Download Characterisation of Aeromonas species isolated from diseased fish

AsPac J. Mol.
2012
Mol. Biol.
Biol.Biotechnol.
Biotechnol.
Vol. 20 (3), 2012
Vol. 20 (3) : 99-106
Characterisation of Aeromonas species
99
Characterisation of Aeromonas species isolated from diseased fish using ERICRAPD markers
Sujata R.Kamble1*, Sudhir U. Meshram1, Arti S. Shanware2
P.G.Department. of Microbiology,Rashtrasant Tukadoji Maharaj Nagpur University, L.I.T. Premises, Nagpur, India
2
Rajiv Gandhi Biotechnology Centre, Rashtrasant Tukadoji Maharaj Nagpur University, Nagpur-440033, India
1
Received 3 April 2012 / Accepted 31 May 2012
Abstract. Aeromonas spp. are Gram negative bacteria which are pathogenic to fish, amphibians and also humans. For this study
18 strains of Aeromonas were isolated from healthy or diseased fish and water samples collected from several areas of the Vidharbha region of Maharashtra state, India, for identification and characterization. Aeromonas isolates were characterized by Enterobacterial Repetitive Intergenic Consensus (ERIC) PCR and Random Amplified Polymorphic DNA (RAPD). ERIC and RAPD
analysis revealed genetic diversity in the Aeromonas genus as judged by comparing banding patterns. Clusters were formed by the
unweighted pair group method with arithmetic (UPGMA) averages applied, which correlate with the genetic information of the
species. Construction of phylogenetic dendrograms based on Jaccard’s coefficient revealed that isolates can be divided into different clusters and three-dimensional plots extracted by principal coordinate analysis using UPGMA of Aeromonas spp.
Keywords: Aeromonas spp., ERIC, Genetic fingerprinting, RAPD.
INTRODUCTION
In India, Aeromonas spp. are common contaminants in fish,
a variety of raw meat, milk and milk products, and other
raw foods (Subhaskumar et al., 2006; Porteen et al., 2007).
They are widely distributed in the environment, commonly
inhabit an aquatic environment and are also part of the normal intestinal microflora of healthy fish (Trust and Sparrow,
1974).
Aeromonas is an opportunistic and zoonotically important bacteria belonging to the family Aeromonadaceae. Several species, such as Aeromonas hydrophila, A. bestiarum, A.
sorbia, A.veronii, A. salmonicida, A. jandaei, and A. allosaccharophila, have been known to be associated with several
diseases, in both warm and cold blooded animals as a result of their virulence and pathogenicity (Gosling, 1995).
Motile Aeromonas spp. cause a hemorrhagic septicaemia in
numerous species of cultured and wild freshwater fish such
as carp, rainbow trout, brown trout, salmon, eel, carp, channel catfish, tilapia, and goldfish. In humans they cause opportunistic infections and gastroenteritis, chronic diarrhea,
wound infections, respiratory tract infections, peritonitis,
urinary tract infections and septicemia (Janda and Abbott,
1996; Altwegg, 1999).
The genus Aeromonas comprises of several species of
gram-negative, rod shaped, motile and non-motile, oxidaseand catalase positive, nitrate to nitrite reducing, glucosefermenting bacteria (Cantas et al., 2012). Owing to the
varied nature of these bacteria and their widespread habitat,
they have been difficult to classify, making the taxonomy
of the genus controversial (Carrnaham and Altwegg, 1995).
There is therefore a need for a system of identification and
characterization of Aeromonas isolates to their ecological
and clinical importance. Characterization of this genus using ERIC-PCR and RAPD fingerprinting is rapid and sensitive, thereby making the detection and identification of
pathogens relatively easy. Structural features within specific
community profiles of 18 Aeromonas strains isolated from
diseased or healthy fish and from water samples are here
compared with these molecular techniques. The present investigation therefore represents a possible approach for the
characterization of Aeromonas spp. at the genomic level and
an effort to classify the bacteria at the species level to facilitate the study of contamination by, and pathogenesis of,
Aeromonas spp.
