Download High-efficiency Agrobacterium-mediated transformation of chickpea

Plant Cell Rep (2011) 30:1603–1616
DOI 10.1007/s00299-011-1071-5
ORIGINAL PAPER
High-efficiency Agrobacterium-mediated transformation
of chickpea (Cicer arietinum L.) and regeneration
of insect-resistant transgenic plants
Meenakshi Mehrotra • Indraneel Sanyal
D. V. Amla
•
Received: 30 November 2010 / Revised: 7 April 2011 / Accepted: 10 April 2011 / Published online: 23 April 2011
Ó Springer-Verlag 2011
Abstract To develop an efficient genetic transformation
system of chickpea (Cicer arietinum L.), callus derived
from mature embryonic axes of variety P-362 was transformed with Agrobacterium tumefaciens strain LBA4404
harboring p35SGUS-INT plasmid containing the uidA gene
encoding b-glucuronidase (GUS) and the nptII gene for
kanamycin selection. Various factors affecting transformation efficiency were optimized; as Agrobacterium suspension at OD600 0.3 with 48 h of co-cultivation period at
20°C was found optimal for transforming 10-day-old
MEA-derived callus. Inclusion of 200 lM acetosyringone,
sonication for 4 s with vacuum infiltration for 6 min
improved the number of GUS foci per responding explant
from 1.0 to 38.6, as determined by histochemical GUS
assay. For introducing the insect-resistant trait into chickpea, binary vector pRD400-cry1Ac was also transformed
under optimized conditions and 18 T0 transgenic plants
were generated, representing 3.6% transformation frequency. T0 transgenic plants reflected Mendelian inheritance pattern of transgene segregation in T1 progeny. PCR,
RT-PCR, and Southern hybridization analysis of T0 and T1
transgenic plants confirmed stable integration of transgenes
into the chickpea genome. The expression level of Bt-Cry
protein in T0 and T1 transgenic chickpea plants was
achieved maximum up to 116 ng mg-1 of soluble protein,
which efficiently causes 100% mortality to second instar
larvae of Helicoverpa armigera as analyzed by an insect
mortality bioassay. Our results demonstrate an efficient and
Communicated by P. Kumar.
M. Mehrotra (&) I. Sanyal D. V. Amla
Plant Transgenic Lab, National Botanical Research Institute,
Rana Pratap Marg, Lucknow 226001, India
e-mail: [email protected]
rapid transformation system of chickpea for producing nonchimeric transgenic plants with high frequency. These
findings will certainly accelerate the development of
chickpea plants with novel traits.
Keywords Chickpea Somatic embryogenesis Mature
embryonic axes Agrobacterium-mediated transformation Bacillus thuringiensis Insect-resistant transgenic plants
Abbreviations
2,4-D 2,4-Dichlorophenoxyacetic acid
Bt
Bacillus thuringiensis
CIM
Callus induction medium
Cry
Crystal protein
IAA
Indole-3-acetic acid
IBA
Indole-3-butyric acid
MEA Mature embryonic axes
MS
Murashige and Skoog medium
nptII Neomycin phosphotransferase
PGR
Plant growth regulators
uidA
b-Glucouronidase
Introduction
Chickpea is an important grain legume which is grown for
human consumption and provides an important source of
dietary protein, especially for the people in developing
countries. Despite a proposed yield potential of 6 metric
tonnes ha-1, the actual yield has remained low due to large
number of biotic and abiotic stresses which reduces yield
and yield stability. Drought and cold stresses, along with
various diseases like Ascochyta blight, Fusarium wilt, dry
123
1604
root rot and gray mold limit the crop productivity to a vast
extent (Coram et al. 2007). This important crop also suffers
from massive yield losses due to the attack of the lepidopteran pod borer Helicoverpa armigera. To combat yield
losses due to insects, introduction of exotic pest-resistant
genes and development of transgenic chickpea plants
through a reproducible and dependable Agrobacteriummediated transformation system is very important. Development of insect-resistant crops via Agrobacterium-mediated transformation of callus results in consistently high
frequency of non-chimeric transgenic plants as demonstrated for several recalcitrant crops like rice (Datta et al.
1998; Ramesh et al. 2004), cotton (Singh et al. 2004),
soybean (Stewart et al. 1996; Trick and Finer 1998; Dang
and Wei 2007) and Medicago (Araújo et al. 2004). During
transformation, the highly recalcitrant nature of chickpea
appeared as a major limiting factor and the problem
became more acute due to non-availability of sufficient
amount of target tissues, competent enough for efficient
integration of T-DNA from Agrobacterium or foreign DNA
coated on microcarriers (Babaoglu et al. 2000; Somers
et al. 2003).
Somatic embryogenesis has many advantages over the
organogenesis as it permits culture of a large number of
reproductive units with the presence of both root and shoot
meristem in the same element, synchronization of culture
with less variability, easy scale-up transfer with low labor
inputs, success in inducing dormancy and accomplishment
of long-term storage together with achievement of encapsulation of somatic embryos (Nhut et al. 2006). Agrobacterium-mediated transformation of embryogenic callus has
been reported earlier in cotton (Leelavathi et al. 2004; Wu
et al. 2008), rice (Hiei et al. 1994), Agapanthus (Suzuki
et al. 2001), Medicago (Araújo et al. 2004) and soybean
(Droste et al. 2000). Developing an efficient genetic
transformation method for chickpea, through somatic
embryogenesis holds promise to complement conventional
breeding strategies. Complete plantlet regeneration from
chickpea somatic embryos has been reported from immature cotyledonary segments (Sagare et al. 1993), young
leaflets (Barna and Wakhlu 1993; Kumar et al. 1994) and
mature embryonic axes (MEA) (Sagare et al. 1993; Suhasini et al. 1994). Fontana et al. (1993) showed GUS-positive transgenic chickpea plants obtained by de novo
regeneration of adventitious shoots from epicotyl region of
embryonic axes. Agrobacterium-mediated transformation
of chickpea based on multiple shoot formation from
embryo axes explants (Kar et al. 1996; Krishnamurthy
et al. 2000; Tewari-Singh et al. 2004), slices from plumules
of germinated seedling (Senthil et al. 2004) and longitudinal slices of embryonic axes from mature imbibed seeds
(Polowick et al. 2004) have been reported earlier.
123
Plant Cell Rep (2011) 30:1603–1616
In the present report, we have optimized an efficient
Agrobacterium-mediated transformation system for chickpea via somatic embryogenesis, using callus derived from
MEA as an explant. Callus derived from MEA of chickpea
seedlings was used as an explant as callus lends itself easily
to Agrobacterium-mediated transformation. The critical
point in developing an efficient transformation system is to
optimize the right combination of several factors that act
during transformation. Developmental stage and type of
explant, Agrobacterium cell density, acetosyringone concentration, co-cultivation duration and temperature, duration of sonication and vacuum infiltration, kanamycin
sensitivity of explants were the major factors optimized for
efficient transformation. This is the first report of Agrobacterium-mediated transformation of chickpea embryogenic callus, which yield stable transgenic plants via
somatic embryogenesis. Transgenic chickpea plants of
GUS and Bt-cry1Ac genes were raised under optimized
conditions and characterized positively by molecular, GUS
histochemical and insect mortality bioassay. T0 and T1
transgenic chickpea plants expressing cry1Ac gene showed
relatively higher and effective protection against
H. armigera.
Materials and methods
Plant material and culture conditions
Breeder seeds of chickpea desi variety P-362 were obtained
from Indian Agricultural Research Institute, New Delhi.
