Download Cloning the catA gene of Acinetobacter sp. Strain ADP1to observe

http://jb.asm.org/cgi/reprint/168/2/815
https://mailattachment.googleusercontent.com/attachm
ent?ui=2&ik=9b75ce087f&view=att&th=13227bdb98e45
8e3&attid=0.1&disp=inline&realattid=f_gs2du9gm0&saf
e=1&zw&saduie=AG9B_P_leWPrVdLhYdbZWPY_RFO&sadet=1315782153334&sads=TsSAn
LWFQ0h9ZbkdSe0GS6GHLr0
Soil organism.
o Gram negative bacteria.
o Helps in mineralization of aromatic
compounds, biodegradation,
bioremediation, enzyme engineering,
etc.
o Addition of linear DNA to log phase
makes it an ideal model organism for
complex strain construction in genetic
engineering.
o
One of the function of the
Acinetobacter sp. is the degradation of
benzoate.
 Ben genes convert benzoate to
catechol and cat genes are responsible
for the conversion of the catechol to
kreb’s cycle intermediates.

Catalyzes the first step in a catechol
utilization via Beta-ketoadipate
pathway.
 catA gene when induced with isopropyl
thiogalactopyranoside, catechol
dioxygenase was formed in E. coli at
twice the level found in fully induced
cultures of A. calcoaceticus.

DNA from source organism.
 Amplification of desired gene by PCR.
 Insertion of gene in T4 vector.
 Insertion of T4 into Biobrick vectors with
the use of restriction enzymes.
 Transformation in E.coli.
 Study the expression of desired gene.

Forward primer
o 18-GASF
5' atggaagtta aaatattcaa tactcagg 3‘
Reverse primer
o 18-GASR
5’ttacaccgctagacgtgg 3’
5' atggaagttaaaatattcaatactcagg ----->>3‘
5’ atggaagttaaaatattcaatactcaggatgtgcaagattttttacgtgttgcaagcggacttgag
aaaggtggcaa tccgcgtgta aagcagatca tccatcgtgt gctttcagat ttatataaag
ccattgaaga tttgaatatc acttcagatg aatactgggc aggtgtggca tatttaaatc
agctaggtgc caatcaagaa gctggtttac tctcgccagg cttgggtttt gaccattacc
tcgatatgcg tatggatgcc gaagatgccg cactaggtat tgaaaatgcg acaccacgta
ccattgaagg cccgctatac gtggcaggtg cgcctgaatc ggtaggttat gcgcgcatgg
atgacggaag tgatccaaat ggtcataccc tgattctaca tggcacgatc tttgatgcag
atggaaaacc tttacccaat gccaaagttg aaatctggca tgccaatacc aaaggctttt
attcacactt cgacccaaca ggcgagcagc aggcgttcaa tatgcgccgt agtattatta
ccgatgaaaa cggtcagtat cgcgttcgta ccattttgcc tgcgggttat ggttgcccac
cagaaggtcc aacgcaacag ttgctgaatc agttgggccg tcatggtaac
cgccctgcgc acattcacta ttttgtttct gccgatggac accgcaaact aactacgcaa
attaatgtgg ctggcgatcc gtacacctat gacgactttg cttatgcaac ccgtgaaggc
ttggtggttg atgcagtgga acacaccgat cctgaagcca ttaaggccaa tgatgttgaa
ggcccattcg ctgaaatggt tttcgatcta aaattgacgc gtttggttga tggtgtagat
aaccaagttg ttgatcgtccacgtctagcggtgtaa 3‘
3 ‘<<------ggtgtagatcgtcacatt 5’
The desired gene of interest is inserted
into the pGEM vector via pGEM-T vector
system by using a standard protocol.
 Then the catA gene is ligated.
 Now the vector containing the desired
gene is introduced into the BioBrick
vector, with the help of restriction
enzyme EcoRI and SpeI.

BBa_I765007 : Iron and UV promoters.
 Bba_K116401: External phosphate
sensing promoter.
 Bba_K118011: PcstA (Glucoserepressible promoter)

The biobrick vectors are inserted into
E.coli cells and are transformed.
 The transformed cells are checked for
the expression of the desired gene.