MATERIAL AND METHODS
Bacterial isolates and Positive cultures All presumptive
strains of Aeromonas spp. were isolated from fish (Figure
1) and water samples originating from different areas of the
Vidharbha region (Table 1). The putative isolates were then
* Author for correspondence:
Sujata R. Kamble, P.G. Department of Microbiology, Rashtrasant Tukadoji
Maharaj Nagpur University, L.I.T. Premises, Nagpur-440033, INDIA. Email: [email protected]. Tel.: +91-9881084246.
100
AsPac J. Mol. Biol. Biotechnol. Vol. 20 (3), 2012
(a)
(b)
Figure 1. Symptoms of Aeromonas infection in fish. (a)
Red spot over the skin (Labeo rohita). (b) Infection around
gills in Cyprus (Rutilus spp.).
subjected to various characterizations which eventually led
to their identification. The bacterial strains were maintained
on nutrient agar while the growth of Aeromonas spp. was
confirmed on Brain heart infusion agar and Aeromonas selective agar (with ampicillin supplement). The isolates were
then subjected to biochemical characterization using the
Enterobacteriaceae Biochemical Identification Kit and conventional biochemical tests (Abott, 2003). Aeromonas hydrophila MTCC-1739 and A. hydrophila MTCC-646 were
used as positive reference strains (Table 1).
Antibiotic Sensitivity Test Isolates were screened for sensitivity to a total of 8 antibiotics by a disk diffusion method.
The antibiotic sensitivity test was performed with Octadiscs
(Himedia, Mumbai) using Mueller-Hinton medium. Mueller-Hinton agar plates were inoculated with 4-hour broth
culture of isolates. The plates were incubated at 37ºC for 24
hours. Results were obtained in the form of zone of clearance
(antibiotic sensitivity), measured as diameter of the zone
(in millimeters). The following antibiotic discs were used:
Ampicillin (A, 10mcg), Co-Trimoxazole, (Co, 25mcg), Tetracycline (T, 25mcg), Penicillin (P, 10units), Norfloxacin
(Nx, 10mcg), Nalidixic acid (Na, 30mcg), Cefuroxime (Cu,
Characterisation of Aeromonas species
Table 1. Origin of isolates used in current study.
S. no.
Accession
name
Location
1
A
National Institute of Oceanography, Goa
2
B
MTCC, Chandigadh
3
C
MTCC, Chandigadh
4
D
RGBC, Nagpur
5
E
Fish market, Nagpur
6
F
Water sample, Pench Reservoir
7
G
Waste water samples
8
H
Diseased fish
9
I
Diseased fish
10
J
Futala lake, Nagpur
11
K
Futala lake, Nagpur
12
L
Gandhisagar lake, Nagpur
13
M
Pench reservoir (fish)
14
N
Fish market, Nagpur
15
O
Ambazari lake (water),Nagpur
16
P
Ambazari lake (fish), Nagpur
17
Q
Ambazari lake (diseased fish),
Nagpur
18
R
Ambazari lake (diseased fish),
Nagpur
30mcg), and Pipemidic acid (Pa, 20mcg).
Genomic DNA Isolation Colonies of Aeromonas spp. were
grown in Luria-Bartani Broth and incubated at 30ºC with
continuous shaking at 100 rpm for 24 hours. A 1.5ml aliquot of culture was taken from the incubated bacterial medium and then centrifuged at 13000g for 2 minutes. The
supernatant was discarded and the sediment (pellet) was
used for DNA extraction. The protocol was followed as per
the Bacterial Genomic DNA Prep Kit (Bangalore Genei).
The extracted DNA was used for RAPD and ERIC-PCR
analyses.
Enterobacterial Repetitive Intergenic Consensus (ERIC)
PCR The ERIC PCR method utilizes primers complimentary to ERIC sequences in the genomic DNA of Aeromonas
spp. Two specific primers were used correlating to ERIC 1
(R) and ERIC 2 sequences (Table 2). PCR amplification
were performed in a 25 μl reaction volume containing 17.5
µl sterile distilled water, 2.5 µl 10x PCR buffer without
MgCl2, 3.75 mM of MgCl2, a 200µM deoxyribonucleotidephosphate (dNTP) mix, 50 pmol of each primer, 2U
Taq DNA polymerase and 1µl template DNA. The cycling
conditions were an initial denaturation at 95°C for 7 minutes, followed by 30 cycles of denaturation at 90°C for 30
seconds, annealing at 52°C for 1 minute, and extension at
65°C for 8 minutes, then a final extension at 68°C for 16
minutes.