Seeds were first washed with Tween-20 and surface sterilized by treating with 0.1% (w/v) mercuric chloride for
5 min followed by 70% ethanol for 2 min and then stringently washed with sterile distilled water. MEA were dissected from overnight soaked seeds and their root and
shoot apices were excised aseptically. Excised MEA
explants were initially incubated on callus induction
medium (CIM) comprising of MS basal salts (Murashige
and Skoog 1962), B5 vitamins (Gamborg et al. 1968) and
5 mg l-1 2,4-D for 7 days followed by 10 day incubation
on lower auxin medium comprising of MS basal salts, B5
vitamins and 0.05 mg l-1 2,4-D in dark at 24 ± 2°C.
The pH of all tissue culture media was adjusted to 5.8
prior to addition of agar and autoclaving. PGR and selective agents were filter sterilized. All tissue culture media
were supplemented with 3% (w/v) sucrose and 0.8% (w/v)
agar, unless otherwise stated. All cultures were incubated
in culture room maintained at 24 ± 2°C under cool white
light intensity of 60 lmole m-2 s-1 for 16/8 h light/dark
photoperiod, while rooted chickpea plants in pots were
grown in contained glasshouse under similar conditions.
Plant Cell Rep (2011) 30:1603–1616
All biochemicals and medium constituents of molecular
biology grade were supplied by Sigma Inc., USA.
Agrobacterium strains and vector constructs
Agrobacterium tumefaciens strain LBA4404, harboring
binary vector p35SGUS-INT and pRD400-cry1Ac was
used for plant transformation (Fig. 1). The T-DNA of
p35SGUS-INT contains uidA gene encoding GUS with a
190 bp intron that makes it non-expressible in prokaryotic
cells under the control of the cauliflower mosaic virus
(CaMV) 35S promoter. Binary vector pRD400-cry1Ac
harbored a modified synthetic truncated cry1Ac gene of
1845 bp (Sardana et al. 1996; courtesy provided by Prof.
I. Altosaar, University of Ottawa, Ottawa, Canada) driven
by a CaMV35S duplicated enhancer (DECaMV35S) promoter with AMV 50 UTR. Both vectors contain the neomycin phosphotransferase (nptII) gene as selection marker
driven by nopaline synthase (nos) promoter. Bacterial
cultures were grown at 28°C in YEB medium containing 20 mg l-1 rifampicin, 50 mg l-1 kanamycin and
50 mg l-1 streptomycin antibiotics.
Agrobacterium-mediated transformation and plantlet
regeneration
MEA were dissected and placed on CIM for 7 days followed
by incubation on lower auxin medium for 10 days to generate callus for transformation. These 10-day-old calluses
were subjected to Agrobacterium-mediated transformation
with p35SGUS-INT and pRD400-cry1Ac constructs. Different parameters important for efficient transformation
were systematically optimized. Calluses of different ages
were co-cultivated at different temperatures with different
Agrobacterium cell densities along with supplementation of
acetosyringone, sonication and vacuum treatment. For sonication, a bath-type ultrasonic sonicator (Bransonic-2510,
Branson, USA) at 35 W ultrasound level and for vacuum
infiltration, a desiccator attached to a vacuum pump at 75 in.
Fig. 1 T-DNA constructs of binary vectors used for chickpea
transformation. a p35SGUS-INT containing the uidA gene with a
190 bp intron driven by the CaMV35S promoter. b pRD400-cry1Ac
containing the Bt-cry1Ac gene driven by the DECaMV35S promoter.
1605
of Hg (Barnant Co., USA) were used. Transformed calluses
were initially incubated on MS basal medium and B5 vitamins supplemented with 0.05 mg l-1 2,4-D in dark for 48 h.
Transformed calluses were then placed on histodifferentiation medium (MS basal salts and B5 vitamins,
0.05 mg l-1 2,4-D, 100 mg l-1 casein hydrolysate) containing 250 mg l-1 cefotaxime for 10 days for early globular embryo formation followed by sub-culturing on
proliferation medium (MS basal salts and B5 vitamins)
containing kanamycin for next 10 days for screening and
selection of transformed embryos. Screened transformed
embryos were cultured on embryo conversion medium (MS
basal salts and B5 vitamins, 1.0 mg l-1 BAP, 3.0 mg l-1
GA3, 0.02 mg l-1 IAA, 25 mM Glutamine, 100 mg l-1
casein hydrolysate) containing kanamycin for conversion of
transformed globular embryos. After 10 days converted
embryos were subjected to maturation medium containing
MS basal salt and B5 vitamins, 0.5 mg l-1 BAP, 1.0 mg l-1
GA3, 0.02 mg l-1 IAA. The matured transformed embryos
were placed on germination medium (half-strength MS
basal salts and B5 vitamins, 1.0 mg l-1 GA3, 0.5 mg l-1
IBA) for germination. Rooted plantlets were acclimatized
initially for 1 week in half-strength MS basal liquid medium
and then transferred to sterilized potted soil. During initial
10–15 days of hardening, high humidity was maintained by
covering the plantlets with an acclimatization hood of
plexiglass and irrigated with sterile water. Gradually the
humidity was decreased and plants were transferred to
greenhouse under controlled conditions.
Histochemical GUS assay
An histochemical GUS assay was performed on transformed chickpea callus, kanamycin-resistant somatic
embryos of different developmental stages and regenerated
transgenic plants, according to the procedure described by
Jefferson et al. (1987). GUS foci were monitored, counted
and documented under a stereozoom microscope (Leica
Wild M3Z, Germany).
RB right border, Pnos nopaline synthase promoter, nptII neomycin
phosphotransferase gene, Tnos nopaline synthase terminator, LB left
border. Different PCR primers used in the present study are shown
with arrow marks at their respective binding positions
123
1606
Molecular characterization of transformants
Integration and expression of transgenes in the chickpea
genome were examined by PCR, RT-PCR and Southern
hybridization analyses using standard procedures (Sambrook and Russel 2001). Genomic DNA and total RNA
from leaves of kanamycin-resistant transgenic plants were
isolated using GenElute plant genomic DNA miniprep kit
and Trizol reagent, respectively, according to manufacturer’s instructions (Sigma, USA). PCR analysis of genomic DNA (100 ng) was achieved by amplification of 506,
995 and 678 bp amplicons of uidA, cry1Ac and nptII gene,
respectively (Sanyal et al. 2005). The set of primers for
uidA gene were forward-50 TTTAACTATGCCGGGATC
CATCGC30 and reverse-50 CCACTCGAGCATCTCTT
CAGCGTA30 , for cry1Ac gene were forward-50 ATTCC
TGGTGCAAATTGAGC30 and reverse-50 CGATTCCGCT
CTTTCTGTAA30 , while for nptII gene were forward50 TATTCGGCTATGACTTGGGC30 and reverse-50 GCGA
ACGCTATGTCCTGATA30 , respectively.
