Download Salp15 Binding to DC-SIGN Inhibits Cytokine Expression by Impairing both Nucleosome

Salp15 Binding to DC-SIGN Inhibits Cytokine
Expression by Impairing both Nucleosome
Remodeling and mRNA Stabilization
Joppe W. R. Hovius1,2[, Marein A. W. P. de Jong3[, Jeroen den Dunnen3, Manja Litjens3, Erol Fikrig4, Tom van der Poll1,2,
Sonja I. Gringhuis3, Teunis B. H. Geijtenbeek3*
1 Center for Experimental and Molecular Medicine, University of Amsterdam, Amsterdam, The Netherlands, 2 Center for Infection and Immunity Amsterdam (CINIMA),
University of Amsterdam, Amsterdam, The Netherlands, 3 Department of Molecular Cell Biology & Immunology, VU Medical Center, Amsterdam, The Netherlands, 4 Section
of Infectious Diseases, Department of Internal Medicine, Yale University School of Medicine, New Haven, Connecticut, United States of America
Ixodes ticks are major vectors for human pathogens, such as Borrelia burgdorferi, the causative agent of Lyme disease.
Tick saliva contains immunosuppressive molecules that facilitate tick feeding and B. burgdorferi infection. We here
demonstrate, to our knowledge for the first time, that the Ixodes scapularis salivary protein Salp15 inhibits adaptive
immune responses by suppressing human dendritic cell (DC) functions. Salp15 inhibits both Toll-like receptor- and B.
burgdorferi–induced production of pro-inflammatory cytokines by DCs and DC-induced T cell activation. Salp15
interacts with DC-SIGN on DCs, which results in activation of the serine/threonine kinase Raf-1. Strikingly, Raf-1
activation by Salp15 leads to mitogen-activated protein kinase kinase (MEK)-dependent decrease of IL-6 and TNF-a
mRNA stability and impaired nucleosome remodeling at the IL-12p35 promoter. These data demonstrate that Salp15
binding to DC-SIGN triggers a novel Raf-1/MEK-dependent signaling pathway acting at both cytokine transcriptional
and post-transcriptional level to modulate Toll-like receptor–induced DC activation, which might be instrumental to
tick feeding and B. burgdorferi infection, and an important factor in the pathogenesis of Lyme disease. Insight into the
molecular mechanism of immunosuppression by tick salivary proteins might provide innovative strategies to combat
Lyme disease and could lead to the development of novel anti-inflammatory or immunosuppressive agents.
Citation: Hovius JWR, de Jong MAWP, den Dunnen J, Litjens M, Fikrig E, et al. (2008) Salp15 binding to DC-SIGN inhibits cytokine expression by impairing both nucleosome
remodeling and mRNA stabilization. PLoS Pathog 4(2): e31. doi:10.1371/journal.ppat.0040031
pathogens in peripheral tissues, DCs capture them for
processing and presentation to activate T cells in draining
lymph nodes [8]. Previously we have shown that Salp15 is
secreted by the feeding tick and is locally introduced in the
host skin [4], where Salp15 also provides B. burgdorferi a
survival advantage in a naive murine host, but only when coinjected, ruling out a systemic immunosuppressive effect of
Salp15 [7]. However, local inhibition of immune responses by
Salp15 could be responsible for the observed effect. Under
normal circumstances there are very few T lymphocytes
present at the site of the tick-bite, whereas DCs are
abundantly present. Therefore, we hypothesized that DCs
are a major target for immunomodulation by Salp15, since
these cells are essential in initiating adaptive immune
responses to exposed tick (salivary gland) antigens and B.
burgdorferi in a naive host.
Here we have investigated the interaction of the major
immunomodulatory protein in Ixodes scapularis saliva, Salp15,
with human DCs. Salp15 inhibits the production of the proinflammatory cytokines IL-12p70, IL-6, and TNF-a of DCs
Introduction
Ixodes ticks are a major arthropod vector for human
pathogens, such as Borrelia burgdorferi, the causative agent of
Lyme disease [1]. Ixodes ticks require five to seven days to feed
to repletion [2]. In order to secure attachment of the vector
and to ensure susceptibility of reservoir hosts for future tick
infestations, tick saliva contains modulators of host immune
responses. Salp15, a 15-kDa salivary gland protein, is a major
immunomodulatory protein in I. scapularis saliva [3]. Salp15
has been shown to bind to CD4, thereby inhibiting T cell
receptor (TCR) ligation-induced signals, resulting in impaired interleukin (IL)-2 production and impaired CD4þ T
cell activation and proliferation [4–6]. While feeding on a
host, ticks can introduce B. burgdorferi into the host’s skin.
Local immunosuppression of the host by tick molecules
assists B. burgdorferi in establishing an infection. In addition, it
has been shown that Salp15 binds to B. burgdorferi outer
surface protein (Osp) C [7]. B. burgdorferi expresses OspC in
the tick salivary glands and during the early stages of
mammalian infection. Binding of Salp15 to OspC protects
the spirochete from antibody-mediated killing by the
immune host [7], and silencing of Salp15 by RNA interference
in I. scapularis ticks resulted in a dramatically impaired ability
to transmit B. burgdorferi to an immune host [7]. Thus, Salp15
is an important immunomodulatory protein in I. scapularis
saliva that targets the T cell arm of adaptive immunity.
Dendritic cells (DCs) are essential in initiating adaptive
immune responses in naive hosts [8]. After sensing invading
PLoS Pathogens | www.plospathogens.org
Editor: Frederick M. Ausubel, Harvard Medical School, United States of America
Received August 8, 2007; Accepted January 2, 2008; Published February 15, 2008
Copyright: Ó 2008 Hovius et al. This is an open-access article distributed under the
terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author
and source are credited.
* To whom correspondence should be addressed. E-mail: [email protected]
[ These authors contributed equally to this work.
0001
February 2008 | Volume 4 | Issue 2 | e31
Salp15 Suppresses Human DC Function
Author Summary
cytotoxicity of Salp15 as determined by 7-AAD staining
(unpublished data). DCs incubated with the TLR-2 ligand
LTA showed a similar downregulation of pro-inflammatory
cytokines in the presence of Salp15 (Figure S1). Thus, Salp15
suppresses TLR-induced cytokine responses by DCs.
Whole tick saliva obtained from Ixodes ricinus did not induce
maturation by itself or cytokine production, but there was a
decrease in pro-inflammatory cytokine production when
saliva was added to DCs in combination with LPS similar to
Salp15 (Figure 1A and 1D). These data indicate that Salp15 in
Ixodes saliva is responsible, although not necessarily exclusively, for reducing pro-inflammatory cytokine production by
DCs. The increase in IL-8 caused by recombinant Salp15 was
not observed as clearly in tick saliva, indicating that other tick
molecules could hamper IL-8 production by human DCs.
Similar to Salp15, DCs stimulated with LPS in the presence of
tick saliva did not have an increased production of the
cytokine IL-10 compared to DCs stimulated with LPS alone
(Figure 1D).
Upon attachment of the tick, the host elicits both innate and
adaptive immune responses directed against the vector. In turn,
ticks have developed countermeasures to withstand and evade host
immune responses. In the current paper we demonstrate how a tick
salivary protein induces immunosuppression of human dendritic
cells and how this could facilitate infection with B. burgdorferi, the
causative agent of Lyme disease. Insight into the molecular
mechanism of immunosuppression by tick salivary proteins might
provide innovative strategies to combat Lyme disease or other tickborne illnesses and could lead to the development of novel antiinflammatory or immunosuppressive drugs.
stimulated with the Toll-like receptor (TLR)-2 and 4 ligands,
LTA and LPS, respectively. Salp15 interacts with the C-type
lectin DC-SIGN, which results in activation of the kinases Raf1 and mitogen-activated protein kinase kinase (MEK). This
leads to the inhibition of pro-inflammatory cytokine production and suppresses the T cell–stimulatory role of DCs.
Strikingly, the Salp15/DC-SIGN-induced signaling pathway
regulates the inhibition of pro-inflammatory cytokines at
different levels: decreased nucleosome remodeling at the IL12p35 promoter impairs IL-12p70 production, whereas the
inhibition of IL-6 and TNF-a is caused by an increased decay
of their respective mRNAs. A similar suppression of proinflammatory cytokines is observed when DCs are activated
with viable B. burgdorferi in the presence of Salp15, indicating
that the spirochete uses Salp15 to induce immune suppression. Thus, local interaction of Salp15 and DCs will lead to
immunosuppression, which potentially allows the tick to feed
for a longer period of time, and B. burgdorferi to escape from
human immune responses, and might therefore be an
important factor in the pathogenesis of Lyme disease.
Salp15 Interacts with Dendritic Cells through the C-Type
Lectin DC-SIGN
To further investigate the interaction of Salp15 and DCs,
we investigated the binding of Salp15 to DCs. Salp15 interacts
with DCs, and this interaction could be blocked to background levels by pre-incubating DCs with the calcium and
magnesium-chelator EDTA, and the mannose-specific C-type
lectin inhibitor mannan (Figure 2A). This strongly indicates
that C-type lectins are involved in binding of Salp15 to DCs.
Analysis of carbohydrate structures on Salp15 demonstrated
that recombinant Drosophila-expressed Salp15 contains mannose and galactose structures, since the mannose- and
galactose-specific plant lectins Con A and Peanut agglutin
(PNA) strongly bound to Salp15 (Figure 2B). Similar to Ixodes
ticks, Drosophila belongs to the phylum of Arthropoda,
suggesting that Salp15 glycosylation is similar to native
Salp15 in tick saliva.