AsPac J. Mol. Biol. Biotechnol. Vol. 20 (3), 2012
Characterisation of Aeromonas species
101
Table 2. Characteristics of molecular methods used for differentiation of Aeromonas spp.
Methods
ERICPCR
Figure 2. Antibiotic sensitivity test of isolates of Aeromonas spp. using Octadisc (Himedia). ‘Zone’ of clearance
of antibiotic sensitivity against isolates measured in diameter
(mm).
Random amplified polymorphic DNA (RAPD) PCR Ten
primers were used for RAPD typing (Table 2). Amplification for RAPD PCR was conducted in a 25µl reaction mixture containing 10x reaction buffer, a 200 µM deoxynucleotide triphosphate (dNTPs mix), 50pmol of primer, 1.5mM
of MgCl2, template DNA, and 1.5U of Taq polymerase. The
reaction mixture was denatured at 94ºC for 2 minutes, followed by 35 cycles of denaturation at 94ºC for 1 minute,
annealing at 36ºC for 1 minute, with an extension at 72ºC
for 2 minutes, and a final extension at 72ºC for 10 minutes.
Agarose gel electrophoresis The amplification products
were separated by electrophoresis on a 1.5% agarose gel (wv
-1
) in Tris-Borate buffer (0.089M Tris, 0.089M boric acid,
and 0.002M EDTA, pH8), stained with ethidium bromide
(1.6 mg/ml) and visualized under a UV light transilluminator. Sizes of the PCR products were determined by comparison with 100bp DNA ladder.
Computer assisted analysis of genomic fingerprints The
genomic fingerprints obtained were compared for similarity
by visual observation of the band patterns according to the
presence or absence of each band in each isolate. Computer
analysis was carried out by NTSYS-pc (Numerical Taxonomy System, version 2.0) software. A dendogram and PCA
was constructed by the unweighted pair-group method with
average linkages (UPGMA).
RESULTS
The results of the present investigation of Aeromonas isolates,
on the basis of biochemical and Gram staining, showed only
a few characteristics which exhibited uniformly in all isolates: gram negativity, motility, oxidase positivity and catalase positivity, ability to fermentat D-glucose, nitrate
RAPD
Primer
Name
Sequence
5’ to 3’
ERIC 1R
ATGTAAGCTCCTGGGATCAC
ERIC 2
AAGTAAGTGACTGGGGTGAGCG
OPA-04
AATCGGGCTG
OPA-08
GTGACGTAGG
OPA-09
GGGTAACGCC
OPA-13
CAGCACCCAC
OPA-14
TCTGTGCTGG
OPA-19
CAAACGTCGG
OPB-03
CATCCCCCTG
OPB-04
GGACTGGAGT
OPB-07
GGTGACGCAG
OPB-18
CCACAGCAGT
References
Versalovic,
1991;
Szczuka,
2004
Oakey,1996;
Delmare,
2002;
Szczuka,
2004;
Zulkifli,
2009
reduction and ampicillin resistance. Further, the selective
media plates with yellowish-green or yellow colored colonies
were exposed to iodine vapors which produced a clear zone
around the colonies of Aeromonas spp. The confirmatory
biochemical tests are oxidase positivity, resistance to ampicillin (10 mg/L), fermentation of dextrin and Mannitol,
ability to grow in 1% tryptone water containing 0% but not
6% NaCl, resistance to 0129 (2,4-diamino-6.7 Diisopropyl pteridine) phosphate (50mg/L) and hydrolyse arginine.
The production of H2S showing as a black color was also
found to be a typical characteristic allowing identification
of A. hydrophila. The results shown in Figure 2 represent the
antibiotic sensitivity test results of selected strains of presumptive Aeromonas isolates. The results were calculated by
taking an average of three replicates, and the zone of clearance, or antibiotic sensitivity, of isolates were measured from
the diameter (mm). Our results confirm that Aeromonas
spp. are poorly susceptible to Norfloxacin (15mm) and to a
lesser extent tetracycline (17mm). Co-Trimoxazole (21mm)
susceptibility was similar to that to Nalidixic acid (21mm);
Ampicillin and penicillin produced no clear zone, while Cefuroxime (8 mm) and Pipemidic acid (6mm) produced only
an insignificant zone of activity.