RT-PCR analysis was done by cDNA first-strand synthesis with enhanced Avian RT-PCR kit according to
manufacturer’s instructions (Sigma, USA) using 5 lg of
plant total RNA. PCR amplification of cDNA was performed using specific primers of uidA and cry1Ac gene.
Amplified DNA fragments were gel electrophoresed on 1%
agarose gels and then visualized, documented and analyzed
on Gel Doc XR (Bio-Rad, USA).
Southern blot hybridization was performed by overnight
digestion of about 10 lg genomic DNA with EcoRI, as it
cuts once in T-DNA of p35SGUS-INT and pRD400cry1Ac. The digested genomic DNA was separated by gel
electrophoresis and transferred onto BioBond Plus nylon
membrane (Sigma, USA). Blots were hybridized at 58°C
for 16–20 h with aP32 dCTP radiolabeled probes of fulllength uidA and cry1Ac gene fragments. Blots were washed
under stringent conditions and exposed to Fuji screen for
48 h followed by scanning and documentation on Molecular Imager FX (Bio-Rad, USA).
Plant Cell Rep (2011) 30:1603–1616
the antibody pre-coated wells of ELISA plate and detection
of Cry1Ac protein was monitored at 655 nm using Spectra
Max 340PC spectrophotometer (Molecular Devices, USA).
Expression levels were quantified on a linear standard
curve plotted with pure Bt-Cry1Ac protein (Agdia, USA).
Insect bioassay
An insect mortality bioassay was performed by challenging
leaves from control and transgenic chickpea plants with
second instar larvae of H. armigera. The larvae were
routinely reared on an artificial diet at 25 ± 1°C, 70%
relative humidity with a 16/8 h light/dark photoperiod
(Ahmed et al. 1998). Ten larvae were released on a leaf
from each transgenic plant in triplicate sets and allowed to
feed for 4 days and thereafter the larvae were collected,
weighed and the differences in weights were recorded. The
effect of Cry toxin on insect larvae was observed for their
growth and overall health compared to larvae fed on nontransformed chickpea plants.
Statistical analyses
Three separate replicates of 25 explants were used for each
treatment during optimization of parameters for Agrobacterium-mediated transformation and each experiment was
repeated at least twice. Results were analyzed by one-way
ANOVA and means were compared for level of significance (p B 0.005) by Duncan’s Multiple Range Test
(DMRT) using Statistical Package for Social Sciences
(SPSS) software. For the insect bioassay 10 second instar
larvae were used per experiment and each experiment was
repeated twice with three replicates. Segregation analysis
of transgene in T1 progeny was analyzed by Chi-square test
at 5% level of significance (p B 0.05).
Results
Transformation of chickpea embryogenic callus
Quantitative estimation of Cry1Ac protein
Quantitative estimation of insecticidal Cry1Ac endotoxin
protein in leaves of transgenic chickpea plants was performed by double antibody sandwich enzyme linked
immunosorbent assay (DAS-ELISA) using peroxidase
labeled PathoScreen Kit for Cry1A protein, according to
manufacturer’s instructions (Agdia, USA). Total protein
from plant tissues was extracted (Agarwal et al. 2008) and
concentration in cell-free extracts was determined as total
soluble protein (TSP) by dye-binding procedure taking
bovine serum albumin as a standard protein (Bradford
1976). Cell-free extracts of plant samples were added into
123
To establish a more efficient method for Agrobacteriummediated transformation of chickpea, we used callus
derived from MEA for transformation and regeneration of
transgenic plants via somatic embryogenesis. A. tumefaciens strain LBA4404 harboring plasmid p35SGUS-INT
was used to evaluate and optimize different parameters and
physiological conditions for T-DNA transfer into callus
while the pRD400-cry1Ac construct was used to incorporate the insect resistant trait in chickpea. Various factors
affecting regeneration of transformed somatic embryos
were explored and systematically optimized including age
of callus, Agrobacterium cell density, co-cultivation period
Plant Cell Rep (2011) 30:1603–1616
1607
and temperature, acetosyringone concentration, period of
sonication and vacuum infiltration, sensitivity of embryogenic callus to kanamycin.
20 min significantly decreased transformation efficiency
and the number of GUS foci per responding explant
(Fig. 2d).
Effect of callus age
Effect of acetosyringone concentration
To determine the effect of callus age on genetic transformation, 0-, 10-, 20- and 30-day-old callus derived from
MEA of chickpea (variety P-362) mature seeds were subjected to Agrobacterium co-cultivation with p35SGUS-INT
and analyzed for GUS expression. Ten-day-old callus
having smaller globule shape cells with big nuclei and
condensed cytoplasm resulted in 74.3% regeneration
response with 17.2 GUS foci per responding explant, while
the increase in callus age resulted in hardening of the callus
and a decrease in the percentage of embryos that responded
for regeneration down to 1% with 0.3 GUS foci per
responding explant for 30-day-old callus (Fig. 2a).
Acetosyringone at four concentrations of 50, 100, 200 and
300 lM were added into co-cultivation medium to determine the effect of this synthetic phenolic compound on
transformation frequency. Supplementation of acetosyringone up to 200 lM gradually increased responding explants
to 68.3% with GUS foci per responding explant to 24.6 in
contrast to 2.5 observed in absence of acetosyringone, while
further increase to 300 lM concentration resulted into significant reduction in percentage regeneration response as
well as number of GUS foci per responding explant (Fig. 2e).
Effect of Agrobacterium cell density
The effect of Agrobacterium cell density was determined
by transforming 10-day-old MEA-derived callus with 0.1,
0.2, 0.3, 0.6, and 1.0 OD600 of Agrobacterium cell suspension. An histochemical GUS assay performed after
15 days of transformation showed 12.5 GUS foci per
responding explant with 90.6% transformation frequency at
OD600 0.3 (Fig. 2b). Cell densities lower than 0.3 showed
lower (40%) transformation frequency with reduced number (2.5) of GUS foci per responding explant, while higher
cell density (OD600 1.0) resulted in complete colonization
of bacteria on explants, which is more difficult to eliminate
during further selection and screening regimes.
Ten-day-old MEA-derived calluses were transformed and
co-cultivated for 12, 24, 48 and 72 h at different temperatures of 20, 22, 24, 28 and 30°C to evaluate the effect of cocultivation duration and temperature on transformation
efficiency. Co-cultivation for 48 h was found to be optimal
for transforming callus as evident with 66.7% regeneration
response with 28.9 GUS foci per responding explant. Longer
co-cultivation duration resulted into superfluous proliferation of bacteria and consequently decreased regeneration
frequency and GUS expression (Fig. 2f). The highest GUS
expression was found at co-cultivation temperature of 20°C
where 67.8% callus responded for GUS activity. Increasing
co-cultivation temperature also resulted in a decrease in
regeneration response down to 29% at 30°C (Fig. 2g).