Salp15 binding to DCs could be blocked with mannan, Nacetyl-D-glucosamine (GlcNac), Lewis X (LeX), Lewis Y (LeY),
and Fucose (Figure 2C). These carbohydrates all have high
affinity for the C-type lectin receptor DC-SIGN, suggesting
that DC-SIGN mediates binding of Salp15 to DCs. To
investigate the cellular binding of Salp15 to DC-SIGN we
used a Raji cell line transfected with DC-SIGN and
demonstrated that Salp15 binds to DC-SIGN-transfected
cells, but not to mock-transfected cells (Figure 2D). The
interaction between Raji cells expressing DC-SIGN and
Salp15 could be blocked with mannan, similar to the
interaction of Salp15 to DCs. HIV-1 gp120 binding to DCSIGN seems stronger than Salp15, although this could reflect
differences in coating of the fluorescent beads. DC-SIGN
binding to Salp15 was further assessed in a DC-SIGN-Fc
binding ELISA. DC-SIGN-Fc interacted with plate-bound
Salp15 and binding could be blocked with EDTA and
mannan, suggesting that the binding is specific for DC-SIGN
(Figure 2E). Furthermore, deglycosylation of Salp15 by Nglycosidase F (PGNaseF) abrogated the binding to DC-SIGNFc, demonstrating that the carbohydrate structures on Salp15
are essential to the interaction with DC-SIGN (Figure 2E).
Due to interaction of murine anti-DC-SIGN blocking antibodies with goat-anti-mouse IgG antibodies used to generate
the fluorescent Salp15-beads, we were unable to investigate
Results
Salp15 Inhibits Pro-Inflammatory Cytokine Production by
Dendritic Cells upon Stimulation with LPS
To investigate the effect of Salp15 on human DC function,
we incubated immature DCs with different concentrations of
recombinant Salp15 for 18 h and analyzed DC maturation
and cytokine production. Salp15 alone did not induce
upregulation of the maturation markers CD80, CD83, or
CD86 (Figure 1A). In addition, DCs incubated with Salp15 did
not secrete detectable levels of IL-10, IL-6, IL-8, IL-12p70, or
TNF-a (Figure 1B). Thus, Salp15 by itself does not affect
activation of DCs.
Next, we investigated the effect of Salp15 on DC maturation and activation induced by the TLR-4 ligand LPS. DCs
incubated with LPS in combination with Salp15 showed an
upregulation of the maturation markers CD80, CD83, and
CD86 similar to DCs incubated with LPS alone (Figure 1A).
LPS induced the secretion of the cytokines IL-6, IL-8, IL-10,
IL-12p70, and TNF-a by DCs. Strikingly, production of the
pro-inflammatory cytokines IL-6, IL-12p70, and TNF-a was
inhibited by Salp15 in a dose-dependent manner (Figure 1B).
This effect was observed at both protein and mRNA level
(Figure 1B and 1C). IL-8 levels were increased at both the
protein and mRNA level, whereas IL-10 production was only
affected at the mRNA level (Figure 1B and 1C). The inhibition
of pro-inflammatory cytokine production was not due to
PLoS Pathogens | www.plospathogens.org
0002
February 2008 | Volume 4 | Issue 2 | e31
Salp15 Suppresses Human DC Function
Figure 1. Salp15 and Ixodes Tick Saliva Do Not Affect DC Maturation, but Dose-Dependently Inhibit IL-12, IL-6, and TNF-a Production
(A) Salp15 does not interfere with DC maturation. Immature DCs were stimulated with Salp15 or tick saliva alone in the presence or absence of 10 ng/ml
LPS. 18 h post-stimulation DCs were analysed by flow cytometry (FACS) for surface expression of maturation markers CD80, CD83, and CD86. The thin
lines represent DCs incubated without LPS and the bold lines those of DCs incubated with LPS. The isotype control is depicted in the left three graphs.
(B and C) Salp15 inhibits pro-inflammatory cytokine production by DCs. Immature DCs were stimulated with control medium (white bars), Salp15 (50,
25, or 12.5 lg/ml; black bars) in the presence of 10 ng/ml LPS. As a control, immature DCs were incubated with control buffer or Salp15 (25 lg/ml) in
the absence of LPS. Supernatants were analyzed after 18 h for cytokine production (B), and for isolation of mRNA cells were lysed after 6 h of incubation
and cytokine gene expression was measured by quantitative real time PCR. LPS was set at 1 (C).
(D) Tick saliva inhibits pro-inflammatory cytokines by DCs. Immature DCs were treated with tick saliva (dilutions of 1:75, 1:150, and 1:300; black bars) in
the presence of 10 ng/ml LPS as described in (B).
For (B) and (D) bars represent the average of duplicates or triplicates from one experiment 6 SE. The results are representative of at least three
independent experiments. For (C) bars represent the mean of four to six independent experiments 6 SE. Differences in cytokine production by DCs
stimulated with LPS and DCs stimulated with LPS in the presence of Salp15 or tick saliva were analyzed by a two-sided one way ANOVA, implementing a
one way analysis of variance and a Dunnett multiple comparison test. A p-value , 0.05 was considered statistically significant. (*) 0.01 , p , 0.05; two
asterisks (**) 0.001 , p , 0.01.
doi:10.1371/journal.ppat.0040031.g001
the biotinylated cell-surface proteins were visualized by
streptavidin-PO. The Salp15 immunoprecipitate showed only
one distinct band with an apparent molecular weight of 45–
50 kDa (Figure 2F). The size of the immunoprecipitate
corresponded to the size of DC-SIGN, which was immunoprecipitated with beads coupled to anti-DC-SIGN antibodies.
whether these anti-DC-SIGN antibodies were able to block
Salp15 binding to DC-SIGN in our bindings assays. Instead,
we used Salp15-coupled Prot-A-Sepharose beads to immunoprecipitate the receptor for Salp15 from a cell-surface
biotinylated DC lysate. The immunoprecipitate was analyzed
by SDS-PAGE, transferred to a nitrocellulose membrane and
PLoS Pathogens | www.plospathogens.org
0003
February 2008 | Volume 4 | Issue 2 | e31
Salp15 Suppresses Human DC Function
Figure 2. Salp15 Interacts with DCs through the C-Type Lectin DC-SIGN
(A) Salp15 binds to DC-SIGN on DCs. A fluorescent bead adhesion assay was performed using fluorescent beads coated with HIV-1 gp120 (positive
control) and Salp15. As negative control beads we used antibody (anti-V5) coated beads. Immature DCs were incubated with the ligands and binding
was measured by FACS analysis. Specificity was determined by preincubation of DCs with EDTA or mannan (significance determined by a two-sided one
way ANOVA, implementing a one way analysis of variance and a Dunnett multiple comparison test).
(B) Salp15 contains mannose and galactose-specific glycosylations. The glycosylation pattern of Salp15 was analysed by a plant lectin ELISA. For
abbreviations see Materials and Methods.
(C) Salp15 binding to DCs is inhibited by carbohydrates that interact with DC-SIGN. Specificity of binding of DCs to Salp15 was further assessed by
pretreating DCs with mannan, free carbohydrate structures (Galactose, N-acetylgalactosamine [GalNac], N-acetyl-D-glucosamine [GlcNac], or Fucose), or
biotinylated Lewis-X/Y (LeX/Y) before performing the fluorescent bead adhesion assay as described in (A). Salp15 binding was set at 100%.
(D) Salp15 interacts specifically with DC-SIGN. The fluorescent bead adhesion assay was performed using the Raji-cell line transfected with DC-SIGN.
Mannan and EDTA was used to determine specificity for C-type lectins.
(E) Glycosylation of Salp15 is important in the interaction with DC-SIGN. A DC-SIGN-Fc binding ELISA was performed on Salp15, deglycosylated Salp15
(by incubation with PGNaseF), and mannan (positive control). For Salp15 and mannan DC-SIGN-Fc binding could be blocked by preincubation with
mannan (significance determined by a two-sided unpaired Student t-test).
(F) DC-SIGN is the major receptor on immature DCs for Salp15. Both a cell-surface biotinylated and non-biotinylated DC lysate were incubated with
Salp15-coupled protein A-Sepharose beads. The biotinylated immunoprecipitate was analysed on SDS-PAGE, transferred to a nitrocellulose membrane,
and detected by streptavidin-PO. The non-biotinylated immunoprecipitate was analyzed by SDE-PAGE, transferred to a nitrocellulose membrane, and
detected by anti-DC-SIGN antibodies. As controls, anti-DC-SIGN protein A-Sepharose beads and anti-V5-protein A-Sepharose beads were used.
Adhesion experiments and ELISAs are representative of at least three independent experiments. Error bars, where depicted, represent the SE of
duplicates or triplicates within one experiment. A p-value , 0.05 was considered statistically significant. (*) 0.01 , p , 0.05; two asterisks (**) 0.001 , p
, 0.01. The immunoprecipitations are representative of two experiments.
doi:10.1371/journal.ppat.0040031.g002
PLoS Pathogens | www.plospathogens.org
0004
February 2008 | Volume 4 | Issue 2 | e31
Salp15 Suppresses Human DC Function
MEK1/2 inhibitor U0126 could block Salp15-induced inhibition of DC cytokine production. Inhibition of MEK
completely blocked the Salp15-induced modulation of
cytokine production (Figures 3E and S2C). Strikingly, despite
a role for MEK kinases in Salp15-induced signaling, stimulation of immature DCs with Salp15 did not lead to ERK
activation as assessed by the phosphorylation of ERK (Figure
3F and 3G), which is a prerequisite for ERK activation [11].
Activation was followed over time but no phosphorylation of
ERK in the presence of Salp15 could be detected (Figure 3G).
In addition, ERK activation by LPS was not altered in the
presence of Salp15, demonstrating that Salp15 does not
sequester MEK away from ERK and thereby inhibiting LPSinduced cytokine production. Thus, Salp15 binding to DCSIGN modulates DC function through a Raf-1- and MEKdependent, but ERK-independent pathway that is distinct
from the recently identified ManLAM/DC-SIGN-induced
signaling pathway that results in Raf-1-dependent but MEKindependent phosphorylation and acetylation of p65 [9].
