• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
DNA
DNA

... • While Frederick Griffith was experimenting with pneumonia, he discovered that mice injected with dead bacteria still died of pneumonia… so it was something inside the bacteria that was still passed on to the next generation. • Oswald Avery and other scientists discovered that DNA is the nucleic ac ...
mb_ch10
mb_ch10

... • Summarize the process of DNA replication. • Identify the role of enzymes in the replication of DNA. • Describe how complementary base pairing guides DNA replication. • Compare the number of replication forks in prokaryotic and eukaryotic cells during DNA replication. • Describe how errors are corr ...
Document
Document

... complementary strand of 5’ to 3’ • Lagging strand: is discontinuous (patchwork for DNA); requires many RNA primers for Okazaki fragments ...
AP BIOLOGY - Bremen High School District 228
AP BIOLOGY - Bremen High School District 228

... the variation in the structure of nucleotides that make up the DNA molecule the types of sugars used in making the DNA molecule the sequence of amino acids that make up the DNA molecule the sequence of nucleotides along the length of the two strands of the DNA molecule all of the above ...
Microbial Genetics
Microbial Genetics

... replication start points (see right) are found.  A DNA sequence that when added to a non-replicating DNA causes it to replicate.  A DNA sequence whose mutation abolishes replication.  A DNA sequence that in vitro is the binding target for enzyme ...
Knowing Nucleic Acids - UCLA Chemistry and Biochemistry
Knowing Nucleic Acids - UCLA Chemistry and Biochemistry

... Definition:
 Nucleic
 acids
 are
 chains
 of
 nucleotides
 that
 are
 biological
 molecules
 essential
 for
 known
 forms
 of
 life,
 including
 deoxyribonucleic
 acid
 (DNA)
 and
 ribonucleic
acid
(RNA) 
 ...
DNA
DNA

... –Each new strand is a ...
Chapter 12 DNA
Chapter 12 DNA

... • If you had a strand of DNA, but only one half of the strand, how would you create a complimentary strand? – Suppose you had the base pairs: • ATGCCCGTAATGTAACCGTTGAA • What would be the complimentary strand? ...
Notes about DNA/Proteins/Mutations
Notes about DNA/Proteins/Mutations

... • If you had a strand of DNA, but only one half of the strand, how would you create a complimentary strand? – Suppose you had the base pairs: • ATGCCCGTAATGTAACCGTTGAA • What would be the complimentary strand? ...
DNA Molecular Structure
DNA Molecular Structure

... semiconservative replication - each daughter DNA consists of one new helix synthesized from free nucleotides and one old helix conserved from the parental DNA ...
MCB 142 second midterm: Molecular Genetics
MCB 142 second midterm: Molecular Genetics

... (b) in a given double helix, one strand is inherited directly from the parental helix and the other strand is newly synthesized as its complement (c) both strands are inherited from the parent, but DNA repair removes half of the sequence randomly, keeping (“conserving”) the other half. (d) If a (pre ...
Nucleic Acids - Cochise College
Nucleic Acids - Cochise College

... • a section of DNA containing the gene unwinds. • one strand of DNA bases is used as a template. • mRNA is synthesized using complementary base pairing with uracil (U) replacing thymine (T). • the newly formed mRNA moves out of the nucleus to ribosomes in the cytoplasm. ...
Investigation of DNA Replication Mechanisms
Investigation of DNA Replication Mechanisms

... hereditary information • Chargoff • Hershey and Chase • Delbruck • DNA has the capability to direct its own replication • Watson and Crick • Delbruck • At this time there were a few hypothesis for how parental DNA was distributed among progeny molecules ...
Ch8 BacterialgeneticsPrt2HO.ppt
Ch8 BacterialgeneticsPrt2HO.ppt

... Barbara McClintock: jumping genes biological mutagen Transposons Can move from one location to another This jumping around is called transposition Genes are inactivated Function destroyed Most transposons have transcriptional terminators---Blocks expression of downstream genes ...
III.C.7 PREPARATION OF THE 32P
III.C.7 PREPARATION OF THE 32P