Effect of sonication and vacuum infiltration
Sensitivity of chickpea callus to Kanamycin
To evaluate the effect of sonication on T-DNA transfer and
regeneration of transformed somatic embryos, 10-day-old
MEA-derived callus was sonicated for 2, 4, 6, 8, 10 and
20 s in presence of Agrobacterium cell suspension of
OD600 0.3. Results showed that sonication for 4 s gives
57.4% regeneration response with 38.6 GUS foci per
responding explant as compared to 70.8% regeneration
response with 8.9 GUS foci per responding explant in nonsonicated conditions. An increase in sonication duration
beyond 4 s resulted in fragmentation of the embryonic
culture followed by necrosis upon sub-culturing and
eventually significant reduction of responding transformed
explants with GUS foci (Fig. 2c). Vacuum treatment for
6 min in addition to sonication for 4 s was found to
increase success both in terms of responding explants to
65.1% and GUS foci per responding explant to 29.6.
Increase in vacuum infiltration treatment up to 8, 10 or
MEA-derived calluses were tested for their sensitivity to
kanamycin at various concentrations from 0 to100 mg l-1
(Fig. 2h). Calluses cultured on kanamycin medium did not
show any significant physiological changes for first 7 days
on any concentration of antibiotics tested. Kanamycin
concentration at 50 mg l-1 served as an efficient selective
agent, where the escapes or non-transformed tissues can be
visually recognized by necrosis and bleaching. Increasing
kanamycin concentration beyond 50 mg l-1 resulted into
significant decrease in regeneration response to 47.3% as
compared to 84.6% in control without kanamycin.
Effect of co-cultivation period and temperature
Selection and regeneration of transgenic
chickpea plants
Independent T0 transgenic chickpea plantlets were generated following Agrobacterium-mediated transformation of
123
1608
Fig. 2 Optimization of different parameters for efficient transformation of callus derived from chickpea MEA. Data represented as
percentage responding explants (open square) and histochemical
GUS expression as GUS foci per responding explant (filled diamond).
a Effect of callus age, b effect of Agrobacterium cell density, c effect
of sonication, d effect of vacuum infiltration, e effect of acetosyringone concentration, f effect of co-cultivation time, g effect of
123
Plant Cell Rep (2011) 30:1603–1616
co-cultivation temperature, h effect of kanamycin concentration on
explants. Histochemical GUS expression in callus explants transformed with strain LBA4404 harboring p35SGUS-INT. Data
(% responding explants) represents the percentage of inoculated
explants displaying GUS ? spots after 15 days of infection
(mean ± standard error of three experiments each having 25
explants)
Plant Cell Rep (2011) 30:1603–1616
10-day-old MEA-derived calluses under optimized conditions. Five independent transformation experiments for
p35SGUS-INT and ten for pRD400-cry1Ac were performed using 50 explants per experiment. After co-cultivation, transformed calluses were subjected to screening on
selection medium containing 250 mg l-1 cefotaxime and
50 mg l-1 kanamycin with sub-culturing after every
10 days. During kanamycin selection cream yellow colored
resistant callus grew vigorously and developed mature
somatic embryos (Fig. 3a–e), whereas non-transformed
callus did not show any growth and turned brown. A total
of 750 explants were transformed with binary vectors
p35SGUS-INT and pRD400-cry1Ac, which resulted in a
total of 1,098 globular embryos after kanamycin selection
and screening (Table 1). These globular embryos after
conversion developed 89 converted embryos with 17.1%
conversion frequency per responding explant. Twenty-six
of these converted embryos after germination formed 26 T0
putative transgenic plantlets including 18 for pRD400cry1Ac and 8 for p35SGUS-INT, achieving a plantlet
regeneration frequency of 5% and transformation frequency up to 3.6% as compared to untransformed control
where plantlet formation frequency was achieved to 14.5%
(Table 1). All putative T0 transgenic plantlets were further
verified by molecular characterization (PCR, Southern
hybridization) and found positive for stable transgene
integration. The transgenic nature of calluses transformed
with p35SGUS-INT were verified by histochemical GUS
assay at different developmental stages of somatic embryos
during transgenic plantlet regeneration via somatic
embryogenesis and demonstrated as embryogenic calluses
(Fig. 3f), globular (Fig. 3g), torpedo (Fig. 3h), developing
dicotyledonary embryo (Fig. 3i), and leaves of transformed
plantlet (Fig. 3k). These results demonstrated the independent and non-chimeric nature of transgenic chickpea
plants developed via somatic embryogenesis. Developed
transgenic plantlets were transferred to pots for growth,
maturity and seed setting in contained glasshouse and
investigated further for transgene inheritance and segregation (Fig. 3j, l, m).
Molecular characterization of transformants
Genomic DNA and total RNA from putative transformants
of p35SGUS-INT and pRD400-cry1Ac were used for
transgene integration and expression analyses by PCR, RTPCR and Southern hybridization. PCR results of promising
transformants showed amplification of anticipated 506, 995
and 678 bp amplicons for uidA, cry1Ac and nptII genes,
respectively, which were similar to plasmid DNA positive
controls developed with gene-specific set of internal primers
(Fig. 4a–d). However, no such amplification was observed
1609
with untransformed control plantlets under identical assay
conditions with either set of primers. RT-PCR analyses also
revealed amplification of expected fragments of 506 bp for
uidA and 995 bp for cry1Ac genes, which verify the transcript formation of respective genes in the transgenic plants
(Fig. 4g, h). Southern hybridization analysis revealed the
genomic organization and number of inserts in independent
transgenic events. Genomic DNA from untransformed and
transformed putative T0 transformants were digested with
EcoRI and subsequently hybridized with 2.0 and 1.8 kb fulllength coding sequences of uidA and cry1Ac as probe,
respectively. The hybridization pattern of individual T0
transgenic plants revealed single copy integration ranged in
sizes from 3.548 to 5.821 kb, while untransformed control
plant did not show hybridization with either gene probe
(Fig. 4e, f).
Expression of Bt-crystal protein in transgenic
chickpea plants
A quantitative estimation of Bt-Cry protein expressed in
leaves of independent T0 transgenic chickpea plants
generated with pRD400-cry1Ac construct was performed
by DAS-ELISA assay. The concentration of expressed
recombinant Cry1Ac protein amongst 18 independent
transgenic chickpea plants (C1–C18) varied from 10 to
112 ng mg-1 soluble protein (Fig. 5a), while no Cry
protein was detected in untransformed chickpea plants.
Immunological studies were performed to assess the
level of Cry protein during different developmental
stages of transformed somatic embryos. Results showed
that level of d-endotoxin increased with maturation of
transformed somatic embryos with a maximum Cry
protein expression in transformed dicot embryos (data
not shown).
