporated into all cells! When does DNA Replication Occur?? During Interphase (S phase) of the ...
DNA - Lehi FFA
DNA - Lehi FFA

... • Remember how DNA got it’s name? – It is a nucleic acid with deoxyribose as the sugar on the backbone – Hence the name Deoxyribonucleic acid ...
Obtain PCR-Ready Genomic DNA from Buccal Cells, HeLa Cells, Hair
Obtain PCR-Ready Genomic DNA from Buccal Cells, HeLa Cells, Hair

... • Human buccal (cheek) cells collected using a Catch-All™ Sample Collection Swab and rotated 5 times in the QuickExtract Solution to disperse the cells. • 104 counted human cervical carcinoma tissue culture (HeLa) cells. ...
Slide 1
Slide 1

... You have a building toy set consisting of parts that can be connected together. You are going to use it to model a piece of DNA. You have decided that each part of DNA will be represented by a different type of toy piece. You have chosen the following four pieces so far: adenine = large red cube; gu ...
Bell Work 2-23-16
Bell Work 2-23-16

... 2. During ___________, a strand of DNA is used as the template to make RNA. TRANSCRIPTION 3. During ___________, the information from mRNA is used (along with rRNA and tRNA) to produce proteins. TRANSLATION ...
Lecture 2
Lecture 2

... but are accessible through major and minor grooves; a pair of bases from opposite strands in the ma- jor groove are highlighted in light and dark blue. The hydrogen bonds between the bases are in the center of the structure. (b) Stick diagram of the chemical structure of double-helical DNA, unravele ...
Synthesis and properties of modified oligonucleotides
Synthesis and properties of modified oligonucleotides

... collaborating with several groups in this field. Several projects funded by the European Commission are currently underway. In one of these projects, we have developed a new photolithographic method that uses photolabile DNA hairpins to make patterns on silicon oxide wafers. The method described off ...
Translation
Translation

... • The Goal of Transcription is to produce a singlestranded mRNA helix that contains information from DNA to make proteins • How it’s done: (This happens in the Nucleus!) 1. DNA strand unwinds/unzips complementary DNA strands 2. Enzyme called RNA Polymerase binds to DNA “promoter” regions and “plugs ...
DNA is
DNA is

... 4. The amino acid is strung together to make a protein inside the ribosome by forming a peptide bond between each amino acid and by being removed from the tRNA molecule. 5. This process continues until the ribosome reaches a stop codon on the mRNA molecule. This signals the process of translation to ...
< 1 ... 91 92 93 94 95 96 97 98 99 ... 233 >

DNA nanotechnology



DNA nanotechnology is the design and manufacture of artificial nucleic acid structures for technological uses. In this field, nucleic acids are used as non-biological engineering materials for nanotechnology rather than as the carriers of genetic information in living cells. Researchers in the field have created static structures such as two- and three-dimensional crystal lattices, nanotubes, polyhedra, and arbitrary shapes, as well as functional devices such as molecular machines and DNA computers. The field is beginning to be used as a tool to solve basic science problems in structural biology and biophysics, including applications in crystallography and spectroscopy for protein structure determination. Potential applications in molecular scale electronics and nanomedicine are also being investigated.The conceptual foundation for DNA nanotechnology was first laid out by Nadrian Seeman in the early 1980s, and the field began to attract widespread interest in the mid-2000s. This use of nucleic acids is enabled by their strict base pairing rules, which cause only portions of strands with complementary base sequences to bind together to form strong, rigid double helix structures. This allows for the rational design of base sequences that will selectively assemble to form complex target structures with precisely controlled nanoscale features. A number of assembly methods are used to make these structures, including tile-based structures that assemble from smaller structures, folding structures using the DNA origami method, and dynamically reconfigurable structures using strand displacement techniques. While the field's name specifically references DNA, the same principles have been used with other types of nucleic acids as well, leading to the occasional use of the alternative name nucleic acid nanotechnology.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report