To confirm that the Salp15-coupled beads had selectively
pulled down DC-SIGN, we also immunoprecipitated the
receptor for Salp15 from non-biotinylated DC lysate. The
immunoprecipitate was analyzed by SDS-PAGE, transferred
to a nitrocellulose membrane, and visualized with antibodies
against DC-SIGN showing a band at 45–50 kDa (Figure 2F)
confirming that Salp15 binds to DC-SIGN on DCs.
Salp15-Induced Activation of Raf-1 Inhibits ProInflammatory Cytokine Production
Next, we investigated the intracellular signaling pathways
that Salp15 induces to inhibit the expression of proinflammatory cytokines by DCs. Recently, we have demonstrated that binding of mycobacterial ManLAM to DC-SIGN
leads to activation of the serine/threonine kinase Raf-1 [9].
We investigated whether binding of Salp15 to DCs also
activates Raf-1 by assessing phosphorylation of the Serine
(S)338 and Tyrosine (Y)340/341 phosphorylation sites of Raf1. Indeed, Salp15 induced phosphorylation of both sites
(Figure 3A), demonstrating that Salp15 activates Raf-1 similar
to ManLAM. Phosphorylation was partially blocked by
blocking antibodies against DC-SIGN (Figure 3A).
Next, we investigated whether Raf-1 silencing through RNA
interference could prevent the Salp15-induced inhibition of
DC cytokine production. Immature DCs were transfected
with siRNA specifically targeting Raf-1, while expression of
the closely related kinase B-Raf remained unaltered as
determined by quantitative real-time PCR (Figure 3B). Raf-1
silencing at the protein level was complete since Raf-1
protein was not detected in silenced DCs as determined by
immunofluorescence analysis (unpublished data). Silencing of
Raf-1 in DCs completely abrogated the Salp15-induced
inhibition of cytokines, since stimulation of Raf-1 silenced
DCs with LPS in the presence of Salp15 restored IL-12p35,
IL-6, TNF-a, IL-8, and IL-10 levels to those observed in DCs
stimulated with LPS alone (Figures 3C and S2A). To confirm
the Raf-1 silencing data, we also used the Raf inhibitor
GW5074 and observed a similar restoration of pro-inflammatory cytokine levels in DCs treated with the Raf inhibitor
in the presence of LPS and Salp15 (Figures 3D and S2B). IL-8
enhancement by Salp15 was abrogated by GW5704 mostly at
the mRNA level, whereas IL-10 was not increased by Salp15
(Figure S2B). These data demonstrate that Raf-1 is essential
for the inhibition of pro-inflammatory cytokine production
by Salp15.
Next, we investigated the downstream effectors of Raf-1.
Raf-1 activation by ligation of ManLAM to DC-SIGN leads to
phosphorylation of the NF-kB subunit p65 at residue S276,
which subsequently results in acetylation of p65 by the
histone acetyltransferases (HATs) p300 and CREB binding
protein (CBP) [9]. Acetylation of p65 leads to an increased IL10 cytokine response by DCs, which is inhibited by the CBP/
p300-inhibitor anacardic acid [9]. Strikingly, anacardic acid
(AA) did not prevent Salp15-induced modulation of IL12p35, IL-6, TNF-a, IL-8, and IL-10 transcription (Figures 3E
and S2C), whereas it did abrogate ManLAM-induced DC
cytokine production (unpublished data, [9]), indicating that
Salp15 induces downstream signaling cascades different from
ManLAM-induced DC-SIGN signaling. Raf kinases are well
known for their ability to activate MEK 1 and 2, that
subsequently activate extracellular signal-regulated kinase
(ERK) 1 and 2 [10]. Therefore, we investigated whether the
PLoS Pathogens | www.plospathogens.org
Salp15 Downregulates Pro-Inflammatory Cytokines by
Increasing IL-6 and TNF-a mRNA Decay and Impairing
Nucleosome Remodeling at the IL-12p35 Promoter
Since we demonstrated that phosphorylation and acetylation of p65 was not responsible for the observed Salp15induced modulation of cytokine responses, we set out to
identify the mechanisms responsible for the Salp15-induced
Raf-1/MEK-dependent decrease in TLR-induced pro-inflammatory cytokines. Gene expression is regulated by complex
mechanisms at many stages, including chromatin accessibility, transcription activation, mRNA nuclear export, mRNA
decay, and translation. Many cytokine genes are subject to
regulation at the level of mRNA decay through the presence
of mRNA-stability elements, particularly AU-rich elements,
within their 39 untranslated regions, as it provides the means
to use transcripts with optimal efficiency and to respond
rapidly to cellular signals [12,13]. Therefore we determined
the effect of Salp15 on mRNA stability. DCs were stimulated
with LPS and Salp15 in the presence or absence of Raf and
MEK inhibitors. After 6 h, actinomycin D was added to block
mRNA synthesis, and cells were harvested every 20 min for 2
h and mRNA decay was determined. Both TNF-a and IL-6
mRNA showed a strongly decreased half-life in the presence
of Salp15 and LPS compared to LPS alone (Figure 4A). IL-6
mRNA half-life was completely restored by the Raf and MEK
inhibitors, GW5074 and U0126, respectively. Inhibition of
Raf-1 by GW5074 also completely abrogated the effects of
Salp15 on TNF-a mRNA half-life. We could not assess
whether the MEK inhibitor abrogated the effect of Salp15
on TNF-a mRNA half-life, since inhibition of MEK has been
shown to affect nucleocytoplasmic transport of TNF-a mRNA
[14]. Strikingly, IL-12p35 mRNA stability remained unchanged in LPS-activated DCs in the presence of Salp15
compared to DCs stimulated with LPS alone, indicating that
the decrease in IL-12 is not regulated at the level of mRNA
stability. In addition, there was no change in IL-8 and IL-10
mRNA stability in the presence of Salp15 (Figure S3).
Previously, it has been described that regulation at the level
of chromatin accessibility is an important factor in the
regulation of IL-12p35 transcription. IL-12p35 gene activation
during DC maturation involves selective and rapid remodeling of nucleosome 2 in the IL-12p35 promoter region [15]. To
0005
February 2008 | Volume 4 | Issue 2 | e31
Salp15 Suppresses Human DC Function
Figure 3. DC Cytokine Inhibition by Salp15 Is Raf-1-Dependent
(A) Salp15 induces phosphorylation of Raf-1. DCs were pretreated with medium or with blocking anti-DC-SIGN antibodies (AZN-D2) before addition of
25 lg/ml Salp15. Intracellular phosphorylation of Raf-1 was measured by flow cytometry using rabbit anti-phospho-c-Raf (Ser338) mAb and rabbit antic-Raf (Tyr341) pAb.
(B) Raf-1 was specifically silenced by siRNA. DCs were transfected with 100 nM siRNA (Raf-1 or non-targeting siRNA as a control). Raf-1 and B-Raf mRNA
was quantified by real-time PCR using gene-specific primers. Relative mRNA expression was corrected for GAPDH expression.
(C) RNAi-mediated silencing of Raf-1 abrogates Salp15-mediated cytokine inhibition. siRNA-treated cells were stimulated for 6 h with LPS in the
presence or absence of 25 lg/ml Salp15. Cytokine gene expression was measured by real time PCR and corrected for GAPDH expression. Relative mRNA
expression of LPS-stimulated non-targeting siRNA-treated cells was set at 1.
(D) Raf-1 inhibition by GW5704 abrogates Salp15-mediated cytokine inhibition. DCs were incubated with 1 lM GW5704, or DMSO as a negative control,
for 2 h before stimulation with LPS for 6 h (mRNA) or 18 h (protein) in the presence or absence of 25 lg/ml Salp15. Cytokine gene expression was
measured by real time PCR and corrected for GAPDH expression. Relative mRNA expression of LPS-stimulated cells was set at 1. For protein levels, LPS
was set at 100%, which is representative of 133 6 17 pg/ml IL-12p70; 9,188 6 850 pg/ml TNF-a, and 1,563 6 800 pg/ml IL-6. GW5704 alone did not
induce cytokine production (unpublished data).
PLoS Pathogens | www.plospathogens.org
0006
February 2008 | Volume 4 | Issue 2 | e31
Salp15 Suppresses Human DC Function
(E) MEK1/2-inhibitor U0126 blocks Salp15-mediated cytokine inhibition. DCs were pre-incubated for 2 h with anacardic acid (AA), an inhibitor of the
histone acetyltransferases p300 and CBP, U0126, an inhibitor of MEK1 and MEK2, or DMSO as a negative control. Cells were stimulated as described in
(C) and cytokine gene expression was measured by real time PCR and corrected for GAPDH expression. Relative mRNA expression of LPS-stimulated
cells was set at 1.
(F and G) Salp15 does not induce phosphorylation of ERK. DCs were stimulated for 0 to 45 min with Salp15 (25 lg /ml), LPS, or PMA/Ionomycin as a
positive control. Phosphorylation of ERK was determined by flow cytometry using a rabbit anti-phospho-p44/42 MAPK (Thr202/Tyr402) mAb.