Insect bioassay
Insecticidal activity of T0 transgenic chickpea plants
expressing Bt-Cry protein was assayed through leaf
feeding bioassay using second instar larvae of H. armigera. Each experiment was repeated twice with three
replicates. Extensive feeding of plant tissues ([90%) by
the larvae was observed for untransformed control plants
and larvae were healthy, active and showed a normal
developmental cycle. No surviving larva was observed
after 4 days of incubation on plants expressing higher
level (70–112 ng mg-1 soluble protein) of Cry1Ac protein (C16–C18). These plants showed high resistance to
the insect and suffered very little feeding damage to
leaves (Fig. 5b). Insect mortality data indicated a range
from 12 to 100% in T0 Bt-transgenic chickpea plant
123
1610
Plant Cell Rep (2011) 30:1603–1616
Fig. 3 Different developmental stages of somatic embryos after
Agrobacterium-mediated transformation of MEA-derived embryogenic callus with p35SGUS-INT. a Different developmental stages of
chickpea somatic embryogenesis (940), b excised MEA (910),
c callus showing globular embryos (940), d torpedo shaped embryos
(910), e germinating dicotyledonary embryos showing root and shoot
(arrows) formation (910), f histochemical GUS expression in callus
(910), g globular embryo (9100), h torpedo shaped embryo (910),
i developing dicotyledonary embryo (940). j Complete plantlet
regenerated via somatic embryogenesis after Agrobacterium-mediated transformation. k Stable GUS expression in leaves of fully
developed transgenic plant (940). l Hardening and acclimatization of
transgenic plantlet. m Fully developed transgenic plant in glasshouse
showing pods (arrow)
population which is in correspondence with the level of
Bt-Cry protein in independent transgenic plants, determined by ELISA (Table 3; Fig. 5a). Plants expressing
moderate level of crystal protein showed severely
affected larval growth with impaired life cycle and early
pupation.
123
Plant Cell Rep (2011) 30:1603–1616
1611
Table 1 Summary of genetic transformation of chickpea embryogenic calli with different binary vectors
Construct
Number of
explants
Embryogenic
responding
explantsa
Globular
embryos
(GE)
GE/
responding
explantb
Transformed
converted
embryos
p35SGIe
250
168
378
2.3
29
8
4.8
pRD400f
500
354
720
2.1
60
18
5.1
NTCg
150
138
510
3.7
35
20
14.5
a
Mature
plantlets
formed
Regeneration
frequencyc (%)
Transformation
frequencyd (%)
3.2
3.6
–
Calluses responding for embryo formation, selected on kanamycin for p35SGI, pRD400-cry1Ac and without kanamycin for NTC
b
Number of globular embryos formed per embryogenic responding explant
c
The percentage of mature plantlets formed per embryogenic responding explant
d
The percentage of mature plantlets formed per explant
e
p35SGUS-INT
f
pRD400-cry1Ac
g
Non-transformed control
Fig. 4 Molecular characterization of T0 transgenic chickpea plants
developed with different binary vectors. Randomly selected transgenic chickpea plantlets transformed with p35SGUS-INT and PCR
amplification of a 506 bp of uidA gene and b 678 bp of nptII gene
using specific primers. Plants transformed with pRD400-cry1Ac and
PCR amplification of c 995 bp of cry1Ac gene and d 678 bp of nptII
gene using specific primers. Southern hybridisation analysis of
randomly selected transgenic chickpea plants of e p35SGUS-INT
and f pRD400-cry1Ac probed with radiolabeled full-length uidA and
cry1Ac gene, respectively. ?C Full-length BamHI/SacI gene fragments of uidA (2.0 kb) and cry1Ac (1.8 kb), respectively. RT-PCR
analysis of randomly selected transgenic chickpea plants of
g p35SGUS-INT and h pRD400-cry1Ac showing 506 and 995 bp
amplicons of uidA and cry1Ac gene transcripts, respectively.
M 100 bp DNA ladder (NEB, USA), -C non-transgenic control
plant, ?C plasmid DNA positive control
Inheritance analysis of cry gene in T1 progeny
according to Mendelian ratio 3:1 (resistant:susceptible,
p B 0.05, v2 = 3.841) for kanamycin tolerance (Table 2).
PCR analysis of T1 progenies of selected T0 plants showed
amplification of desired amplicons of 995 bp for cry1Ac
and 678 bp for nptII genes, respectively, similar to that of
plasmid DNA positive controls (Fig. 6a, b). RT-PCR
analysis also showed amplification of 995 bp amplicon of
cry1Ac in similar T1 transgenic plants (Fig. 6c). Southern
analysis results showed hybridization of 4.16–5.57 kb
DNA fragments for randomly selected T1 transgenic plants
of pRD400-cry1Ac. Results of Southern hybridization
showed inheritance of cry gene as single copy inserts in T1
The transgenic chickpea plants had a normal flowering
pattern, except there were fewer flowers; this could be due
to physiological conditions from culture room to contained
glasshouse. Number of pods and seeds in T0 transgenic
chickpea plants were also reduced as compared to tissue
culture raised untransformed plants. The inheritance pattern of cry1Ac gene in T1 progeny of primary transformants
was analyzed by germinating the seeds on kanamycinsupplemented medium (50 mg l-1). Antibiotic screening
of T1 seeds followed by PCR analysis revealed segregation
123
1612
Fig. 5 a Quantitative assessment of Bt-Cry protein estimated by
DAS-ELISA as ng mg-1 soluble protein (open square) and corresponding insect mortality (filled diamond) estimated by insect
mortality bioassay in different T0 transgenic chickpea plants (C1–
C18). Data represents mean ± standard error of three experiments.
b Insect mortality bioassay of Bt transgenic and control chickpea
plants with second instar larvae of Helicoverpa armigera
progeny (Fig. 6d). Quantitative estimation of Bt-Cry protein in leaves of T1 transgenic chickpea plants showed
expression range from 26 to 116 ng mg-1 soluble protein
(Table 3). Insect mortality bioassay performed with
promising T1 transgenic plants showed insect mortality in a
range from 30 to 100% which is in correspondence with the
level of Bt-Cry protein in independent transgenic plant
(Table 3).
Discussion
A major application of gene transfer technology is the
introduction of agronomically useful traits into crop plants;
this requires availability of efficient methods for transformation, selection and regeneration of economically
important genotypes. Success has also been achieved in
transfer of agronomically important traits to improve plants
in terms of quality and quantity (Sharma et al. 2005).
Genetic transformation for incorporation of foreign traits
123
Plant Cell Rep (2011) 30:1603–1616
has been achieved in some grain legumes. But there are
very few reports on agronomically important gene transfer
in chickpea (Anwar et al. 2010). In most of previous
reports on Agrobacterium-mediated transformation of
chickpea, either embryo axes or slices of embryo axes were
used as target tissue where mode of regeneration of
transgenic plant is direct organogenesis and efficiency of
transformation was found to be low (Fontana et al. 1993;
Kar et al. 1996, 1997; Krishnamurthy et al. 2000; Polowick
et al. 2004; Senthil et al. 2004). Other reports using
decapitated embryo explant attached with one half of the
cotyledon produced a lot of escapes after Agrobacteriummediated transformation that drastically reduced the
transformation efficiency (Jayanand et al. 2003; Sarmah
et al. 2004; Tewari-Singh et al. 2004). In addition, establishment of rooting in transgenic shoots on antibiotics
supplemented medium was found to be very laborious and
time consuming (Anwar et al. 2010).
