Download Journal of Applied Science and Agriculture Foreground Selection of BC F

Journal of Applied Science and Agriculture, 9(18) Special 2014, Pages: 132-135
AENSI Journals
Journal of Applied Science and Agriculture
ISSN 1816-9112
Journal home page: www.aensiweb.com/JASA
Foreground Selection of BC1F1 Families derived from MR 264 x Pongsu Seribu 2 using
SSR marker
1
H. Nor’Aishah, 2Y.Mohd Rafii, 3H. Abdul Rahim, 4A. Shamsiah, 2A. Latif, 2S. Askhani
1
Faculty of Applied Science, Universiti Teknologi MARA, 72000 Kuala Pilah, Malaysia.
Institutes of Tropical Agriculture, Universiti Putra Malaysia, 43600, Serdang, Malaysia.
3
Division of Agrotechnology and Bioprocess, Agency Nuclear Malaysia, 43000, Kajang, Malaysia.
4
Faculty of Plantation and Agrotechnology, Universiti Teknologi MARA, 40450, Shah Alam, Malaysia.
2
ARTICLE INFO
Article history:
Received 25 July 2014
Received in revised form
8 July 2014
Accepted 15 September 2014
Available online 17 October 2014
Keywords:
Blast Heterozygous
MR 264 Marker-assisted backcrossing
Pongsu Seribu 2
ABSTRACT
Background: Blast is considered as an essential threat towards food security which
gives significant losses to yield loss in rice production worldwide. Marker-assisted
backcrossing is one of the reasonable approaches to develop a new resistant variety to
confront with this challenge. Objective: The prime aim of this study was to identify the
introgressed line in backcross population using selected foreground marker. Results:
Crossing was conducted in Greenhouse of Agency Nuclear Malaysia (ANM) between
MR 264 and Pongsu Seribu 2. MR 264 was identified as recipient parent while Pongsu
Seribu 2 as donor parent for resistance gene. A total of 20 F1 seeds were successfully
produced and subsequently backcrossing was done and produced a total of 36 BC1F1
seedlings. Foreground selection was performed with tightly linked marker towards pigene to 23 BC1F1 plants. Marker RM 413 which tightly linked with pi-21 demonstrated
6 heterozygous (score as “H”) out of 23 backcrossed plants. Conclusion: These
selected genotypes were further used for recombinant and background selection with
appropriate markers for further generation in development of stable blast resistant rice
genotypes.
© 2014 AENSI Publisher All rights reserved.
To Cite This Article: H. Nor’Aishah, Y.Mohd Rafii, H. Abdul Rahim, A. Shamsiah, A. Latif, S. Askhani., Foreground Selection of BC1F1
Families derived from MR 264 x Pongsu Seribu 2 using SSR marker. J. Appl. Sci. & Agric., 9(18): 132-135, 2014
INTRODUCTION
Rice is the primary and vital food crops for more than 2.7 billion people in South and Southeast Asia
(Hossain, 2005). In Malaysia, rice grows in 2 major seasons and occupied 389,544 ha area (Paddy Statistic of
Malaysia, 2011). Currently, blast disease is one of the major obstacles hampering rice production. Blast disease
caused by Magnaporthe oryzae affected most of the growing rice countries including Malaysia and
approximately 1049 hectares land was destroyed. Recent outbreak had been reported at MADA, Kedah, resulted
20-40% or 2.2 tan metric/hectare of yield losses (MADA, 2013).
Due to this concern, more research and technology advancement should be made to help the poor farmers
and developing countries whose totally depends on the rice as their source of energy. The instability of blast
fungus can be threatened by the development of blast resistant cultivar. Over the decade, conventional methods
had been practiced by the breeders to develop the blast resistant variety. However, it is tedious, time consuming
and mostly dependent on environment. Currently, breeders are using a molecular approach that is easier, highly
efficient and environmental friendly to manage the disease (Miah et al., 2013). In this method, a broad spectrum
of resistance gene (qualitative or quantitative) is incorporate in resistance variety to develop durable blast
resistant cultivar. Prior technology such as the development of tightly linked molecular markers had made it
possible to pyramid major gene into one genotype and simultaneously select several complex characters.
Marker assisted backcrossing offers a greatly approaches in improving the selection strategies in rice
breeding (Mondal et al., 2013). Currently, SSRs are predominantly being used to map and introgress
agronomically important Quantitative Trait Loci (QTLs) into popular varieties using Marker-Assisted
Backcrossing (MABC).SSR or microsatellite markers are proved to be ideal for making genetic maps (Islam,
2004; Niones, 2004), assisting selection (Bhuiyan, 2005) and studying genetic diversity in crop germplasm.