Bars represent the mean of at least three independent experiments 6 SE. For (C) mRNA expression levels in non-target siRNA-treated DCs activated
with LPS þ Salp15 were compared to Raf-1 siRNA-treated DCs activated with LPS þ Salp15. In (D) and (E) levels in DCs treated with LPS þ Salp15 were
compared to levels in DCs treated with LPS þ Salp15 in the presence of the indicated inhibitor. A two-sided unpaired Student t-test was applied and a pvalue , 0.05 was considered statistically significant. (*) 0.01 , p , 0.05; two asterisks (**) 0.001 , p , 0.01.
doi:10.1371/journal.ppat.0040031.g003
investigate the effect of Salp15 on nucleosome remodeling at
the IL-12p35 promoter we used a Chromatin accessibility by
real time PCR (ChART) assay [16]. In the presence of LPS,
rapid nucleosome remodeling at the IL-12p35 promoter
occurs in DCs, allowing for efficient transcription initiation
(Figure 4B). Strikingly, Salp15 severely impaired this nucleosome remodeling, whereas both Raf and MEK inhibitors
restored the level of remodeling to that observed with LPS
alone (Figure 4B). Thus, Salp15 impairs nucleosome remodeling at the IL-12p35 promoter through a Raf-1/MEK-dependent signaling pathway, which results in decreased IL-12p35
mRNA expression in DCs.
Therefore, Salp15-DC-SIGN signaling regulates cytokine
production at both transcriptional and post-transcriptional
levels; the decreased IL-12p70 production in the presence of
Salp15 and LPS is dependent on nucleosome remodeling at
the IL-12p35 promoter, while the downregulation of IL-6 and
TNF-a is a result of increased mRNA decay.
DCs, similar to DCs activated by LPS in the presence of
Salp15 (Figure 6B). B. burgdorferi, in contrast to LPS, did
induce IL-1b production by human DCs (Figure 6B). Similar
to the other pro-inflammatory cytokines IL-1b was inhibited
by Salp15. In addition, compared to B. burgdorferi alone, B.
burgdorferi preincubated with Salp15 induced enhanced
production of the immunomodulatory cytokine IL-10 by
DCs; this was similar to what was observed for LTA (Figure
S1), underscoring the fact that the set of cytokines produced
by human DCs is dependent on the TLR-ligand. Thus, these
data demonstrate that the interaction of Salp15 with B.
burgdorferi assists B. burgdorferi in altering and potentially
evading host adaptive immune responses during early human
infection.
Discussion
The main vectors for Borrelia burgdorferi, the causative agent
of Lyme borreliosis, are ticks belonging to the Ixodes genus. In
Europe, B. burgdorferi is transmitted by I. ricinus, whereas in the
United States B. burgdorferi is predominantly transmitted by I.
scapularis. Upon attachment of the tick, the host elicits both
innate and adaptive immune responses directed against the
vector. In turn, ticks have developed countermeasures to
withstand and evade host immune responses. Therefore, tick
saliva contains anticoagulant, vasodilatory, and immunosuppressive molecules and is abundantly secreted into the
host’s skin during tick feeding. The balance between host
immune responses and the vector’s immunosuppressive
countermeasures determines the duration of tick attachment,
the degree of engorgement of the tick, but also the extent of
B. burgdorferi transmission [18–20].
Salp15 is a protein in I. scapularis saliva that is induced
during feeding and it is abundantly secreted into the host. I.
ricinus contains a Salp15 homologue, Salp15 Iric-1 (GenBank
accession number: ABU93613) with 82% similarity to Salp15
from I. scapularis [21]. Previously, we have shown that native
Salp15 can be readily detected in host skin at the site of the
tick-bite [4]. Salp15 has been shown to inhibit CD4þ T cell
activation [4], and to interfere with T cell receptor signaling
[6] through binding to CD4 [5], which results in the inhibition
of IL-2 production upon recognition of cognate antigens.
However, low numbers of T cells are present in the dermis of
the skin, the site where Salp15 is secreted during tick feeding.
In contrast, DCs, as sentinels and initiators of adaptive
immune responses, are abundantly localized in the skin and
might therefore be targeted by the tick to suppress the
initiation of adaptive immune responses. Indeed, we demonstrate that I. scapularis Salp15 interacts with human DCs and
that Salp15 impairs TLR-induced pro-inflammatory cytokine
production by DCs and suppresses DC-induced T lymphocyte
activation. DCs recognize antigens by TLRs and C-type
Salp15 Blocks T Cell Activation by Mature Dendritic Cells
T lymphocyte activation by mature DCs is essential to
initiate an effective adaptive immune response against
invading pathogens. Therefore we investigated whether
Salp15 interfered with the T lymphocyte activation capacity
of DCs by performing a mixed leukocyte reaction (MLR). DCs
were incubated with Salp15 and LPS for 18 h. The DCs were
washed extensively to remove remaining Salp15 before
allogenic lymphocytes were added, because it has been shown
that Salp15 can directly inhibit T cell activation [4,5]. DCs
pretreated with Salp15 alone did not suppress lymphocyte
proliferation. However, LPS-matured DCs pre-incubated
with Salp15 or tick saliva were less capable of inducing
lymphocyte proliferation compared to DCs matured with LPS
alone (Figure 5A and 5B). These data demonstrate that Salp15
in tick saliva does not only alter cytokine responses of DCs,
but also inhibits T cell proliferation induced by DCs.
Salp15 Suppresses DC-Mediated Cytokine Responses
Induced by Borrelia burgdorferi
A recent study demonstrated that B. burgforferi alone does
not suppress DC functions [17]. Since B. burgdorferi has been
shown to interact with Salp15 to evade host antibodymediated killing [7], we investigated whether B. burgdorferi
could also benefit from the inhibition of DC cytokine
production by Salp15. Therefore, we determined DC cytokine
production by stimulating DCs with viable B. burgdorferi alone
or in the presence of Salp15. B. burgdorferi alone induced DC
maturation and pro-inflammatory cytokine secretion, as has
been shown before [17]. Preincubation with Salp15 did not
affect the upregulation of DC maturation markers by B.
burgdorferi (Figure 6A). However, Salp15 inhibited the proinflammatory cytokine production by B. burgdorferi-activated
PLoS Pathogens | www.plospathogens.org
0007
February 2008 | Volume 4 | Issue 2 | e31
Salp15 Suppresses Human DC Function
Figure 4. Salp15 Destabilizes IL-6 and TNF-a mRNA and Impairs Nucleosome Remodeling at the IL-12p35 Promoter
(A) Salp15 destabilizes IL-6 and TNF-a mRNA. DCs were stimulated with Salp15 and LPS for 6 h. Actinomycin D (ActD) was added to block new mRNA
synthesis. Cells were harvested for 2 h to determine mRNA half-life. IL-12p35 mRNA stability remained unaltered in the presence of Salp15, whereas IL-6
and TNF-a mRNA half-life was strongly reduced. This was completely restored using Raf (GW5074) or MEK (U0126) inhibitors. Bars represent the mean of
two independent experiments 6 SE. ND: Not determined.
(B) IL-12 inhibition by Salp15 is a result of decreased nucleosome remodeling at the IL-12p35 promoter. Cells were stimulated as described before and
harvested. Using enzymatic digestion, nucleosome remodeling was measured by quantitative real time PCR. Results are expressed as a percentage of
the remodeling observed in EcoRI-digested samples. The decreased remodeling induced by Salp15 could be completely restored using Raf (GW5074) or
MEK (U0126) inhibitors. Results represent results from one donor.
doi:10.1371/journal.ppat.0040031.g004
lectins. DC-SIGN is a C-type lectin abundantly expressed by
DCs. It is becoming clear that DC-SIGN is involved in
pathogen recognition, but that several pathogens target this
receptor to modulate DC functions [22]. We here demonstrate that Salp15 targets the C-type lectin DC-SIGN on DCs
to activate a Raf-1/MEK-dependent signaling cascade that
results in downregulation of pro-inflammatory cytokines
induced not only by TLR-2 and TLR-4 ligands, but also by
viable B. burgdorferi. This downregulation is a result of
decreased IL-6 and TNF-a mRNA stability and impaired
nucleosome remodeling at the IL-12p35 promoter. Moreover,
our data demonstrate that Salp15 and tick saliva inhibit T cell
activation. Therefore, B. burgdorferi could use Salp15 in saliva
to suppress DC-mediated cytokine production, which might
assist the spirochete in establishing an infection of the host.
I. scapularis Salp15, similar to tick saliva, inhibited the
production of the pro-inflammatory cytokines IL-12p70, IL-6,
and TNF-a by LPS-activated DCs. These data indicate that
PLoS Pathogens | www.plospathogens.org
Salp15 present in tick saliva induced the observed cytokine
suppression. Indeed, anti-Salp15 antibodies prevented the
suppression of IL-12 by tick saliva (unpublished data). This is
also supported by the Salp15 concentrations used in this
study, since approximately 0.1% of tick saliva consists of
Salp15 which equals a concentration of 1 lg/ml [4] and the
concentration of Salp15 increases over time during tick
feeding, reaching high concentrations locally. Our observations are in line with data from Cassavani et al. showing that
saliva from the Rhipicephalus sanguineus tick inhibits IL-12
production by murine bone marrow–derived DCs [23]. Also,
very recently, I. scapularis saliva was shown to dose-dependently inhibit IL-12 and TNF-a production by murine bone
marrow–derived DCs [24]. Although the authors contribute
this effect to Prostaglandin E2 (PGE2), they state that other
DC modulators might be present in I. scapularis saliva.
Importantly, both studies were performed with murine DCs,
whereas our experiments are performed with human DCs.
0008
February 2008 | Volume 4 | Issue 2 | e31
Salp15 Suppresses Human DC Function
production (Figure 6). Immunosuppression of the host by
Salp15 could be advantageous to the arthropod vector and
the spirochete, since it could impair adaptive immune
responses to both tick as well as B. burgdorferi antigens and
could therefore be an important factor in the pathogenesis of
Lyme diseases. Interestingly, Ramamoorthi et al. have shown
that Salp15 mRNA levels were 13-fold higher in B. burgdorferiinfected engorged ticks than in uninfected controls [7]. This
symbiosis might be the result of millions of years of coevolution of the spirochete and the arthropod vector.