A total of ten primers (Table 2) were used for RAPD
fingerprinting of Aeromonas isolates, though some primers
did not result in amplification products for all isolates. The
resultant banding patterns (Figure 4) were analysed, and
used to produce a dendrogram showing genetic relatedness
of 18 strains of Aeromonas, determined using Jaccard’s coefficient and the UPGMA cluster method (Figure 5b). A second dendrogram was produced to show polymorphism and
three-dimensional plots extracted by principal Coordinate
analysis using UPGMA of Aeromonas isolates (Figure 6).
Distinct ERIC-PCR fingerprint patterns (Figure 3) of
102
AsPac J. Mol. Biol. Biotechnol. Vol. 20 (3), 2012
Characterisation of Aeromonas species
(a)
Figure 3. Representative ERIC-PCR patterns of different isolates of Aeromonas spp. Lane1, 2 and 3: positive reference
strains, Lane 4 - 18: isolates respectively, Lane m - molecular size 1kb markers.
(b)
Figure 4. Representative RAPD patterns of different isolates of Aeromonas spp. Lane 1, 2 and 3: positive reference strains,
Lane 4 - 18: isolates respectively, Lane m: molecular size markers.
between 3 to 9 amplification bands with similarity coefficient 0.88 were used to produce a dendrogram (Figure 4)
indicating variance in 18 isolates of Aeromonas. A dendrogram using Jaccard’s coefficient based on the UPGMA cluster method divided into two major clusters, showing genetic
relatedness of isolates determined by analysis of ERIC PCR
fingerprint patterns (Figure 5a), showed clear polymorphism
with similarity ranging from 0.37 to 0.87, indicating genetic
variance. Based on cluster analysis and principal coordinate
analysis (Figure 6), the results indicated that all accessions
could be divided into two major groups and that the clustering pattern was related to their ecological origin.
DISCUSSION
The presence and distribution of Aeromonas is not well docu-
AsPac J. Mol. Biol. Biotechnol. Vol. 20 (3), 2012
Characterisation of Aeromonas species
103
(a)
(b)
Figure 5. Dendrograms obtained from different isolates of Aeromonas spp. with UPGMA based on Jaccard’s coefficient.
(a) based on ERIC PCR fingerprint data. (b) based on RAPD data.
mented in the Vidarbha region; most studies conducted on
Aeromonas in different parts of the world provide evidence
that this bacteria is infectious to aquaculture species as well
as humans. In the present investigation, Aeromonas was isolated from fish and water samples collected from different
reservoirs of the Vidarbha region. Information about the origin of Aeromonas spp. has become very important because of
the increasing incidence of infections caused by these species.
Aeromonas is known to be susceptible to all antibiotics
active against nonfastidious Gram negative bacteria except
-lactums and resistant to ampicillin, ceohalothin, cefoxitin,
and penicillin (Goni-Urriza et al., 2000). In this research
work a screening test against various antibiotics was done;
further research to test for Minimal Inhibitory Concentrations (MIC) are needed in future to assess the clinical relevance of above mentioned strains. On the basis of biochemical and morphological tests, several of these isolates have
been demonstrated to be identical, but genetic studies like
PCR-based molecular typing have supported the existence
of genetic variability among the isolates. By using molecular
typing with the aid of RAPD and ERIC-PCR methods a
high diversity of polymorphism has been demonstrated between isolates (Szczuka, 2004).
In this study, polymorphism found among the isolates
demonstrated that Aeromonas species are highly heterogeneous. Genome fragments identified with these novel strategies may be used as genome-specific markers for dynamic
104
AsPac J. Mol. Biol. Biotechnol. Vol. 20 (3), 2012
Characterisation of Aeromonas species
(a)
(b)
Figure 6. Three-dimensional plots extracted by principal Coordinate analysis using UPGMA of Aeromonas spp. isolates. (a) 3D plot using ERIC markers. (b) 3D plot using RAPD markers.
monitoring and sequence-guided isolation of functionally
important Aeromonas populations in complex communities
such as fish microflora. As several authors have suggested
(Versalovic, 1991; Davin, 1998; Solar et al., 2003; Szczuka, 2004; Subhaskumar, 2006) molecular typing has great
discriminating power and could be used in epidemiological studies of Aeromonas spp. RAPD analysis of Aeromonas
is efficient for discriminating between isolates but is not
useful for the characterization of strains at the species level
(Delmare et al., 2002). The findings from both techniques
were shown to be suitable for the differentiation of unrelated
strains and useful for epidemiological investigation and population genetic analysis of Aeromonas spp. (Szczuka, 2004).