Microsatellite marker analysis is promising to identify major gene locus for blast resistant that can be helpful for
plant breeders to develop new cultivars However, their use is still limited due to lack of sufficient polymorphism
particularly within related genotypes, labour requirements and cost of application. In addition, SSR markers
Corresponding Author: H. Nor’Aishah, Faculty of Applied Science, Universiti Teknologi MARA, 72000 Kuala Pilah,
Malaysia,
Tel: 60-0126922863
H. Nor’Aishah et al, 2014
133
Journal of Applied Science and Agriculture, 9(18) Special 2014, Pages: 132-135
have a low potential for multiplexing and require lengthy periods of time to genotype many markers as during
the initial background selection in the marker-assisted backcrossing protocol (Thomson et al., 2010). Therefore
in this study our aim is to identify the introgress lines of backcrossed population in MR 264 and Pongsu Seribu
2 using specific foreground marker.
Methodology:
1.1 Plant Material:
Two local rice varieties of Pongsu Seribu 2 and MR 264 were obtained from Malaysia Nuclear Agency and
were used for hybridization to produce 98 F1 seeds. Subsequently 20 identified F 1 seeds were crossed with MR
264 to produce BC1F1 seeds (Figure 1). Among these seeds, 36 seeds were germinated in the experimental field.
Only 23 seedlings were selected to collect the leaf samples to apply foreground selection using SSR markers.
Normal and reciprocal crosses were conducted according to Virmani and Sharma, 1992 with some modification.
Complete NPK were introduced to plants with recommended doses.
1.
Fig. 1: BC1F1 families grown in greenhouse.
1.2 Extraction:
Three weeks young and fresh leaves were collected to extract genomic DNA using modified CTAB
method. Two grams of leaf samples were chopped into small pieces and were added with 5 ml extraction buffer
prior to ground in Tissue Lyser (QIAGEN, Germany) for 2 minutes. Samples then were precipitated using 70%
ethanol. Dried DNA pellet was re-suspended in 1xTE buffer. Concentration of DNA was measured by NanoDrop spectrophotometry while DNA quality was checked by 1.5% agarose gel electrophoresis at 90 V for 30
minutes. Separation of DNA fragments was visualized under UV light.
1.3 Polymorphism survey for primer selection:
Polymorphism survey of parental plants was carried out and foreground selection of 23 BC1F1 plants were
screened with marker tightly linked with pi-gene.
1.4 PCR Amplification:
PCR assay was performed in a program; 30 cycles of denaturation at 94°C for 1 minute, annealing for 1
minute at 55°C and polymerization at 72°C for 2 minutes. Final elongation was at 72°C for 7 min. The
amplification products were analyzed by electrophoresis in a 3.0 % agarose in 1xTBE at 90 V for 1 hour. Gels
were stained with ethidium bromide. The amplified fragments were visualized with UV transilluminator. The
100 bp DNA ladder was used as a DNA size marker.
Primer
PCR product size
(bp)
Sequence (5’ – 3’)
Position
Repeat motif
Annealing
Temperature (oC)
RM 413
79
F:GGCGATTCTTGGATGAAGA
G
R:TCCCCACCAATCTTGTCTTC
5
(AG)11
55
1.5 Data Analysis:
The pattern of bands obtained after amplification with primers was scored with reference to two parents.
Bands having same level with MR 264 was scored A, bands similar with Pongsu Seribu 2 was scored B. H was
scored for bands having both parents. Size of bands (molecular weight, bp) was determined using Alpha Ease
FC 5.0 software based on migration relative to 100bp DNA ladder.
2.
Results:
Marker Assissted Backcrossing (MAB) was performed in this study in order to maximize the recovery of all
desirable trait of recurrent parent, MR 264. Table 2 demonstrated the characteristic of MR 264 in comparison
with Pongsu Seribu 2. MR 264 possesses lesser days to flowering and lower plant height compared to Pongsu
Seribu 2.
Polymorphism survey is an essential requirement before conducting MAB. For further successful
foreground and background selection, polymorphic marker needs to cover the entire genome of rice
chromosome. In this study, a total of 98 SSR marker tightly linked with pi gene were selected and screened for
H. Nor’Aishah et al, 2014
134
Journal of Applied Science and Agriculture, 9(18) Special 2014, Pages: 132-135
polymorphism between both parents. Out of 98 markers, only 14 markers showed a polymorphism and
considered as foreground marker. Table 3 demonstrated the foreground marker in this study.