Pro-inflammatory cytokines, such as IL-12, are essential to
T cell activation as well as differentiation [26], and indeed
Salp15, as well as tick saliva, inhibits DC-mediated T
lymphocyte activation (Figure 5). This inhibition was not
due to a direct effect of Salp15 on lymphocyte proliferation,
since, besides extensive washing of the DCs before addition of
lymphocytes, simultaneous addition of lymphocytes and
Salp15 to DCs did not result in impaired lymphocyte
proliferation (unpublished data).
The inhibition of DC cytokine production by Salp15 we
describe here and the previously described direct inhibition
of T cell activation through binding to CD4 [4,5] could be
complementary to each other. Salp15 could inhibit T cell
activation by directly binding to CD4 on T cells entering the
tick-host-pathogen interface. In addition, inhibition of
cytokine production by DCs by Salp15 could inhibit these
DCs from adequately activating T cells in regional lymph
nodes or at the site of the feeding lesion. Both approaches
will lead to decreased numbers of effector T cells and
impaired adaptive immune responses. In contrast to T cells,
DCs express only low levels of CD4 [27] suggesting that CD4 is
not a major receptor for Salp15 on human DCs. Indeed, only
DC-SIGN was immunoprecipitated by Salp15 from immature
DC lysates (Figure 2), supporting our findings that DC-SIGN
plays an important role in the observed immunosuppression.
However, we can not exclude a low affinity/avidity interaction
between Salp15 and another receptor on DCs, possibly CD4.
Several pathogens and parasites have been demonstrated
to target DC-SIGN on DCs to modulate DC-mediated
immune responses [22,28] leading to evasion of host immune
responses and prolonged pathogen survival. Blocking antibodies against DC-SIGN were not effective in restoring
cytokine responses inhibited by Salp15 (unpublished data)
suggesting that even a decreased binding of Salp15 to DCs is
sufficient to inhibit cytokine responses. Recently, we have
demonstrated that binding of various pathogens such as
Mycobacterium tuberculosis to DC-SIGN leads to activation of
the serine/threonine kinase Raf-1 [9]. To further identify the
mechanism by which Salp15 inhibits DC cytokine production,
we also assessed the ability of Salp15 to activate Raf-1. Similar
to the mycobacterial component ManLAM, Salp15 activates
Raf-1 by inducing phosphorylation of Raf-1 at the residues
S338 and Y340/341, which is partially blocked by antibodies
against DC-SIGN (Figure 3), supporting an important role for
DC-SIGN in Raf-1 activation. Furthermore, silencing of Raf-1
in human primary DCs by RNA interference completely
restored IL-12p35, IL-6, and TNF-a transcription (Figure 3)
and protein expression (unpublished data) after activation by
LPS in the presence of Salp15. In addition, cytokine levels
could be completely restored by blocking Raf-1 activation
during stimulation of DCs with Salp15 and LPS using a Raf
inhibitor (Figure 3). Thus, DC-SIGN-induced Raf-1 activation
Figure 5. Salp15 Inhibits DC-Induced T Cell Proliferation
(A and B) Salp15 impairs DCs in the induction of T cell proliferation as
shown by a mixed lymphocyte reaction (MLR). After 18 h of stimulation
with LPS in the presence of Salp15 (25 lg/ml), tick saliva (1:100), or
controls, DCs were extensively washed and cultured with allogeneic PBLs
(1 3 105) at different ratios (1:50 to 1:500) for 4 d. Lymphocyte
proliferation was assessed by overnight incorporation of radioactive
thymidine. Data are representative of results obtained from four donors.
Bars represent the mean of triplicates within one experiment 6 SE.
Differences between the different conditions were analyzed by a twosided one way ANOVA, implementing a one way analysis of variance with
Dunnett multiple comparison test. A p-value , 0.05 was considered
statistically significant and indicated with one asterisk (*).
doi:10.1371/journal.ppat.0040031.g005
The fact that the addition of rabbit polyclonal anti-Salp15antibodies abrogates the capacity of Ixodes saliva to inhibit IL12, but not IL-6 and TNF-a, might indicate that saliva
contains other molecules, such as PGE2, that are able to block
IL-6 and TNF-a (unpublished data). However, silencing of
Raf-1, and inhibitors of Raf and MEK restored Salp15induced suppression of IL-12p35, IL-6, and TNF-a, suggesting
that the anti-Salp15 antibodies are less effective than small
molecule inhibitors or RNAi treatment. Possibly due to
genetic variability [25], DCs derived from approximately half
the donors failed to produce IL-10 upon stimulation with
LPS. Moreover, the IL-10 production might be dependent on
the TLR ligand used to activate DCs, since Salp15 did
enhance IL-10 production by LTA- and B. burgdorferi-treated
DCs (Figures 6 and S1). Neutralization of IL-10 using
antibodies did not restore IL-12 levels, demonstrating that
inhibition of pro-inflammatory cytokines is not due to IL-10
production (unpublished data).
B. burgdorferi by itself does not modulate DC function, since
human DCs have been shown to react adequately to B.
burgdorferi [17]. However, similar to the observed effects of
Salp15 on LPS-stimulated DCs, preincubation of B. burgdorferi
with Salp15 resulted in inhibited pro-inflammatory cytokine
PLoS Pathogens | www.plospathogens.org
0009
February 2008 | Volume 4 | Issue 2 | e31
Salp15 Suppresses Human DC Function
Figure 6. Salp15 Does Not Affect DC Maturation, but Dose-Dependently Inhibits IL-12p70, IL-6, and TNF-a Production by DCs Stimulated with Viable
Borrelia burgdorferi
(A) Salp15 does not interfere with viable B. burgdorferi-induced maturation of DCs. Immature DCs were either not stimulated (dotted line), or stimulated
with 1 3 10 5 or 1 310 6 of viable B. burgdorferi in the absence (solid line) or presence (bold line) of Salp15. The grey-filled graphs represent isotype
controls. B. burgdorferi was preincubated with Salp15 for 30 min before addition of DCs. 18 h post-stimulation DCs were analysed by FACS for surface
expression of CD80 and CD86.
(B) Salp15 inhibits viable B. burgdorferi-induced pro-inflammatory cytokine production by DCs. The experiment was performed as in (A). However, for
this assay supernatant was analyzed for cytokine production by CBA.
The experiments were performed with DCs from four independent donors. Bars represent the mean of triplicates within one experiment 6 SE.
Differences in cytokine production between DCs stimulated with B. burgdorferi and DCs stimulated with B. burgdorferi and Salp15 were analyzed by a
PLoS Pathogens | www.plospathogens.org
0010
February 2008 | Volume 4 | Issue 2 | e31
Salp15 Suppresses Human DC Function
two-sided one way ANOVA, implementing a one way analysis of variance with Dunnett multiple comparison test. A p-value , 0.05 was considered
statistically significant, indicated as one asterisk (*) 0.01 , p , 0.05 or two asterisks (**) 0.001 , p , 0.01.
doi:10.1371/journal.ppat.0040031.g006
nosuppression will have to elucidate how MEK and downstream effectors affect mRNA stability and nucleosome
remodeling to inhibit pro-inflammatory cytokine expression.
This might be due to post-translational modifications of the
proteins involved in nucleosome remodeling and mRNA
decay [34,35]. Further characterization of the Salp15/DCSIGN-induced signaling pathway could lead to the identification of new anti-inflammatory or immunosuppressive agents.
TLR-mediated immune responses play an important role in a
variety of diseases including infectious diseases, autoimmune
diseases, and atherosclerosis. Therefore manipulation of TLRtriggered signaling is of wide clinical interest and the Salp15/
DC-SIGN-induced signaling pathway described in the current
study might prove to be important in the development of
novel immunotherapies [36]. In addition, interfering with
Salp15-induced signaling could potentially enhance antiBorrelia immune responses and might be an alternative novel
intervention strategy to prevent or potentially even treat
Lyme borreliosis. Furthermore, efforts are being made to
target biologically important vector proteins to prevent
pathogen transmission from the tick to the host [37,38].
In summary, the salivary gland protein Salp15 is a tick
protein exerting various activities at the tick-host-pathogen
interface. We here report that Salp15 modulates TLRinduced DC pro-inflammatory cytokine production and
renders DCs less capable of activating T lymphocytes. Salp15
binds to the surface of immature DCs through the C-type
lectin receptor DC-SIGN, which results in the phosphorylation of the serine/threonine kinase Raf-1 and subsequent
MEK activation. Silencing or inhibition of Raf-1 as well as
inhibition of MEK abrogates the effects of Salp15. Both
mRNA destabilization and impairment of nucleosome
remodeling are responsible for the decreased pro-inflammatory cytokine production observed after DC-SIGN/Salp15
ligation. Immunosuppression of the host by Salp15 could be
advantageous for both the arthropod vector as well as the
spirochete, since it could impair adaptive immune responses
against tick and/or B. burgdorferi antigens.
is essential to the observed immunosuppression by Salp15.
Recently, we have demonstrated that Raf-1 activation by the
mycobacterial component ManLAM leads to acetylation of
the NF-jB subunit p65, but only after TLR-induced activation
of NF-jB. Acetylation of p65 both prolonged and increased
IL-10 transcription to enhance anti-inflammatory cytokine
responses [9]. Strikingly, our data demonstrate that acetylation of the NF-jB subunit p65 is not involved in the
suppression of pro-inflammatory cytokines by Salp15, since
an inhibitor of the HATs p300/CBP, responsible for p65
acetylation, did not abrogate pro-inflammatory cytokine
suppression by Salp15 (Figure 3). Moreover, we did not see
any effect on IL-8 and L-10 cytokine levels (Figure S2C).