Three dimensional (3D) principal component analyses were
constructed to provide anther means of testing the relationships between isolates, these are known to be less sensitive
to distances between close neighbors but to represent more
accurately between clusters associations among subgenera, as
also revealed by 3D principal component analyses (Sneath
and Sokal, 1973).
In conclusion, genotyping showed considerable differentiation along the subgeneric boundaries and within the
genus Aeromonas, and by using these methods we can contribute tremendously to the understanding of overall distribution patterns of genetic variation. As a result of this study,
we know that fish and water samples taken from reservoirs
in the Vidharbha region were considerably contaminated
with Aeromonas, so clearly fish were at risk of related diseases
which also pose a threat to human health. Prevention of disease is always preferable and more cost effective than treatment of disease outbreaks. Preventive medicine programs
should be designed to minimize stress, maintain the best
water quality possible, and minimize exposure to infectious
agents. Further research is needed to identify and study the
responsible determinants of virulence.
AsPac J. Mol. Biol. Biotechnol. Vol. 20 (3), 2012
ACKNOWLEDGEMENTS
Characterisation of Aeromonas species
105
S.W. (ed.) The Genus Aeromonas. John Wiley & Sons
Ltd., Chichester, England, p.175 - 196.
The financial assistance rendered by Council of Scientific
and Industrial Research, Government of India, New Delhi
to SRK, the Junior Research Fellow during the course of this
investigation is duly acknowledged. The authors also wish
to acknowledge the National Institute of Oceanography
(NIO), Goa, India for providing the A. hydrophila culture.
Goni-Urrriza, M., Pinneau, L., Capdepuy, M., Roques, C.,
Caumette, P. and Quentin, C. 2000. Antimicrobial resistance to mesophilic Aeromonas spp. isolated from two
European rivers. Journal of Antimicrobial Chemotherapy
46: 297-301.
REFERENCES
Jaccard, P. 1908. Nouvelles recherches sur la distribution
florale. Bulletin Société Vaudoise des Sciences Naturelles
44: 223 - 270.
Altwegg, M. 1999. Aeromonas and Plesiomonas. In P. Murray, E. Baron, M. pfaller, F.Tanover & R. Yolken (ed.).
Manual of clinical Microbiology, ASM Press, Washington DC, p 507-516.
Janda, J.M. and Abbott, S.L. 1995. Human Pathogens. In
Austin, B., Altwegg, M., Gosling, P.J. and Joseph, S.W.
(ed.) The Genus Aeromonas. John Wiley & Sons Ltd.,
Chichester, England, p.151 - 174.
Aslani, M. and Hamzeh, H.S. 2004. Characterization and
Distribution of Virulence Factors in Aeromonas hydrophila Strains Isolated from Fecal Samples of Diarrheal and Asymptomatic Healthy Persons, in Ilam,
Iran. Iranian Biomedical Journal 8(4): 199 - 203.
Kallita, M.C., Mohapatra, T., Dhadapani, A. and Yadava,
D.K. 2007. Comparative evaluation of RAPD, ISSR
and anchored SSR markers in assenssing of genetic diversity in fingerprinting of oil seed Brassica genotypes.
Journal of Plant Biochemistry and Biotechnology 16(1):
41 - 48.
Austin, B. and Austin, D.A. 1999. Third ed. Chapter 2:
“Characteristics of the diseases. In Bacterial Pathogens:
Diseases of Farmed and Wild Fish”. Springer-Praxis,
Praxis Publishing, Ltd. Chichester, UK. Pp 13-15.
Cantas L., Sørby, J.R., Aleström, P. and Sørum, H. 2012.
Culturable gut microbiota diversity in zebrafish. Zebrafish 9(1): 26 - 37.