Table 2: Characteristics of local varities, MR 264 and Pongsu Seribu 2.
Charactertistic
MR 264
Plant height
Semi dwarf
Seed
Long
Panicle
High
Grain yield
High
Blast Disease
Susceptible
Days to flowering
113 days
Pongsu Seribu 2
Tall
Medium long
Small
Low
Resistant
150 days
Table 3: Foreground markers for MR 264 and Pongsu Seribu 2 population.
Primer
RM 495
RM 1
RM 140
RM 1167
RM 462
RM 250
RM 148
RM 303
RM 413
RM 296
RM 3912
RM 244
RM 206
RM 101
Sequence
Forward
AATCCAAGGTGCAGAGATGG
GCGAAAACACAATGCAAAAA
TGCCTCTTCCCTGGCTCCCCTG
GAACATAAACCATGCGGGAG
ACGGCCCATATAAAAGCCTC
GGTTCAAACCAAGCTGATCA
ATACAACATTAGGGATGAGGCTGG
GCATGGCCAAATATTAAAGG
GGCGATTCTTGGATGAAGAG
CACATGGCACCAACCTCC
TGTGTGCCCGATCTACCC
CCGACTGTTCGTCCTTATCA
CCCATGCGTTTAACTATTCT
GTGAATGGTCAAGTGACTTAGGTGGC
Reverse
CAACGATGACGAACACAACC
GCGTTGGTTGGACCTGAC
GGCATGCCGAATGAAATGCATG
AGCTAGTGGCAAAAGTGTGC
AAGATGGCGGAGTAGCTCAG
GATGAAGGCCTTCCACGCAG
TCCTTAAAGGTGGTGCAATGCGAG
GGTTGGAAATAGAAGTTCGGT
TCCCCACCAATCTTGTCTTC
GCCAAGTCATTCACTACTCTGG
CCCCCATCCCCACTAAATAC
CTGCTCTCGGGTGAACGT
CGTTCCATCGATCCGTATGG
ACACAACATGTTCCCTCCCATGC
Annealing
Temperature (OC)
55
55
55
55
55
55
55
55
55
55
55
55
55
55
In this study, out of 14 foreground marker, only RM 413 tightly linked with pi-21 were demonstrated a
highly reproducible band with BC1F1 families. Figure 2 showed the band scoring with RM 413 when
electrophoreses with 3% agarose gel. A total of 6 plants were detected with H indicated the heterozygous plants.
Three plants were detected as B, showed a similar bands of Pongsu Seribu 2 while eleven plants followed MR
264. However, there are 3 plants failed to showed any bands and were recorded as AB (Table 4).
Table 4: Twenty three BC1F1 families with respects to the alleles amplified by microsatellite marker.
Primers
Total no. of parental BC1F1 families
Pattern of BC1F1 families
Resistant type
Susceptible type
Heterozygous
(PS 2)
(MR 264)
RM 413
23
3
11
6
Fig. 2: Marker banding patterns in BC1F1 families for SSR marker; RM 413 electrophoresed on 3% agarose
gel. Lane M: 100 bp DNA ladder; Lane A: MR 264; Lane B: PS2; Lanes 1 -12: progenies; Lane N:
Negative control.
Discussion:
In this study, MR 264 was used as recurrent parent and Pongsu Seribu 2 was act as donor parent. According
to Ashkani et al., 2013, Pongsu Seribu 2 had known as traditional variety that consists a resistance towards blast
disease. MR 264 was an advance mutant line (300 Gy) of Khao Dok Mali derived from a breeding program of
Malaysian Nuclear Agency. MR 264 is susceptibility to panicle blast and not release to the farmer therefore an
attempt had been made to produce families of BC1F1 by introgressed the resistance gene from Pongsu Seribu 2
while retains the characteristic of, MR 264 which produces more yields.