These data indicate that Raf-1 activation by Salp15 leads to
activation of different downstream effectors than ManLAM
[9]. Indeed, Salp15-induced inhibition of cytokine production
is completely blocked by the MEK1/2 inhibitor U0126,
demonstrating that MEK kinases are essential downstream
effectors of Raf-1 after DC-SIGN/Salp15 ligation, in sharp
contrast to DC-SIGN/ManLAM ligation [9]. Raf kinases are
known to activate MEK1 and MEK2 through phosphorylation
of two serine residues [29]. MEK kinases are well-known to
signal through ERK kinases and there is evidence that
suggests that antibody ligation of DC-SIGN leads to ERK
activation [30]. However, DC-SIGN ligation by its pathogenderived ligands such as ManLAM and Salp15 does not result
in ERK activation (Figure 3 and [9]), demonstrating that ERK
is not involved in pathogen-induced DC-SIGN signaling. The
mechanism of MEK-dependent and ERK-independent signaling induced by Salp15 binding to DC-SIGN might be
dependent on the subcellular localization of the kinases
[31–33]. Salp15 might interact with low avidity to other
receptors on DCs such as CD4, which could result in an
altered signaling cascade. A recent study has demonstrated
that Salp15 binding to CD4 modulates actin polymerization
[6]. This observation implies that co-ligation of DC-SIGN and
CD4 by Salp15 might affect the subcellular localization of
Raf-1 or its downstream effectors. This would result in the
activation of different kinases compared to DC-SIGN ligands
that do not affect actin polymerization, such as ManLAM.
Thus, although Salp15 binding to DC-SIGN does induce Raf-1
similar to ManLAM, the downstream effectors are different.
Indeed, Salp15 affects pro-inflammatory cytokine production
by human DCs both at the transcriptional and the posttranscriptional level. We demonstrate that Salp15 increases
IL-6 and TNF-a mRNA decay, and impairs nucleosome
remodeling at the IL-12p35 promoter. This is in contrast to
pathogens such as mycobacteria and HIV-1 that interact with
DC-SIGN to increase the transcription rate and prolong
transcription activity through acetylation of p65 [9]. These
data further demonstrate that pathogen binding to DC-SIGN
might lead to different ligand-specific signaling cascades that
regulate distinct adaptive immune responses. Although our
data suggest that Raf-1 activation might play a central role in
these immune responses, the downstream effectors of Raf-1
regulate the subsequent cytokine responses. Future research
on the molecular mechanism of Salp15-induced DC immuPLoS Pathogens | www.plospathogens.org
Materials and Methods
Salp15 purification and tick saliva collection. Salp15 (GenBank
accession number: AAK97817) was isolated from cultured Drosophila
S2 cells as described previously [4]. Briefly, Drosophila S2 cells
(Invitrogen), co-transfected with the recombinant pMT/BiP/V5-His
A-salp15 vector (Invitrogen) and the hygromycin selection vector,
pCOHYGRO, were grown as large cultures in DES serum-free
medium and induced with copper sulphate. The supernatant was
used to purify recombinant Salp15 containing the V5 epitope and
HIS-tag the using 5-ml pre-packed nickel charged HisTrap FF
columns (GE Healthcare). The protein was eluted using 100 mM
imidazole, extensively dialyzed against PBS (pH 7.4), and concentrated by centrifugal filtration through a 5-kDa filter (Vivascience).
Tick saliva was collected from fed ticks as described previously [4].
Briefly, adult ticks were allowed to feed on rabbits, removed ticks
were immobilized, and a capillary tube was fitted over the mouthparts. 2 ll of 5% pilocarpine (Sigma-Aldrich) in methanol was
applied topically to the dorsa, and saliva was collected and stored at
80 8C until use.
Borrelia burgdorferi cultures. B. burgdorferi sensu stricto strain B31
clone 5A11 [39], referred to as B. burgdorferi throughout the paper, was
cultured in Barbour-Stoenner-Kelly (BSK)-H medium (Sigma-Aldrich). Spirochetes were grown to approximately 5 310 7/ml
0011
February 2008 | Volume 4 | Issue 2 | e31
Salp15 Suppresses Human DC Function
h at RT. Specificity was determined (unless indicated otherwise) by
blocking with mannan (1 mg/ml). Unbound DC-SIGN-Fc was washed
away and binding was determined using a peroxidase-conjugated
goat anti-human Fc antibody (Jackson Immunoresearch). Peroxidaselabeled strepavidin was used to detect DC-SIGN-Fc binding.
Absorbance was read at 450 nm. To assess whether carbohydrate
structures on Salp15 were involved in binding to DC-SIGN 10 lg of
Salp15 deglycosylated using 1,000 units of PGNaseF under nondenaturing conditions according to the manufacturer’s instructions
(New England Biolabs), was coated.
Immunoprecipitation and immunoblot analysis. The surface of
DCs was biotinylated for 30 min at 4 8C with 0.5 mg/ml of sulfo-NHSbiotin (Pierce) in PBS (pH 7,4) and cells were then lysed for 1 h at 4 8C
in lysis buffer (10 mM tri-ethanolamine [pH 8.2], 150 mM NaCl, 1 mM
MgCl2, 1 mM CaCl2, and 1% [volume/volume] Triton X-100,
containing EDTA-free protease inhibitors) (Roche Diagnotics).
Salp15 ligands were immunoprecipitated with Salp15- (via anti-V5)
coupled protein A–Sepharose beads (CL-4B; Pharmacia). As a
positive and negative control, we used anti-DC-SIGN (AZN-D2) [27],
and anti-V5-coupled protein A–Sepharose beads respectively. Immunoprecipitation products were separated by SDS-PAGE and
transferred to nitrocellulose membranes. A Page Ruler Protein
ladder (Fermentas) was run adjacently. Blots were blocked with 5%
BSA in PBS followed by immunoblot analysis with streptavidincoupled peroxidase (Vector Laboratories). To immunoprecipitate
Salp15 ligands from non-biotinylated DC lysate we performed a
similar assay. However, the blot was stained with specific goat
antibodies against DC-SIGN (Santa Cruz Biotechnology), followed by
secondary peroxidase-conjugated swine anti-goat (Tago). Blots were
developed by enhanced chemiluminescence.
Phosphorylation of Raf-1 and ERK, and inhibition of Raf-1, MEK,
and p300/CBP-mediated acetylation of the NF-jB subunit p65. DCs
were stimulated for 15 min with Salp15 (25 lg /ml) or controls. When
indicated, cells were stimulated with LPS (10 ng/ml) or PMA (150 ng/
ml) plus ionomycin (5 lg /ml) (positive control for ERK phosphorylation, Sigma-Aldrich) for 15 min, or pre-incubated with blocking
anti-DC-SIGN antibodies (AZN-D2) [27] for 30 min. Subsequently,
cells were fixed in 3% para-formaldehyde for 10 min and
permeabilized in 90% methanol at 4 8C for 10 (Raf-1) or 30 (ERK)
min. To assess phosphorylation of Raf-1 we used a rabbit antiphospho-c-Raf (Ser338) mAb (Cell Signaling) and a rabbit anti-c-Raf
(pTyr340, Tyr341) pAb (Calbiochem) and to assess phosphorylation of
ERK a rabbit-anti-phospho-p44/42 MAPK (Thr202/Tyr204) mAb (Cell
Signaling). Phosphorylation of Raf-1 and ERK was measured by flow
cytometry after incubation with PE-conjugated donkey anti-rabbit
antibodies as described [9]. When indicated, DCs were pre-incubated
for 2 h with 1 lM GW5074 (Calbiochem), a Raf inhibitor, 4 lM U0126
(LC Laboratories), an inhibitor of MEK1 and MEK2, or 30 lM
anacardic acid (AA) (Calbiochem), an inhibitor of the histone
acetyltransferases p300 and CBP, respectively. Thereafter, cells were
stimulated for 6 h with LPS as previously described, and mRNA was
isolated for the generation of cDNA and real time PCR analysis.
RNA interference. DCs were transfected with 100 nM siRNA using
transfection reagens DF4 (Dharmacon), according to the manufacturer’s protocol. The siRNAs used were: Raf-1 SMARTpool (M003601–00) and non-targeting siRNA pool (D-001206–13) as a control
(Dharmacon). This protocol resulted in a nearly 100% transfection
efficiency as determined by flow cytometry of cells transfected with
siGLO-RISC free-siRNA (D-001600–01). At 72 h after transfection,
cells were used for experiments as described above. Silencing of Raf-1
transcription was confirmed by quantitative real-time PCR.
Chromatin accessibility measured by real-time PCR (ChART)
assay. To quantify nucleosome remodeling at the IL-12p35 promoter, chromatin accessibility was measured by a real-time PCR
(ChART) assay. Nuclei were prepared from unstimulated cells, or
cells stimulated as indicated, with lysis buffer (10 mM Tris-HCl [pH
7.5], 15 mM NaCl, 3 mM MgCl2, 0.5 mM spermidine, 1 mM PMSF,
0.5% Nonidet P-40). Digestion reactions were performed with 50 U
BstIXI or 50 U EcoRI for 1 h at 37 8C. After proteinase K and RNase
A treatment, DNA was purified using the QIAamp DNA blood kit
(Qiagen). Real-time PCR reactions were then performed as
described above. Amplification with primer set A (encompassing
BstXI site located at nucleotide 298) is sensitive to remodeling of
nuc-2 [16]. Increased accessibility of the region results in reduced
amplification in the real-time PCR. Amplification with primer set B
(encompassing BstXI site located at nt 456) was performed as an
internal control to test for the efficiency of BstXI digestion as the
accessibility of this locus is not subject to changes in the chromatin
structure [16]. To normalize for DNA input amounts, each sample
was analyzed with primer set C for GAPDH. Results are expressed as
(enumerated using a Petroff-Hausser counting chamber as described
previously [40]), pelleted by centrifugation at 2,000 x g for 10 min,
and resuspended in RPMI medium without antibiotics.