Here we report for the first time a stable and efficient
Agrobacterium-mediated transformation system using
MEA-derived callus of chickpea and regeneration of T0
and T1 transgenic plants harboring Bt-cry1Ac gene via
somatic embryogenesis. This system insures potency of a
cultivar embryogenesis and shortens the time of tissue
culture by directly transforming 10-day-old callus derived
from MEA with Agrobacterium and regeneration of nonchimeric mature transgenic chickpea plants in 80 days. The
cells of chickpea callus used for Agrobacterium-mediated
transformation were endorsed with characteristic smaller
size, condensed cytoplasm and rapidly dividing nature
(Barna and Wakhlu 1993). Secondly, it is convenient to
obtain a mass of material for transformation in a short time
presumably initiated from single cell leading for non-chimeric events. From this study it is evident that various
physiochemical factors such as age of callus, density of
bacterial cells, duration and temperature of co-cultivation,
antibiotic selection play a major role for Agrobacteriummediated transformation of MEA-derived callus. In addition inclusion of acetosyringone in co-cultivation medium
enhanced the transformation frequency as already reported
in chickpea and in other crops (Hiei et al. 1994; Polowick
et al. 2004; Sanyal et al. 2005; Pandey et al. 2010).
Acetosyringone is suggested as the best phenolic vir
inducer, containing an unsaturated lateral chain which
increases virulence induction and also transformation efficiency. Our results on favorable effect of sonication along
with vacuum infiltration on transformation are in agreement with soybean (Trick and Finer 1998), chickpea
(Sanyal et al. 2005; Pathak and Hamzah 2008) and Withania (Pandey et al. 2010). Use of antibiotic resistance
marker included in the vector along with the desired gene
gives a convenient and efficient system for removal of
escapes. Cefotaxime at 250 mg l-1 did not inhibit
Plant Cell Rep (2011) 30:1603–1616
1613
Table 2 Segregation analysis of T1 transgenic chickpea seeds of
pRD400-cry1Ac
T0 transgenic
plants
Response of seeds on kanamycin
selection medium
v2
Total
Kanr
Kans
valuea
C3
4
2
2
1.33
C5
3
2
1
0.11
C8
2
2
0
0.67
C11
3
2
1
0.11
C12
5
4
1
0.07
C14
3
2
1
0.11
C15
7
5
2
0.05
C16
6
4
2
0.22
C17
5
3
2
0.6
C18
3
2
1
0.11
a
v21 =
r
3.841 at p B 0.05
Kan kanamycin resistant, Kans kanamycin sensitive
induction of somatic embryogenesis in chickpea as shown
earlier for other grain legumes (Wiebke et al. 2006).
However, increasing the concentration to 500 mg l-1
inhibited further early globular stage differentiation as well
as embryo conversion. Some somatic embryos failed to
convert into normal germinating cotyledonary embryos
possibly due to different antibiotics used in the selection
medium (Yu et al. 2001; Wiebke et al. 2006). Kanamycin
exposure appeared to have higher impact on regeneration at
early stages of embryogenesis rather than later stages of
differentiation (Araújo et al. 2004). Torpedo and dicotyledonary stage of transgenic somatic embryos were
apparent after 30–45 days of culture, whereas non-transgenic embryos bleached or became brown following direct
contact with selective medium. The presence of an intron
in the uidA gene guards against false positives that may
result from expression of gene in A. tumefaciens. Therefore, an initial GUS assay showed the presence of transgene while PCR and Southern hybridization analysis of the
Fig. 6 Molecular characterization of T1 transgenic chickpea plants of
pRD400-cry1Ac. PCR amplification of a 995 bp of cry1Ac gene and
b 678 bp of nptII gene using gene-specific primers. c RT-PCR
analysis showing 995 bp amplicon of cry1Ac gene transcript.
transgenic plants confirmed stable integration of gus gene
into chickpea plant genome.
Transgenic plants expressing various crystalline insecticidal proteins encoded from B. thuringiensis cry genes
have shown significant resistance to number of insect pests
of agricultural crops, resulting in the reduced application of
synthetic pesticides and improved yield (Glaser and Matten
2003). In the present report, the transformation system
developed was further exploited for the production of
chickpea transgenic plants harboring Bt-cry1Ac gene
resistant to pod borer insect H. armigera. Following the
Agrobacterium co-cultivation conditions, sequential and
serial screening, sub-culturing of transformed embryogenic
cells on kanamycin-supplemented medium resulted into
non-chimeric transformed somatic embryos with an
embryo conversion rate of 17.1% and transformation frequency up to 3.6%. In chickpea, earlier work using Agrobacterium-mediated gene transfer showed transformation
frequency rate of 0.5–3% (Polowick et al. 2004; Senthil
et al. 2004). Transformation frequency using particle gun
bombardment was also found to be low (Tewari-Singh
et al. 2004) or not recorded (Kar et al. 1996). However,
Indurker et al. (2007) reported a transformation frequency
of 18% in chickpea using particle gun bombardment as a
method of transformation. T0 transgenic plants obtained
from independent transformation events were characterized
by PCR, RT-PCR, Southern and immunological assays to
verify the integration and expression of uidA and cryIAc
genes in chickpea plants. Results clearly confirmed the
stable integration without any rearrangements of uidA and
cry1Ac gene in chickpea genome. Southern hybridization
using independent T0 plant transformants indicated variation in hybridization signals, which could be due to random
gene integration in chickpea genome. Immunological
studies performed for quantitative assessment of Cry protein in T0 and T1 transgenic chickpea plants by ELISA
showed a maximum expression of 116 ng mg-1 soluble
protein, which is about five to six folds higher in comparison to the earlier reports of Bt transgenic chickpea
d Southern hybridisation analysis of randomly selected transgenic
chickpea plants probed with radiolabeled full-length 1.8 kb BamHI/
SacI fragment of cry1Ac gene (?C)
123
1614
Table 3 Bt-toxin expression
and insect mortality in T0 and
T1 transgenic chickpea plants of
pRD400-cry1Ac
Plant Cell Rep (2011) 30:1603–1616
T0
planta
C3
Bt toxin
(ng mg-1 TSP)b
46
Insect mortality
(%)c
53
C5
35
43
C8
33
41
C11
C12
32
64
40
80
C14
48
56
C15
33
42
a
Promising T0 transgenic
chickpea plants selected on the
basis of Bt-toxin expression
C16
75
98
b
Bt protein expression level
determined by DAS-ELISA
assay
c
Determined by insect
bioassay of transgenic plants
with second instar larvae
of H. armigera
d
C17
C18
97
112
Kanamycin resistant T1
transgenic chickpea plants
plants harboring cry1Ac gene (Kar et al. 1997; Sanyal et al.