Carnaham, A.M. and Altwegg, M. Taxonomy. 1995. In
Austin, B., Altwegg, M., Gosling, P.J. and Joseph, S.W.
(Ed.) The Genus Aeromonas. John Wiley & Sons Ltd.,
Chichester, England, p.1-38.
Davin-Regli, A., Bollet, C., Chamorey, E., Colonna D’istria,
V. and Cremieux, A. 1998. A cluster of cases of infections due to Aeromonas hydrophila revealed by combined RAPD and ERIC-PCR. Journal of Medical Microbiology 47: 499 - 504.
Delamare, A.P.L., de Oliveira Artico, L., Grazziotin, F.G.,
Echeverrigaray, S. and da Costa, S.O.P 2002. Total protein Electrophoresis and RAPD fingerprinting analysis
for their identification Aeromonas at species level. Brazilian Journal of Microbiology 33: 358 - 362.
Dickeman, B., Metzger, J. and Lee, W.T. 2006. Molecular
identification of Aeromonas and coliform bacteria isolated on M- Endo media from Lake Erie water. World
Journal of Microbiology 22: 29 - 33.
Gosling, P.J. 1995. Aeromonas species in disease of animals.
In Austin, B., Altwegg, M., Gosling, P.J. and Joseph,
Koca, C. and Sarimehmetoglu, B. 2009. Isolation and Identification of motile Aeromonas spp. in turkey meat. Ankara Üniversitesi Veteriner Fakültesi Dergisi 56(2): 95
- 98.
Oakey, H., Ellis, J.J.T. and Gibson, L.F. 1996. Differentiation of Aeromonas genomospecies using random amplified polymorphic DNA polymerase chain reaction
(RAPD-PCR). Journal of Applied Bacteriology 80: 402
- 410.
Porteen, K., Agrawal, R.K. and Bhilegaonkar, K.N. 2007.
Detection of Aeromonas spp. from Chicken and fish
samples by polymerase chain reaction. American Journal
of Food Technology 2(1): 30 - 37.
Solar, L., Figueras, M.J., Chacón, M.R., Guarro, J. and
Martinez-Murcia, A.J. 2003. Comparison of three molecular methods for typing Aeromonas popoffii isolates.
Antonie van Leeuwenhoek 83(4): 341 - 349.
Subaskumar, R., Thayumanavan, T., Thilagavathy, C., Vivekanandhan, C., Savithamani, K. and Lakshmanaperumalsamy, P. 2006. Typing of haemolytic and Antibiotic
resistant Aeromonas hydrophila isolated from raw milk
of Coimbatore, South India. International Journal of
Dairy Sciences 1(1): 70 - 83.
Sneath, P.H.A. and Sokal, R.R. 1973. Numerical taxonomy:
The principles and practice of numerical classification.
Freeman, San Francisco, CA.
106
AsPac J. Mol. Biol. Biotechnol. Vol. 20 (3), 2012
Svec, P., Novakova, D. and Sedlacek, I. 2006. ERIC-PCR
fingerprinting of presumptive Aeromonas caviae strains
isolated from surface waters. In 2nd FEMS congress of
European Microbiologists, Madrid, Spain, July 4 - 8.
Szczuka, E. and Kaznowki, A. 2004. Typing of Clinical and
Environmental Aeromonas spp. Strains by Random Amplified Polymorphic DNA PCR, Repetitive Extragenic
Palindromic PCR, and Enterobacterial Repetitive Intergenic Consensus Sequence PCR. Journal of Microbiology 42(1): 220 – 228.
Trust, T.J. and Sparrow, R.A. 1974. The bacterial flora in
the alimentary tract of freshwater salmonid fishes. Canadian Journal of Microbiology 20: 1219 – 1228.
Versalovic, J., Koeuth, T. and Lupski, J.R. 1991. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic
Acids Research 19: 6823 - 6831.
Zulkifli, Y., Alitheen, N.B., Son, R., Raha, A.R., Samuel, L.,
Yeap, S.K. and Nishibuchi, M. 2009. Random amplified polymorphic DNA-PCR and ERIC PCR analysis
on Vibrio parahaemolyticus isolated from cockles in Padang, Indonesia. International Food Research Journal 16:
141 - 150.
Characterisation of Aeromonas species