Cell culture and dendritic cell stimulation. Immature DCs were
cultured as described before [41]. Immature DCs were used for
experiments at day 6. A total of 100,000 DCs were stimulated with
Salp15 (10–50 lg/ml) or tick saliva (diluted 1:75–1:300) in the presence
or absence of Samonella typhosa LPS (10 ng/ml, Sigma-Aldrich) or LTA
(10 lg/ml). For isolation of mRNA, cells were lysed after 6 h of
incubation. To determine cytokine production and expression of cell
surface markers, cells were incubated for 18 h. Supernatants were
harvested to determine cytokine production, whereas the cells were
analysed by flow cytometry analysis (FACS) for surface expression of
CD80, CD86, or CD83. Cells were incubated at 4 8C for 30 min with
PE-labeled antibodies (CD80-PE, CD86-PE, (Pharmingen); and CD83PE (Immunotech). In addition, a staining with 7-amino-actinomycin
D (7-AAD, Molecular Probes) was performed. Spirochetes (1 3 105 or
1 3 106) were pre-incubated with Salp15 (25 lg/ml final concentration) for 30 min before addition to 100,000 DCs. After 18 h of
incubation supernatant was harvested, and cells were fixed in 2%
PFA before performing FACS analysis. For binding experiments, we
used Raji cells and Raji transfectants expressing wild-type DC-SIGN
(Raji-DC-SIGN). Raji-DC-SIGN was generated as previously described
[27,42]. All cells used in these studies were cultured in RPMI
containing 10% fetal calf serum.
T lymphocyte proliferation (mixed lymphocyte reaction). After 18
h of stimulation, DCs were washed extensively with medium. Next,
DCs were cultured with allogenic PBLs (1 3 105) at different ratios
(1:50–1:500) for 4 d at 37 8C. T lymphocyte proliferation was assessed
by measuring the overnight incorporation of [methyl-3H] Thymidine
(Amersham Biosciences).
Cytokine measurements. For detection of cytokines, supernatants
were harvested 18 h after DC activation and stored at 20 8C until
further analysis. TNF-a, IL-10, IL-6, IL-12 p70, IL-8, and IL-1 b were
measured using cytometric bead array kits (BD Biosciences) according to the manufacturer’s recommendations.
RNA extraction, mRNA half-life determination, and quantitative
real-time PCR. mRNA was specifically isolated with the mRNA
capture kit (Roche) and cDNA was synthesized with the reverse
transcriptase kit (Promega). For real-time PCR analysis, PCR
amplification was performed in the presence of SYBR green, as
previously described [43]. Specific primers for IL-12p35, IL-6, TNF-a,
IL-8, IL-10, and GAPDH were designed by Primer Express 2.0
(Applied Biosystems) [9]. IL-12p35, IL6, TNFa, IL-8, and IL-10
transcription was adjusted for GAPDH transcription. For the
determination of mRNA half-life, DCs were stimulated with LPS for
6 h prior to the addition of 10 lg/ml actinomycin D (Sigma-Aldrich)
to block transcription; mRNA was then isolated at 20-min time
periods. We calculated the half-life of the different mRNA transcripts
by applying non-linear fitting according to the one phase exponential
decay model (Graphpad Prism Software version 4.0).
Fluorescent bead adhesion assays. Fluorescent bead adhesion
assays were performed as described previously [27]. Briefly, streptavidin-coated TransFluorSpheres (488/645 nm, 1.0 lm; Molecular
Probes) beads were incubated with biotinylated goat anti-mouse
F(ab)2 fragments (6 lg/ml; Jackson Immunoresearch), followed by
overnight incubation with mouse anti-V5 (Invitrogen) (3 lg), and
overnight incubation with Salp15 (5 lg), or PBS with 1% BSA for the
generation of Salp15-, or negative-control beads, respectively. As a
positive control fluorescent beads coated with the HIV protein gp120
were used [27]. 50,000 cells were incubated with beads for 45 min at
37 8C. When indicated cells were pre-treated with mannan (1 mg/ml),
EDTA (10mM), free sugars N-acetylgalactosamine (GalNac), GlcNac,
galactose, fucose; all 50 mM) or biotinylated LeX/LeY- (20 lg /ml) for
15 min at 37 8C. Bead adhesion to the cells was measured by FACS
analysis.
Plant lectin ELISA. Salp15 (5 lg/ml) was coated onto maxisorb
ELISA plates (NUNC) for 18 h at room temperature (RT). The plate
was blocked by incubating with 1% BSA for 1 h at 37 8C. Biotinylated
lectins Con A, GNA (Galanthus nivalis agglutinin), NPA (Narcissus
pseudonarcissus agglutin), PSA (Pisum sativum agglutin), LTA (Lotus
tetragonolobus agglutin), UEA (Ulex europaeus agglutin), or PNA (SigmaAldrich) were added for 2 h at a concentration of 5 lg/ml. Binding of
biotinylated lectins was detected using peroxidase-labeled strepavidin and absorbance was read at 450 nm.
DC-SIGN-Fc binding ELISA. The soluble DC-SIGN-Fc binding
ELISA was performed as previously described [44]. Briefly, 5 lg/ml
Salp15 or mannan was coated onto maxisorb ELISA plates (NUNC)
for 18 h at RT. Unspecific binding was blocked by incubating the
plate with 1% BSA for 1 h at RT. Soluble DC-SIGN-Fc was added for 1
PLoS Pathogens | www.plospathogens.org
0012
February 2008 | Volume 4 | Issue 2 | e31
Salp15 Suppresses Human DC Function
a percentage of the remodeling observed in the EcoRI-digested
sample for each cell treatment using the formula (NtEcoRI – NtBstXI/
NtEcoRI) 3 100%, with Nt ¼ 2Ct(primer set C)-Ct(primer set A). The following
primer sequences were used: set A (IL-12p35 promoter): forward 59
GCGGGGTAGCTTAGACACG 39, reverse 59 CCCAAAATGAAAGCGAAATG 39; set B (BstXI control): forward 59 TCTAAAGTCAGGCTTGGCCG 39, reverse 59 GGTTTCACCATGTTGGTCAGG
39; set C (GAPDH promoter): forward 59 TACTAGCGGTTTTACGGGCG 39, reverse 59 TCGAACAGGAGGAGCAGAGAGCGA 39.
Statistical analysis. Statistical analysis was performed using parametric tests (Graphpad Prism Software version). When multiple
conditions were compared a Dunnett multiple comparisons test was
performed. Statistical significance of the data was set at p , 0.05, with
one asterisk (*) representing 0.01 , p , 0.05; two asterisks (**) 0.001
, p , 0.01.
for 2 h before stimulation with LPS for 6 h (mRNA) or 18 h (protein)
in the presence or absence of 25 lg/ml Salp15. Relative mRNA
expression of LPS-stimulated cells was set at 1. For protein levels, LPS
was set at 100%, which is representative of 2,407 6 355 pg/ml IL-8
and 6,194 6 1,934 pg/ml IL-10.
(C) MEK1/2-inhibitor U0126 abrogates the Salp15-induced effects on
cytokine production. DCs were pre-incubated for 2 h with anacardic
acid (AA), an inhibitor of the histone acetyltransferases p300 and CBP,
or U0126, an inhibitor of MEK1 and MEK2, or DMSO as a control.
Relative mRNA expression of LPS-stimulated cells was set at 1.
For a more detailed description of the experiments see legend Figure 3.
Found at doi:10.1371/journal.ppat.0040031.sg002 (1.1 MB TIF).
Figure S3. Salp15 Does Not Destabilize IL-8 and IL-10 mRNA
DCs were stimulated with Salp15 and LPS for 6 h. Actinomycin D was
added to block new mRNA synthesis. Cells were harvested for 2 h to
determine mRNA half-life. For a more detailed description of the
experiment see legend Figure 4.
Supporting Information
Figure S1. Salp15 Inhibits IL-12, IL-6, and TNF-a Production by DCs
Stimulated with LTA
Immature human DCs were stimulated with control medium (grey
bars), or with 10 lg/ml LTA in the presence (black bars) or absence
(white bars) of 25 lg/ml Salp15. Supernatants were analyzed for
cytokine production after 18 h of stimulation. Bars represent
duplicates or triplicates from within one experiment 6 SE. The
graphs are representative of two independent experiments with two
independent donors. For a more detailed description of the experiment see legend Figure 1.
Found at doi:10.1371/journal.ppat.0040031.sg001 (846 KB TIF).
Found at doi:10.1371/journal.ppat.0040031.sg003 (902 KB TIF).
Acknowledgments
Figure S2. The Salp15 Effect on DC Cytokine Production Is Raf-1Dependent
(A) RNAi-mediated silencing of Raf-1 abrogates the effect of Salp15
on DC cytokine production. siRNA-treated cells were stimulated for 6
h with LPS in the presence or absence of 25 lg/ml Salp15. Relative
mRNA expression of LPS-stimulated non-targeting siRNA-treated
cells was set at 1.
(B) Raf-1 inhibition by GW5704 abrogates the Salp15-induced effects
on DC cytokine production. DCs were incubated with 1 lM GW5704
Author contributions. JWRH and MAWPJ conceived and designed
the experiments, performed the experiments, analyzed the data, and
wrote the paper. JD and ML performed experiments. EF and TVP
contributed reagents/materials/analysis tools. SIG and TBHG conceived and designed the experiments, analyzed data, contributed
reagents/materials/analysis tools, and wrote the paper.
Funding. JWRH is supported by ZonMw, the Netherlands
organisation for health research and development; MAWPJ, JD, and
ML are supported by the Dutch Scientific Research program (MAWPJ
and ML, VIDI NWO 917-46-367; JD, NWO 912-04-025); SIG is
supported by the Dutch Asthma Foundation (3.2.03.39); and EF is a
recipient of the Burroughs Wellcome Clinical Scientist Award in
Translational Research.