2005; Indurker et al. 2007). Differences in the Cry1Ac
protein expression levels in the transgenic plant population
could be attributed to the site of gene integration in
chickpea genome. An insect bioassay performed for T0 and
T1 transgenic chickpea plants showed significant reduction
in larval weight followed by mortality compared to larvae
fed on control plants. Larvae fed on transgenic plants
stopped feeding and most of the plant parts remained
unaffected, whereas the larvae on untransformed plants fed
voraciously. An insect bioassay performed with second
instar larvae of H. armigera had been previously reported
for 100% insect mortality in tomato, chickpea and cotton
transgenic plants expressing Bt-cry1Ac gene (Mandaokar
et al. 2000; Sanyal et al. 2005; Bakhsh et al. 2009)
The primary transgenic plants of T0 generation have
reflected independent and varied pattern of transgene
expression due to random integration of transgene in the
host genome, therefore, generating stable transgenic plants
of further generations expressing higher levels of Cry
123
100
100
T1
Progenyd
Bt toxin
(ng mg-1 TSP)b
Insect mortality
(%)c
C3.1
44
55
C3.2
40
50
C5.1
36
45
C5.2
34
40
C8.1
30
38
C8.2
28
35
C11.1
26
30
C11.2
33
42
C12.1
68
88
C12.2
62
82
C12.3
C12.4
60
64
78
85
C14.1
42
50
C14.2
44
50
C15.1
30
40
C15.2
28
35
C15.3
34
44
C15.4
29
36
C15.5
32
42
C16.1
76
92
C16.2
74
90
C16.3
69
89
C16.4
80
96
C17.1
100
99
C17.2
95
98
C17.3
C18.1
90
116
95
100
C18.2
98
99
protein is important. Results obtained from Southern blot
and RT-PCR analyses have clearly confirmed the stable
integration and segregation of cry1Ac gene in T1 generation. In our present investigation, we have not recorded any
rearrangement of cry gene and obtained the expected 3:1
Mendelian segregation ratio in the selfed T1 transgenic
chickpea population. All the T1 transgenic plants obtained
were healthy and further grown to maturity and seed set.
In conclusion, the system for Agrobacterium-mediated
transformation of chickpea embryogenic callus reported for
the first time in the present report is regarded as simple,
reliable and more efficient than conventional methods of
chickpea transformation. The present protocol also
describes an efficient and reproducible method for nonchimeric chickpea mature plant regeneration in 80 days.
MEA-derived callus as an explant also offers an inexpensive method to obtain transformed embryos with increased
transformation efficiency. Stable transgenic chickpea
plants expressing Bt-cry gene showed effective protection
against H. armigera. Further efforts will be aimed toward
Plant Cell Rep (2011) 30:1603–1616
development of chickpea transgenic plants with novel traits
for crop improvement.
Acknowledgments We are thankful to Council of Scientific and
Industrial Research, New Delhi for providing funds and research
fellowships. We thankfully acknowledge Prof. I. Altosaar, Department of Biochemistry, University of Ottawa, Ottawa, Canada for
providing synthetic modified Bt-cry1Ac gene. This work was carried
out under the CSIR Network Project NWP0003 and OLP0031.
References
Agarwal S, Singh R, Sanyal I, Amla DV (2008) Expression of
modified gene encoding functional human alpha-1-antitrypsin
protein in transgenic tomato plants. Transgenic Res 17:881–896
Ahmed K, Khalique F, Malik BA (1998) Modified artificial diet for
mass rearing of Chickpea Pod borer, Helicoverpa armigera (H.).
Pak J Biol Sci 1:183–187
Anwar F, Sharmila P, Saradhi PP (2010) No more recalcitrant:
chickpea regeneration and genetic transformation. Afr J Biotechnol 9:782–797
Araújo SS, Duque ASRLA, Santos DMMF, Fevereiro MPS (2004) An
efficient transformation method to regenerate a high number of
transgenic plants using a new embryogenic line of Medicago
truncatula cv. Jemalong. Plant Cell Tissue Organ Cult 78:
123–131
Babaoglu M, Davey MR, Power JB (2000) Genetic engineering of
grain legumes: key transformation events. AgBiotechNet 2:1–8
Bakhsh A, Rao AQ, Shahid AA, Husnain T, Riazuddin S (2009)
Insect resistance and risk assessment studies in advance lines of
Bt cotton harboring Cry1Ac and Cry2A genes. Am Eur J Agric
Environ Sci 6(1):1–11
Barna KS, Wakhlu AK (1993) Somatic embryogenesis and plant
regeneration from callus cultures of chickpea (Cicer arietinum
L.). Plant Cell Rep 12:521–524
Bradford MM (1976) A rapid and sensitive method for the
quantitation of protein utilizing the principle of protein dye
binding. Anal Biochem 72:248–254
Coram TE, Mantri NL, Ford R, Pang ECK (2007) Functional
genomics in chickpea: an emerging frontier for molecularassisted breeding. Funct Plant Biol 34:861–873
Dang W, Wei Z-M (2007) An optimized Agrobacterium-mediated
transformation for soybean for expression of binary insect
resistance genes. Plant Sci 173:381–389
Datta K, Vasquez A, Tu J, Torrizo L, Alam MF, Oliva N, Abrigo E,
Khush GS, Datta SK (1998) Constitutive and tissue-specific
differential expression of the cry1Ab gene in transgenic rice
plants conferring resistance to rice insect pests. Theor Appl
Genet 97:20–30
Droste A, Pasquali G, Bodanese-Zanettini MH (2000) Integrated
bombardment and Agrobacterium transformation system: an
alternative method for soybean transformation. Plant Mol Biol
Rep 18:51–59
Fontana GS, Santini L, Caretto S, Frugis G, Mariotti D (1993) Genetic
transformation in the grain legume Cicer arietinum L. (chickpea). Plant Cell Rep 12:194–198
Gamborg OL, Miller RA, Ojima K (1968) Nutrient requirements of
suspension cultures of soybean root cells. Exp Cell Res
50:150–158
Glaser JA, Matten SR (2003) Sustainability of insect resistance
management strategies for transgenic Bt corn. Biotechnol Adv
22:45–69
1615
Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and
sequence analysis of the boundaries of the T-DNA. Plant J
6:271–282
Indurker S, Misra HS, Eapen S (2007) Genetic transformation of
chickpea (Cicer arietinum L.) with insecticidal crystal protein
gene using particle gun bombardment. Plant Cell Rep 26:
755–763
Jayanand B, Sudarsanam G, Sharma KK (2003) An efficient protocol
for the regeneration of whole plants of chickpea (Cicer arietinum
L.) by using axillary meristem explants derived from in vitro
germinated seedlings. In Vitro Cell Dev Biol 39:171–179
Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: betaglucuronidase as a sensitive and versatile gene fusion marker in
higher plants. EMBO J 6:3901–3907
Kar S, Johnson TM, Nayak P, Sen SK (1996) Efficient transgenic
plant regeneration through Agrobacterium-mediated transformation of chickpea (Cicer arietinum L.). Plant Cell Rep 16:32–37
Kar S, Basu D, Das S, Ramakrishanan NA, Mukherjee P, Nayak P
et al (1997) Expression of cry1Ac gene of Bacillus thuringiensis
in transgenic chickpea plants inhibits development of pod borer
(Heliothis armigera) larvae. Transgenic Res 6:177–185
Krishnamurthy KV, Suhasini K, Sagare AP, Meixner M, De Kathen
A, Pickardt T, Schieder O (2000) Agrobacterium-mediated
transformation of chickpea (Cicer arietinum L.) embryo axes.