... III.C.7 ...
transcription, translation
transcription, translation

... molecule to be easily transcribed. Whys is this important for genetic information? 3. Whys is RNA important to the cell? How does an mRNA molecule carry information from DNA? 4. If DNA strand read AAC GTC GCG TAC, what would the mRNA strand be? ...
DNA Extraction from Fruit
DNA Extraction from Fruit

... 3. Choose a fruit, any kind will do. However, kiwi, mango and strawberry have been found to yield the most DNA. 4. Cut a small piece of fruit, peel any tough skin and take out large seeds. Cut into small pieces. 5. Place fruit in blender and pour soap/salt solution over fruit. Cover blender and pres ...
DNA Extraction from Fruit
DNA Extraction from Fruit

... 3. Choose a fruit, any kind will do. However, kiwi, mango and strawberry have been found to yield the most DNA. 4. Cut a small piece of fruit, peel any tough skin and take out large seeds. Cut into small pieces. 5. Place fruit in blender and pour soap/salt solution over fruit. Cover blender and pres ...
DNA - Zanichelli online per la scuola
DNA - Zanichelli online per la scuola

... Phases of DNA replication DNA replication occurs in two phases: opening and synthesis. In the opening phase, DNA separates its strands at the site of the origin of replication where a Yshaped replication fork is created. In the synthesis phase, new nucleotides link with those displayed on the templ ...
DNA - anisam2
DNA - anisam2

... genetic information comes from DNA? • What type of experiment would you design to determine that DNA is the source of all genetic information? ...
DNA - The Double Helix
DNA - The Double Helix

... The DNA helix is actually made of repeating units called nucleotides. Each nucleotide consists of three molecules: a sugar (deoxyribose), a phosphate which links the sugars together, and then one of the four bases. Two of the bases are purines - adenine and guanine. The pyrimidines are thymine and c ...
Ch. 10 Exam Review
Ch. 10 Exam Review

... ____ 13. During transcription a. proteins are synthesized. b. DNA is replicated. c. RNA is produced. d. translation occurs. ____ 14. Each nucleotide triplet in mRNA that specifies a particular amino acid is called a a. mutagen. c. anticodon. b. codon. d. exon. ...
DNA’s Discovery and Structure
DNA’s Discovery and Structure

... - only one of the DNA strands contains the protein recipe - the strand with the recipe is the template strand - the strand without the recipe is the non-template strand - it is not copied ...
word - marric.us
word - marric.us

... Note that that the bases attach to the sides of the ladder at the sugars and not the phosphate. The DNA helix is actually made of repeating units called nucleotides. Each nucleotide consists of three molecules: a sugar (deoxyribose), a phosphate which links the sugars together, and then one of the f ...
SBI4U Molecular Genetics Review
SBI4U Molecular Genetics Review

... Identify the labeled structures: 1 Lagging Strand 2 Leading Strand 3 DNA pol. 4 Ligase 5 RNA Primer 6 Primase 7 Okazaki fragment 8 DNA pol. 9 Helicase 10 ssb’s 11 Gyrase ...
< 1 ... 61 62 63 64 65 66 67 68 69 ... 176 >

DNA replication



DNA replication is the process of producing two identical replicas from one original DNA molecule. This biological process occurs in all living organisms and is the basis for biological inheritance. DNA is made up of two strands and each strand of the original DNA molecule serves as a template for the production of the complementary strand, a process referred to as semiconservative replication. Cellular proofreading and error-checking mechanisms ensure near perfect fidelity for DNA replication.In a cell, DNA replication begins at specific locations, or origins of replication, in the genome. Unwinding of DNA at the origin and synthesis of new strands results in replication forks growing bidirectional from the origin. A number of proteins are associated with the replication fork which helps in terms of the initiation and continuation of DNA synthesis. Most prominently, DNA polymerase synthesizes the new DNA by adding complementary nucleotides to the template strand.DNA replication can also be performed in vitro (artificially, outside a cell). DNA polymerases isolated from cells and artificial DNA primers can be used to initiate DNA synthesis at known sequences in a template DNA molecule. The polymerase chain reaction (PCR), a common laboratory technique, cyclically applies such artificial synthesis to amplify a specific target DNA fragment from a pool of DNA.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report