Competing interests. The authors have declared that no competing
interests exist.
References
1. Burgdorfer W, Barbour AG, Hayes SF, Benach JL, Grunwaldt E, et al. (1982)
Lyme disease: a tick-borne spirochetosis? Science 216: 1317–1319.
2. Binnington KC, Kemp DH (1980) Role of tick salivary glands in feeding and
disease transmission. Adv Parasitol 18: 315–339.
3. Das S, Banerjee G, DePonte K, Marcantonio N, Kantor FS, et al. (2001)
Salp25D, an Ixodes scapularis antioxidant, is 1 of 14 immunodominant
antigens in engorged tick salivary glands. J Infect Dis 184: 1056–1064.
4. Anguita J, Ramamoorthi N, Hovius JW, Das S, Thomas V, et al. (2002)
Salp15, an ixodes scapularis salivary protein, inhibits CD4(þ) T cell
activation. Immunity 16: 849–859.
5. Garg R, Juncadella IJ, Ramamoorthi N, Ashish, Ananthanarayanan SK, et al.
(2006) Cutting edge: CD4 is the receptor for the tick saliva immunosuppressor, Salp15. J Immunol 177: 6579–6583.
6. Juncadella IJ, Garg R, Ananthnarayanan SK, Yengo CM, Anguita J (2007) T
cell signaling pathways inhibited by the tick saliva immunosuppressor,
Salp15. FEMS Immunol Med Microbiol 49: 433–438.
7. Ramamoorthi N, Narasimhan S, Pal U, Bao F, Yang XF, et al. (2005) The
Lyme disease agent exploits a tick protein to infect the mammalian host.
Nature 436: 573–577.
8. Banchereau J, Steinman RM (1998) Dendritic cells and the control of
immunity. Nature 392: 245–252.
9. Gringhuis SI, den Dunnen J, Litjens M, van Het HB, van Kooyk Y, et al.
(2007) C-type lectin DC-SIGN modulates Toll-like receptor signaling via
Raf-1 kinase-dependent acetylation of transcription factor NF-kappaB.
Immunity 26: 605–616.
10. Wellbrock C, Karasarides M, Marais R (2004) The RAF proteins take centre
stage. Nat Rev Mol Cell Biol 5: 875–885.
11. Payne DM, Rossomando AJ, Martino P, Erickson AK, Her JH, et al. (1991)
Identification of the regulatory phosphorylation sites in pp42/mitogenactivated protein kinase (MAP kinase). EMBO J 10: 885–892.
12. Garneau NL, Wilusz J, Wilusz CJ (2007) The highways and byways of mRNA
decay. Nat Rev Mol Cell Biol 8: 113–126.
13. Keene JD (2007) RNA regulons: coordination of post-transcriptional
events. Nat Rev Genet 8: 533–543.
14. Dumitru CD, Ceci JD, Tsatsanis C, Kontoyiannis D, Stamatakis K, et al.
(2000) TNF-alpha induction by LPS is regulated posttranscriptionally via a
Tpl2/ERK-dependent pathway. Cell 103: 1071–1083.
15. Goriely S, Demonte D, Nizet S, De Wit D, Willems F, et al. (2003) Human IL-
12(p35) gene activation involves selective remodeling of a single nucleosome within a region of the promoter containing critical Sp1-binding sites.
Blood 101: 4894–4902.
Goriely S, Van Lint C, Dadkhah R, Libin M, De Wit D, et al. (2004) A defect
in nucleosome remodeling prevents IL-12(p35) gene transcription in
neonatal dendritic cells. J Exp Med 199: 1011–1016.
Suhonen J, Komi J, Soukka J, Lassila O, Viljanen MK (2003) Interaction
between Borrelia burgdorferi and immature human dendritic cells. Scand J
Immunol 58: 67–75.
Nazario S, Das S, de Silva AM, DePonte K, Marcantonio N, et al. (1998)
Prevention of Borrelia burgdorferi transmission in guinea pigs by tick
immunity. Am J Trop Med Hyg 58: 780–785.
Wikel SK, Allen JR (1976) Acquired resistance to ticks. I. Passive transfer of
resistance. Immunology 30: 311–316.
Wikel SK (1999) Tick modulation of host immunity: an important factor in
pathogen transmission. Int J Parasitol 29: 851–859.
Hovius JW, Ramamoorthi N, Veer CV, De Groot KA, Nijhof AM, et al.
(2007) Identification of Salp15 homologues in Ixodes ricinus ticks. Vector
Borne Zoonotic Dis 7: 296–303.
van Kooyk Y, Geijtenbeek TB (2003) DC-SIGN: escape mechanism for
pathogens. Nat Rev Immunol 3: 697–709.
Cavassani KA, Aliberti JC, Dias AR, Silva JS, Ferreira BR (2005) Tick saliva
inhibits differentiation, maturation, and function of murine bonemarrow–derived dendritic cells. Immunology 114: 235–245.
Sa-Nunes A, Bafica A, Lucas DA, Conrads TP, Veenstra TD, et al. (2007)
Prostaglandin E2 is a major inhibitor of dendritic cell maturation and
function in Ixodes scapularis saliva. J Immunol 179: 1497–1505.
Hajeer AH, Lazarus M, Turner D, Mageed RA, Vencovsky J, et al. (1998) IL10 gene promoter polymorphisms in rheumatoid arthritis. Scand J
Rheumatol 27: 142–145.
Trinchieri G (2003) Interleukin-12 and the regulation of innate resistance
and adaptive immunity. Nat Rev Immunol 3: 133–146.
Geijtenbeek TB, Kwon DS, Torensma R, Van Vliet SJ, van Duijnhoven GC,
et al. (2000) DC-SIGN, a dendritic cell-specific HIV-1-binding protein that
enhances trans-infection of T cells. Cell 100: 587–597.
Geijtenbeek TB, Van Vliet SJ, Koppel EA, Sanchez-Hernandez M,
Vandenbroucke-Grauls CM, et al. (2003) Mycobacteria target DC-SIGN to
suppress dendritic cell function. J Exp Med 197: 7–17.
Alessi DR, Saito Y, Campbell DG, Cohen P, Sithanandam G, et al. (1994)
PLoS Pathogens | www.plospathogens.org
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
0013
February 2008 | Volume 4 | Issue 2 | e31
Salp15 Suppresses Human DC Function
30.
31.
32.
33.
34.
35.
36.
37.
Identification of the sites in MAP kinase kinase-1 phosphorylated by
p74raf-1. EMBO J 13: 1610–1619.
Caparros E, Munoz P, Sierra-Filardi E, Serrano-Gomez D, Puig-Kroger A, et
al. (2006) DC-SIGN ligation on dendritic cells results in ERK and PI3K
activation and modulates cytokine production. Blood 107: 3950–3958.
Holt KH, Kasson BG, Pessin JE (1996) Insulin stimulation of a MEKdependent but ERK-independent SOS protein kinase. Mol Cell Biol 16:
577–583.
Raman M, Chen W, Cobb MH (2007) Differential regulation and properties
of MAPKs. Oncogene 26: 3100–3112.
Taha C, Tsakiridis T, McCall A, Klip A (1997) Glucose transporter
expression in L6 muscle cells: regulation through insulin- and stressactivated pathways. Am J Physiol 273: E68–E76.
Bhaumik SR, Smith E, Shilatifard A (2007) Covalent modifications of
histones during development and disease pathogenesis. Nat Struct Mol Biol
14: 1008–1016.
Cairns BR (2007) Chromatin remodeling: insights and intrigue from singlemolecule studies. Nat Struct Mol Biol 14: 989–996.
Ishii KJ, Uematsu S, Akira S (2006) ‘‘Toll’’ gates for future immunotherapy.
Curr Pharm Des 12: 4135–4142.
Hovius JW, van Dam AP, Fikrig E (2007) Tick-host-pathogen interactions in
Lyme borreliosis. Trends Parasitol 23: 434–438.
PLoS Pathogens | www.plospathogens.org
38. Labuda M, Trimnell AR, Lickova M, Kazimirova M, Davies GM, et al. (2006)
An antivector vaccine protects against a lethal vector-borne pathogen.
PLoS Pathog 2: e27. doi:10.1371/journal.ppat.0020027
39. Purser JE, Norris SJ (2000) Correlation between plasmid content and
infectivity in Borrelia burgdorferi. Proc Natl Acad Sci U S A 97: 13865–
13870.
40. Barthold SW (1999) Specificity of infection-induced immunity among
Borrelia burgdorferi sensu lato species. Infect Immun 67: 36–42.
41. Romani N, Gruner S, Brang D, Kampgen E, Lenz A, et al. (1994)
Proliferating dendritic cell progenitors in human blood. J Exp Med 180:
83–93.
42. Geijtenbeek TB, Torensma R, Van Vliet SJ, van Duijnhoven GC, Adema GJ,
et al. (2000) Identification of DC-SIGN, a novel dendritic cell-specific
ICAM-3 receptor that supports primary immune responses. Cell 100: 575–
585.
43. Garcia-Vallejo JJ, Van Het HB, Robben J, Van Wijk JA, Van Die I, et al.
(2004) Approach for defining endogenous reference genes in gene
expression experiments. Anal Biochem 329: 293–299.
44. Geijtenbeek TB, van Duijnhoven GC, Van Vliet SJ, Krieger E, Vriend G, et
al. (2002) Identification of different binding sites in the dendritic cellspecific receptor DC-SIGN for intercellular adhesion molecule 3 and HIV1. J Biol Chem 277: 11314–11320.
0014
February 2008 | Volume 4 | Issue 2 | e31