135
H. Nor’Aishah et al, 2014
Journal of Applied Science and Agriculture, 9(18) Special 2014, Pages: 132-135
Polymorphic assay was very essential in order to select the foreground marker that tightly linked with pigene between these populations. Polymorphic markers are defined as a type of marker that can distinguish
between two parental genotypes, in this study MR 264 and Pongsu Seribu 2 (Alam et al., 2012). Twenty three
(n=23) BC1F1 families were develop from Marker Assisted Backcrossing method from F1 families (MR 264 x
Pongsu Seribu 2) with recurrent parent, MR 264. Foreground selection were assayed using SSR markers which
distributed entire 12 rice chromosome. A total of 14 markers showed polymorphism by producing a
reproducible and clearly discriminate band in both parental varieties. Those markers also were reported as
highly polymorphic in Mahsuri x Pongsu Seribu 2 for blast disease tolerant in the study made by Ashkani et al.,
2012 and was confirmed by NorÁishah et al., 2013 in his preliminary study with F1 families. El-rafaee et al.,
(2006) also reported that 80% of the tested SSR markers showed polymorphic pattern in rice population using
Binadhan-7 x FL-378.
Among 14 polymorphic markers, only markers RM 413 showed a wide variation in BC1F1 families. Table
2 demonstrated the banding pattern (allelic score) of BC1F1 families by using both parents as a control. Primer
RM 413 indicated 6 lines were introgressed and 11 lines as susceptible in comparison with blast resistant parent,
Pongsu Seribu 2 and susceptible parent, MR 264.
Conclusion:
RM 413 was successfully identified the introgressed rice line in BC1F1 families. RM 413 marker can be
further used as a foreground marker to facilitate the screening for development of blast resistant variety.
ACKNOWLEDGEMENT
The authors are grateful to Universiti Teknologi MARA and Malaysian Nuclear Agency for the facilities,
support and financial aids during the research work. Research was supported by FRGS (600-RMI/FRGS 5/3
(151/2013)
REFERENCE
Ashkani, S., M.Y. Rafii, H. Abdul Rahim and M.A. Latif, 2013. Mapping of the quantitative trait locus
(QTL) conferring partial resistance to rice leaf blast disease. Biotechnol Lett., 35: 799-810.
Bhuiyan, M.A.R., 2005. Efficiency in evaluating salt tolerance in rice using phenotypic and marker assisted
selection. M.S. Thesis, Department of Genetics and Plant Breeding, Bangladesh Agricultural University,
Mymensingh, Bangladesh, 96.
El-Rafaee, Y.Z., M. Atallah, M.L. Savo and E. Porceddu, 2006. Fine QTLs mapping for salinity tolerance
in rice. Proc 50th Italian Soc. Agric. Genetics Annual Congress. Ischia Italy,ISBN 88-900622-7-4.
Hossain, M.M., M.M. Islam, H. Hossain, M.S. Ali, J.A. Teixeira da Silva, A. Komamine, S.H. Prodhan,
2012. Genetic diversity analysis of aromatic landraces of rice (Oryza sativa L.) by microsatellite markers.
Genes, Genomes and Genomics, 6: 42-47.
Islam, M.M., 2004. Mapping salinity tolerance genes in rice (Oryza sativa L.) at reproductive stage. Ph. D.
Dissertation. University of the Philippines Los Baños, College, Laguna, Philippines, 149.
Miah, G., M.Y. Rafii, M.R. Ismail, A.B. Puteh, H.A. Rahim, R. Asfaliza, M.A. Latif 2013. Blastresistance
in rice: a review of conventional breeding to molecularapproaches. Mol Biol Rep, 40: 2369-2388.
Niones, J.M., 2004. Fine mapping of the salinity tolerance gene on chromosome 1 of rice (Oryza sativa L.)
using near-isogenic lines. M. S. dissertation. University of the Philippines Los Baños, College, Laguna,
Philippines, 78.
MADA, 2013. Laporan Pemantauan projek IRPA.
Mondal, K.T. and A.G. Showkat, 2013. Identification and Characterization off salt-responsive miRNA-SSR
markers in rice (Oryzae sativa). Genes, 535(2): 204-209.
Nor’Aishah, H., H. Abdul Rahim, A.R. Khairuddin, H. Sobri, M.N. Norain and M.Z. Nursamahah, 2013. “
Assessment of Purity of F1 Plants Derived from the Cross of MR264 and Pongsu Seribu 2 Using Microsatellite
Markers”, International Conference on Sustainable Environment and Agriculture IPCBEE. 57 pp. 1-3. DOI:
10.7763/IPCBEE.
Thomson, M.J., A.M. Ismail, S.R. McCouch, M.J. Mackill, 2010. Marker Assisted Breeding (Chap. 20),
Abiotic Stress Adaptation in Plants: Physiological, Molecular and Genomic Foundation, 451-469.
Paddy Statistic of Malaysia, 2011. Laporan Statistik Padi di Malaysia.