Plant Cell Rep 19:235–240
Kumar VD, Kirti PB, Sachan JKS, Chopra VL (1994) Plant
regeneration via somatic embryogenesis in chickpea (Cicer
arietinum L.). Plant Cell Rep 13:468–472
Leelavathi S, Sunnichan VG, Kumria (2004) A simple and rapid
Agrobacterium-mediated transformation protocol for cotton
(Gossypium hirsutum L.): embryogenic calli as a source to
generate large numbers of transgenic plants. Plant Cell Rep
22(7):465–470
Mandaokar AD, Goyal RK, Shukla A, Bisaria S, Bhalla R, Reddy VS,
Chaurasia A, Sharma RP, Altosaar I, Kumar PA (2000)
Transgenic tomato plants resistant to fruit borer (Helicoverpa
armigera Hubner). Crop Prot 19:307–312
Murashige T, Skoog F (1962) A revised medium for rapid growth and
bioassays with tobacco tissue cultures. Physiol Plant 15:473–497
Nhut DT, Hanh NTM, Tuan PQ, Nquyet LTM, Tram NTH, Chinh
NC, Nguyen NH, Vinh DN (2006) Liquid culture as a positive
condition to induce and enhance quality and quantity of somatic
embryogenesis of Lilium longiflorum. Sci Hortic 110:93–97
Pandey V, Misra P, Chaturvedi P, Mishra MK, Trivedi PK, Tuli R
(2010) Agrobacterium tumefaciens mediated transformation of
Withania somnifera (L.) Dunal: an important medicinal plant.
Plant Cell Rep 29:133–141
Pathak MR, Hamzah RY (2008) An effective method of sonicated
assisted Agrobacterium-mediated transformation of chickpea.
Plant Cell Tissue Organ Cult 93:65–67
Polowick PL, Baliski DS, Mahon JD (2004) Agrobacterium tumefaciens-mediated transformation of chickpea (Cicer arietinum L.);
gene integration, expression and inheritance. Plant Cell Rep
23:485–491
Ramesh S, Nagadhara D, Pasalu IC, Padma Kumari A, Sarma NP,
Reddy VD, Rao KV (2004) Development of stem borer resistant
transgenic parental lines involved in the production of hybrid
rice. J Biotechnol 111:131–141
Sagare AP, Suhasini K, Krishnamurthy KV (1993) Plant regeneration
via somatic embryogenesis in chickpea (Cicer arietinum L.).
Plant Cell Rep 12:652–655
Sambrook J, Russel DW (2001) Molecular cloning: a laboratory
manual. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York
123
1616
Sanyal I, Singh AK, Kaushik M, Amla DV (2005) Agrobacteriummediated transformation of chickpea (Cicer arietinum L.) with
Bacillus thuringiensis cry1Ac gene for resistance against pod
borer insect Helicoverpa armigera. Plant Sci 168:1135–1146
Sardana R, Dukiandjiev S, Giband M, Cheng X, Cowan K, Sauder C,
Altosaar I (1996) Construction and rapid testing of synthetic and
modified toxin gene sequences CryIA (b & c) by expression in
maize endosperm culture. Plant Cell Rep 15:677–681
Sarmah BK, Moore A, TateW MorvigL, Morton RL, Rees RP et al
(2004) Transgenic chickpea seeds expressing high levels of a
bean a-amylase inhibitor. Mol Breed 14:73–82
Senthil G, Williamson B, Dinkin RD, Ramsay G (2004) An efficient
transformation system for chickpea. Plant Cell Rep 23(5):
297–303
Sharma KK, Mathur PB, Thorpe TA (2005) Genetic transformation
technology: status and problems. In Vitro Cell Dev Biol 4:
102–112
Singh PK, Kumar M, Chaturvedi CP, Yadav D, Tuli R (2004)
Development of a hybrid d-endotoxin and its expression in
tobacco and cotton for control of a polyphagous pest Spodoptera
litura. Transgenic Res 13:397–410
Somers DA, Samac DA, Olhoft PM (2003) Recent advances in
legume transformation. Plant Physiol 131:892–899
Stewart CN Jr, Adang MJ, All JN, Boerma HR, Cardineau G, Tucker
D, Parrott WA (1996) Genetic transformation, recovery and
characterization of fertile soybean transgenic for a synthetic
B. thuringiensis cry1Ac gene. Plant Physiol 112:121–129
123
Plant Cell Rep (2011) 30:1603–1616
Suhasini K, Sagare AP, Krishnamurthy KV (1994) Direct somatic
embryogenesis from mature embryo axes in chickpea (Cicer
arietinum L.). Plant Sci 102:189–194
Suzuki S, Supaibulwatana K, Mii M, Nakano M (2001) Production of
transgenic plants of Liliaceous ornamental plant Agapanthus
praecox ssp. orientalis (Leighton) Leighton via Agrobacteriummediated transformation of embryogenic calli. Plant Sci 161:
89–97
Tewari-Singh N, Sen J, Kiesecker J, Reddy VS, Jacobsen HJ, GuhaMukherjee S (2004) Use of a herbicide or lysine plus threonine
for non-antibiotic selection of transgenic chickpea. Plant Cell
Rep 22:576–583
Trick HN, Finer JJ (1998) Sonication-assisted Agrobacterium-mediated transformation of soybean [Glycine max (L.) Merr.] embryogenic suspension culture tissue. Plant Cell Rep 17:482–488
Wiebke B, Ferreira F, Pasquali G, Bodanese-Zanettini MH, Droste A
(2006) Influence of antibiotics on embryogenic tissue and
Agrobacterium tumefaciens suppression in soybean genetic
transformation. Bragantia 65:543–551
Wu S-J, Wang H-H, Li F-F, Chen T-Z, Zhang J, Jiang Y-J, Ding Y,
Guo W, Zhang T-Z (2008) Enhanced Agrobacterium-mediated
transformation of embryogenic calli of upland cotton via
efficient selection and timely subculture of somatic embryos.
Plant Mol Biol Rep 26:174–185
Yu TA, Yeh SD, Yang JS (2001) Effects of carbenicillin and
cefotaxime on callus growth and somatic embryogenesis from
adventitious roots of papaya. Bot Bull Acad Sin Nan 42:281–286