Download Word file

Supplementary Materials
Supplementary Methods
RT-PCR. Reverse transcription and PCR amplification were performed with 1g total
RNA isolated from the indicated prostate tissues and cell lines. Human EZH2 forward
(5'-GCCAGACTGGGAAGAAATCTG-3’), reverse (5’TGTGCTGGAAAATCCAAGTCA-3’) and GAPDH sense (5’CGGAGTCAACGGATTTGGTCGTAT-3’), antisense 5'AGCCTTCTCCATGGTGGTGAAGAC–3’) primers were used.
EZH2 Constructs. Myc-tagged EZH2-pCMV was a kind gift of T. Jenuwein. The
Myc-EZH2 fragment was sub-cloned into the expression vector pCDNA3 (Invitrogen).
An EZH2-ER in-frame fusion expression construct was generated by replacing the FADD
fragment of a FADD-ER construct (derived from Myc-ER23, kind gift of G. Evan) with
the PCR amplified human EZH2. The EZH2ΔSET mutant DNA was amplified using the
primers 5 ‘GGGGTACCATGGGCGGCCGCGAACAAAAGTTGATT 3’ and 5’
GGGGAATTCTCATGCCAGCAATAGATGCTTTTT3’ and subsequently sub-cloned
into pCDNA3.
Supplementary Figures
Supplementary Table 1.
SAM analysis of prostate cancer gene expression.
SAM analysis was performed by comparing 7 metastatic prostate cancer
samples against 10 clinically localized prostate cancer sample 1.
Data was
normalized per array by multiplication by a factor to adjust the aggregate ratio of
medians to one, then log base 2 transformed and median centered. This
normalized data was divided into 2 groups for comparison using a two-class,
unpaired t-test. Critical values for the analysis include: Iterations = 500, Random
Number Seed 1234567, a fold change cutoff of 1.5 and a delta cutoff of 0.985,
resulting in a final largest median False Discovery Rate of 0.898 % for the 535
genes selected as significant (55 relatively up and 480 relatively down regulated
between MET and PCA). These 535 genes were analyzed using Cluster2
implementing average linkage hierarchical clustering of genes. The output was
visualized in Treeview2. The data can be obtained by opening the file labeled:
NATdataSet_METvsPCA.htm
Supplementary Table 2. SAM analysis of EZH2 differentially regulated genes.
EZH2ΔSET mutant expressing samples were compared to EZH2 expressing
samples using the SAM analysis package3.
Data was pre-processed by
multiplication by a normalization factor to adjust the aggregate ratio of medians to
one, log base 2 transformed and median centered each array, individually. This
pre-processed data was divided into 2 groups for comparison using a two-class,
unpaired t-test. Critical values for the analysis include: iterations = 5000, (720 at
convergence) random Number Seed 1234567, a fold change of 1.5 and a delta
cutoff of 0.45205, resulting in a final largest median False Discovery Rate of
0.45% for the 161 genes selected as significant. The data for figure 4c and figure
4d can be obtained by opening the file labeled EZH_deltaSET_derepressed.htm
Supplementary Figure 1. EZH2 and Ki-67 Association Study. Scatter plot of
EZH2 versus Ki-67:
A significant but weak correlation between Ki-67
proliferation (Ki-67 labeling index) and EZH-2 protein expression for clinically
localized prostate cancer is evident. Thirty-five paired cases were used for this
analysis (each cases had 5-6 TMA spots analyzed). Table shows the statistical
analysis of the EZH2 and Ki-67 labeling.
Supplementary Figure 2. EZH2 protein levels are elevated in metastatic prostate
cancer independent of metastatic site. a, Tissue microarray analysis of EZH2
expression considered per patient. The mean EZH2 protein expression for the
indicated prostate tissues is summarized using error bars with 95% confidence
intervals. Number of clinical specimens and associated number of patients are
indicated. b. Tissue microarray analysis of EZH2 expression considered based
on site of metastsis.
The mean EZH2 protein expression for the indicated
prostate tissues is summarized using error bars with 95% confidence intervals.
Number of clinical specimens and associated number of patients are indicated.
Supplementary Figure 3. A model for potential functional interactions of EZH2 as
elucidated by transcriptome analysis and placed in the context of previously
reported interactions. +, induction. -, repression. The PcG group protein EPC,
which is the human homolog of the Drosophila protein Enhancer of Polycomb
(E(Pc)) was consistently repressed by EZH2 (Fig. 4c).
Of the Drosophila PcG
proteins, E(Pc) and E(z) are related in that they both act as suppressors of
variegation (Su(var))4,5 and are the only PcG proteins to have yeast homologs,
emphasizing the evolutionary conservation of this PcG pair. In addition to EPC, a
host of other transcriptional regulators/activators were transcriptionally silenced by
EZH2 including MDNA, RNF5, RNF15, ZNF42, ZNF262, ZNFN1A1, RBM5, SPIB,
and FOXF2, among others (Fig. 4c). MDNA, also known as myeloid cell nuclear
differentiation antigen, is especially interesting as it mediates transcriptional
repression by interacting with the transcription factor YY1, which is a PcG homolog
of Drosophila Pho and shown to be part of the EZH2/EED complex of proteins 6.
In addition to transcriptional repression in prostate cells, our results also support a
role for EZH2 in regulating cell growth (Fig. 3). Thus, it is intriguing that we observed
transcriptional repression of cdc27 (two independent Unigene clones). Cdc27 is part
of the anaphase-promoting complex (APC) which mediates ubiquitination of cyclin
B1, resulting in cyclinB/cdk complex degradation7. Another family of proteins that
deserve further investigation as EZH2 targets are the solute carriers since at least 5
distinct members were shown to be repressed (i.e., SSLC34A2, SLC25A16,
SLC25A6, SLC16A2, and SLC4A3).
References
1.
2.
3.
4.
5.
6.
7.
Dhanasekaran, S. M. et al. Delineation of prognostic biomarkers in prostate
cancer. Nature 412, 822-6. (2001).
Eisen, M. B., Spellman, P. T., Brown, P. O. & Botstein, D. Cluster analysis and
display of genome-wide expression patterns. Proc Natl Acad Sci U S A 95, 148638 (1998).
Tusher, V. G., Tibshirani, R. & Chu, G. Significance analysis of microarrays
applied to the ionizing radiation response. Proc Natl Acad Sci U S A 98, 5116-21.
(2001).
Sinclair, D. A. et al. Enhancer of Polycomb is a suppressor of position-effect
variegation in Drosophila melanogaster. Genetics 148, 211-20. (1998).
Laible, G. et al. Mammalian homologues of the Polycomb-group gene Enhancer
of zeste mediate gene silencing in Drosophila heterochromatin and at S. cerevisiae
telomeres. Embo J 16, 3219-32. (1997).
Satijn, D. P., Hamer, K. M., den Blaauwen, J. & Otte, A. P. The polycomb group
protein EED interacts with YY1, and both proteins induce neural tissue in
Xenopus embryos. Mol Cell Biol 21, 1360-9. (2001).
Jorgensen, P. M., Brundell, E., Starborg, M. & Hoog, C. A subunit of the
anaphase-promoting complex is a centromere-associated protein in mammalian
cells. Mol Cell Biol 18, 468-76. (1998).